MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-300A10
Chromosome	14 (Build37)
Map Location	67,171,791 - 67,220,336
singlet/doublet	doublet
Overlap gene	none
Upstream gene	Elp3, Gm600, Scara5, Pbk, Esco2, Ccdc25, Scara3, Clu, Gulo, Adam2, LOC100043675, Ephx2, Chrna2, Ptk2b, LOC100043676, Trim35, Stmn4
Downstream gene	Adra1a, ENSMUSG00000057913, LOC668366, Dpysl2, EG432870, Pnma2, LOC672614, Bnip3l, Ppp2r2a, Ebf2, EG628416, LOC100043046, LOC100043056
Link	Open Mouse BAC browser

Click to get alignment info.

name	Elp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74195 MGI:1921445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239151 MGI:2685446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	Scara5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71145 MGI:1918395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pbk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52033 MGI:1289156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Esco2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71988 MGI:1919238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67179 MGI:1914429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scara3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219151 MGI:2444418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12759 MGI:88423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gulo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268756 MGI:1353434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11495 MGI:1340894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043675 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 325 ESTs, 6 Proteins

name	Ephx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13850 MGI:99500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrna2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110902 MGI:87886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptk2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19229 MGI:104908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Trim35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66854 MGI:1914104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stmn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56471 MGI:1931224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adra1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11549 MGI:104773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000057913 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:791407 MGI:3642901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC668366 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 209 ESTs, 10 Proteins pseudo : _no_value

name	Dpysl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12934 MGI:1349763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432870 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432870 MGI:3643060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnma2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239157 MGI:2444129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Bnip3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12177 MGI:1332659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71978 MGI:1919228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ebf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13592 MGI:894332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628416 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628416 MGI:3644701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043046 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043046
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100043056 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043056
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Elp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803224 GeneID:74195 MGI:1921445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation protein 3 homolog (S. cerevisiae) transcript_id : NM_028811.2

name	Gm600 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265646 GeneID:239151 MGI:2685446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : gene model 600, (NCBI) transcript_id : XM_001479352.1

name	Scara5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22296588 GeneID:71145 MGI:1918395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scavenger receptor class A, member 5 (putative) transcript_id : NM_028903.1

name	Pbk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802176 GeneID:52033 MGI:1289156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ binding kinase transcript_id : NM_023209.2

name	Esco2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859705 GeneID:71988 MGI:1919238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : establishment of cohesion 1 homolog 2 (S. cerevisiae) transcript_id : NM_028039.1

name	Ccdc25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672913 GeneID:67179 MGI:1914429
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 25 transcript_id : NM_145944.4

name	Scara3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377080 GeneID:219151 MGI:2444418
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scavenger receptor class A, member 3 transcript_id : NM_172604.2

name	Clu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304966 GeneID:12759 MGI:88423
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : clusterin transcript_id : NM_013492.1

name	Gulo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892400 GeneID:268756 MGI:1353434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gulonolactone (L-) oxidase transcript_id : NM_178747.3

name	Adam2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089326 GeneID:11495 MGI:1340894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 2 transcript_id : NM_009618.2

name	LOC100043675 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265778 GeneID:100043675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 325 ESTs, 6 Proteins product : similar to Translocase of inner mitochondrial membrane 23 homolog (yeast) transcript_id : XM_001480621.1

name	Ephx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131083 GeneID:13850 MGI:99500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epoxide hydrolase 2, cytoplasmic transcript_id : NM_007940.3

name	Chrna2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892762 GeneID:110902 MGI:87886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) transcript_id : NM_144803.2

name	Ptk2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387203 GeneID:19229 MGI:104908
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PTK2 protein tyrosine kinase 2 beta transcript_id : NM_172498.2

name	LOC100043676 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265780 GeneID:100043676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043676 transcript_id : XM_001480636.1

name	Trim35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133506655 GeneID:66854 MGI:1914104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 35 transcript_id : NM_029979.3

name	Stmn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981038 GeneID:56471 MGI:1931224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stathmin-like 4 transcript_id : NM_019675.2

name	Adra1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129926 GeneID:11549 MGI:104773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, alpha 1a transcript_id : NM_013461.3

name	ENSMUSG00000057913 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265782 GeneID:791407 MGI:3642901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : predicted gene, ENSMUSG00000057913 transcript_id : XM_001480647.1

name	Dpysl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254594 GeneID:12934 MGI:1349763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydropyrimidinase-like 2 transcript_id : NM_009955.2

name	EG432870 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352133 GeneID:432870 MGI:3643060
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432870 transcript_id : NM_001034881.2

name	Pnma2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41055909 GeneID:239157 MGI:2444129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paraneoplastic antigen MA2 transcript_id : NM_175498.3

name	Bnip3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542233 GeneID:12177 MGI:1332659
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2/adenovirus E1B interacting protein 3-like transcript_id : NM_009761.2

name	Ppp2r2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625885 GeneID:71978 MGI:1919228
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform transcript_id : NM_028032.1

name	Ebf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350241 GeneID:13592 MGI:894332
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early B-cell factor 2 transcript_id : NM_010095.3

name	EG628416 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375394 GeneID:628416 MGI:3644701
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG628416 transcript_id : NM_001037931.2

name	LOC100043046 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265653 GeneID:100043046
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to Mnn4p transcript_id : XM_001479401.1

name	Elp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469023 GeneID:74195 MGI:1921445
definition	GO_component : GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 product : elongation protein 3 homolog protein_id : NP_083087.1

name	Gm600 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265647 GeneID:239151 MGI:2685446
definition	codon_start : 1 product : similar to hCG17291 protein_id : XP_001479402.1

name	Scara5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22296589 CCDS:CCDS27214.1 GeneID:71145 MGI:1918395
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : scavenger receptor class A, member 5 protein_id : NP_083179.1

name	Pbk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963575 CCDS:CCDS27215.1 GeneID:52033 MGI:1289156
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018105 - peptidyl-serine phosphorylation [Evidence ISS]; GO:0018107 - peptidyl-threonine phosphorylation [Evidence ISS] codon_start : 1 note : T-LAK cell-originated protein kinase product : MAPKK-like protein kinase protein_id : NP_075698.1

name	Esco2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34787410 CCDS:CCDS27216.1 GeneID:71988 MGI:1919238
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : establishment of cohesion 1 homolog 2 protein_id : NP_082315.2

name	Ccdc25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164768 CCDS:CCDS27217.1 GeneID:67179 MGI:1914429
definition	codon_start : 1 product : coiled-coil domain containing 25 protein_id : NP_666056.1

name	Scara3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369868 GeneID:219151 MGI:2444418
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : scavenger receptor class A, member 3 protein_id : NP_766192.1

name	Clu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304967 GeneID:12759 MGI:88423
definition	GO_process : GO:0008219 - cell death [Evidence IEA] codon_start : 1 exception : mismatches in translation note : complement lysis inhibitor; testosterone repressed prostate message; Apolipoprotein J product : clusterin protein_id : NP_038520.1

name	Gulo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520195 GeneID:268756 MGI:1353434
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0003885 - D-arabinono-1,4-lactone oxidase activity [Evidence IEA]; GO:0050105 - L-gulonolactone oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016899 - oxidoreductase activity, acting on the CH-OH group of donors, oxygen as acceptor [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA]; GO:0019853 - L-ascorbic acid biosynthesis [Evidence IMP] codon_start : 1 note : L-gulono-gamma-lactone oxidase product : gulonolactone (L-) oxidase protein_id : NP_848862.1

name	Adam2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089327 GeneID:11495 MGI:1340894
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : fertilin beta; a disintegrin and metalloprotease domain 2 product : a disintegrin and metalloprotease domain 2 (fertilin beta) protein_id : NP_033748.2

name	LOC100043675 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265779 GeneID:100043675
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480671.1

name	Ephx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982393 CCDS:CCDS27218.1 GeneID:13850 MGI:99500
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0019439 - aromatic compound catabolism [Evidence IEA]; GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0009636 - response to toxin [Evidence IEA]; GO:0006805 - xenobiotic metabolism [Evidence IEA] codon_start : 1 product : epoxide hydrolase 2, cytoplasmic protein_id : NP_031966.2

name	Chrna2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450163 CCDS:CCDS27219.1 GeneID:110902 MGI:87886
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 product : cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) protein_id : NP_659052.1

name	Ptk2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369678 CCDS:CCDS27220.1 GeneID:19229 MGI:104908
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : protein tyrosine kinase 2 beta; cellular adhesion kinase beta; proline-rich tyrosine kinase 2; calcium-dependent tyrosine kinase; related adhesion focal tyrosine kinase product : PTK2 protein tyrosine kinase 2 beta protein_id : NP_766086.1

name	LOC100043676 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265781 GeneID:100043676
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480686.1

name	Trim35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133506656 CCDS:CCDS27221.1 GeneID:66854 MGI:1914104
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IDA] codon_start : 1 product : tripartite motif-containing 35 protein_id : NP_084255.2

name	Stmn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790189 CCDS:CCDS27222.1 GeneID:56471 MGI:1931224
definition	codon_start : 1 note : stathmin-like protein RB3; leukemia-associated gene-like product : stathmin-like 4 protein_id : NP_062649.1

name	Adra1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542114 CCDS:CCDS27223.1 GeneID:11549 MGI:104773
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004937 - alpha1-adrenergic receptor activity [Evidence IMP] [Evidence IDA] [Evidence ISS]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007512 - adult heart development [Evidence IGI]; GO:0016049 - cell growth [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IDA]; GO:0001997 - increased strength of heart contraction by epinephrine-norepinephrine [Evidence IGI]; GO:0001985 - negative regulation of heart contraction rate in baroreceptor response to increased blood pressure [Evidence IMP]; GO:0001994 - norepinephrine-epinephrine vasoconstriction during regulation of blood pressure [Evidence IMP]; GO:0035265 - organ growth [Evidence IGI]; GO:0001996 - positive regulation of heart contraction rate by epinephrine-norepinephrine [Evidence IGI]; GO:0043410 - positive regulation of MAPKKK cascade [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : adrenergic receptor, alpha 1c product : adrenergic receptor, alpha 1a protein_id : NP_038489.2

name	ENSMUSG00000057913 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265783 GeneID:791407 MGI:3642901
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480697.1

name	Dpysl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254595 CCDS:CCDS27224.1 GeneID:12934 MGI:1349763
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043025 - cell soma [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : collapsin response mediator protein 2 product : dihydropyrimidinase-like 2 protein_id : NP_034085.2

name	EG432870 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702228 GeneID:432870 MGI:3643060
definition	codon_start : 1 product : hypothetical protein LOC432870 protein_id : NP_001030053.1

name	Pnma2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425252 CCDS:CCDS27226.1 GeneID:239157 MGI:2444129
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : paraneoplastic antigen MA2 protein_id : NP_780707.1

name	Bnip3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753200 CCDS:CCDS27227.1 GeneID:12177 MGI:1332659
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0051607 - defense response to virus [Evidence ISS]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0008634 - negative regulation of survival gene product activity [Evidence ISS]; GO:0043065 - positive regulation of apoptosis [Evidence IEA] codon_start : 1 note : BCL2/adenovirus E1B 19 kDa-interacting protein 3-like product : BCL2/adenovirus E1B 19kDa-interacting protein 3-like protein_id : NP_033891.1

name	Ppp2r2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625886 GeneID:71978 MGI:1919228
definition	codon_start : 1 product : alpha isoform of regulatory subunit B55, protein phosphatase 2 protein_id : NP_082308.1

name	Ebf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753704 CCDS:CCDS27228.1 GeneID:13592 MGI:894332
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Olf-1/EBF-like 3 product : early B-cell factor 2 protein_id : NP_034225.1

name	EG628416 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702332 GeneID:628416 MGI:3644701
definition	codon_start : 1 product : hypothetical protein LOC628416 protein_id : NP_001033020.1

name	LOC100043046 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265654 GeneID:100043046
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479451.1

name	LOC672614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672614
definition	number : 1 pseudo : _no_value

name	LOC672614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672614
definition	number : 2 pseudo : _no_value

name	LOC672614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672614
definition	number : 3 pseudo : _no_value

name	LOC672614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672614
definition	number : 4 pseudo : _no_value

name	LOC672614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672614
definition	number : 5 pseudo : _no_value

name	LOC100043056 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043056
definition	number : 1 pseudo : _no_value

name	LOC668366 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265784 GeneID:668366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 209 ESTs, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_035709.1

clone name	MSMg01-534J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-473G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031E14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-300A10.b	B6Ng01-300A10.g
ACC	GA094706	GA094707
length	1,157	1,124
definition	B6Ng01-300A10.b	B6Ng01-300A10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(67,171,791 - 67,172,949)	(67,219,764 - 67,220,336)
sequence	gaattcaatgaatgctcaaatcatttcccaatgtatcaataatgttgagt caaatactcagtttcaaagaaatgatggtaactaattaactgtgctaaag cttagaactcataactctgacacagagttgaaaggtcagcaatgtgttga tctccattttatagactaggaaatggactcacggagagttgagctaactc ctcagagacacaggttagtgtcaaaacgtctaaattagaacccaagcaat cccttttccagtccctggctcacagtcactcacactctgctcaagcctgg tgtcacccggtgtcgccagtaggctttactggaacttcctatgactctag tatggtctgacttctagatgacttggatctcaagagaaaaggaagaattc aaacgtcacctgcttctccgattgtctggagcgtgttgatgtgggacaga ggaaagggagtgaactctgagtcacacagctgtcaaagcagagttctttg catgtacagtctttgagtccactgaattcacagcaatgaattgattctcg cacctgtaaagtgtaggtgcccatccaaacctcctcgtgtctgtgtggaa aaagagatacctagtaacagaactgctaggcttcttcagttcccctcagg agctgactaacagccaaaatgtcccctgtgctgtttccagctaacttagg cactcctcataaagtaagtatatcaggtctctcggaacttgctttaaatg aaattttcacaagacttccttcagagagagtgaagtctaactggtgtggt gggaaagtgaactgaacaaaaaagctaatgcagaaaggtagtgggggatt tttcctttagaacttcacacggagctatcacatccgtagtcctcacatgg cggccactatcctttcgctggttttagattttgatgtcatggcagcttat ggctcacataagagacaaaggcacaggagaagacagaaatgatgctggga aaataacttttccacatacagagtactcacagtttcagctccagctagct cattcccctcgacagatctgcaggggtaacaacattctcatttagcataa agctaggcatgtattttttttttcttcagagagctcagcctagccagtaa tgtcaga	gaattcagttgagttcctgaagttctgttcggttccattcagttcacgca gtcagtgcagtcagagtagttcagttcgtggaagtgagagcaaagagaaa agcaaagcaaagcagttcagtcagaagccaagagaagccagtttggatca gtcaccttggagaggagttttgagccagaacagctgagttgaaccagcca gccagagtttagaaagaaatgagtgatcttattcagcagtaagcctctga gatgacaattacatctgttaaggtctagataaaatgttaagacctatgta cctgctacctggctagcctgccattgtaagaaaactttctcatatgtttc tgttgttacgaggacactttctaatgccaagctgattacatattctgtgc ccctggaaaccaatcatacacaatcagtagaactgcttttgtatagccag gcacaataaagttggactggaacccaccacccagcagcacttcctgcacc tatgtatgaacttttatgatatctgcctttataaactgcccctgggatgg acccaacataagagatataagaaactatttgaaataagatttccattttg agtagtggttgagtcaagtttaagtttccaagacctccctggaaactgac cttttagttggcagaaggagacttgtaagtgggcaactgacaccctgttt gacaaattagacatgaatgttagacaaggcaagtcccctgccacagttga ataccaatgggagcaggataagtgttcgacatgttcctaaggaactcccc ctatccctaaatcctaactggtgaaataatttggcatggacatttgtaga tcccagacttaaaaagtctaggaccttaactcagagtcatgactcagttc ccaagtctggaccatggccctggtcaatcagtttggggtgtatactcaat aaactatccctatcttactgagatcgtgttcttgtggtttgtggaggcaa ttcctagactgaaacacatctggtgaataaatgtgacatttactcttcta gacaagtgacttctatgtacaatgagactgctcagcagggcatcactgtg gatggtgtgagaggtgccatcact
quality values	Open. Hide. 58 47 27 31 62 31 25 56 47 49 62 56 47 47 62 62 41 31 62 62 62 47 54 62 62 62 62 62 59 43 59 56 62 50 32 43 46 29 34 54 56 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 54 59 59 62 62 62 62 54 59 62 62 62 62 62 49 54 62 59 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 58 58 58 58 58 58 58 58 58 58 58 49 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 45 54 58 58 58 58 54 58 58 58 54 52 58 54 58 58 58 58 58 58 58 58 52 58 58 58 58 58 54 58 58 58 58 49 41 58 58 58 53 58 53 46 53 53 58 58 58 58 58 46 58 58 58 51 53 58 58 50 58 58 51 51 51 51 58 52 58 58 58 58 51 52 40 50 58 58 51 58 58 58 58 52 49 32 58 44 40 58 58 58 44 41 53 41 58 51 53 53 58 53 52 58 58 54 49 58 40 51 58 58 58 49 58 53 58 53 49 54 39 58 50 50 50 36 58 58 47 37 58 50 54 54 53 28 44 50 41 51 52 53 58 51 52 50 53 50 58 51 53 34 50 39 49 45 53 52 53 52 51 51 28 54 39 54 53 53 54 53 49 34 50 53 52 54 52 44 52 51 54 39 32 54 47 49 46 54 54 40 42 54 54 52 45 40 52 31 54 42 46 38 52 47 33 33 33 32 42 34 34 54 32 54 37 54 45 54 52 52 45 32 40 53 33 31 45 40 31 51 49 32 53 45 51 51 40 53 53 53 32 53 35 39 32 34 33 37 32 35 45 31 33 32 32 49 49 52 52 45 31 32 40 32 31 31 51 32 31 31 46 46 30 31 51 24 37 34 29 41 51 51 47 43 31 14 51 51 51 46 34 38 31 51 31 36 33 42 35 30 31 43 31 26 32 26 31 31 33 32 29 30 30 28 31 31 29 31 31 31 29 42 31 26 37 31 20 31 33 22 30 31 31 31 34 32 33 19 30 39 26 38 31 37 32 31 31 29 32 29 46 30 29 24 34 31 31 31 27 47 47 29 32 32 34 25 48 48 31 26 26 12 29 24 31 24 31 26 25 13 27 28 28 27 18 22 25 28 31 23 32 21 20 19 19 37 21 34 31 48 10 6 7 17 41 24 6 36 34 19 22 14 11 5 17 13 17 16 21 25 23 20 13 24 43 34 20 30 26 16 32 32 31 14 33 13 4 25 43 15 11 9 37 31 14 48 48 11 25 16 12 19 18 27 18 20 15 21 10 12 21 32 24 27 25 13 15 21 6 5 29 6 16 7 18 28 15 8 26 18 28 28 28 23 22 28 26 16 6 23 26 9 40 47 20 11 12 8 11 16 11 13 28 18 19 10 3 5 6 3 32 38 21 14 16 4 3 12 9 20 10 22 13 21 16 17 10 6 28 17 6 11 18 11 9 12 25 23 16 16 20 3 5 5 1 3 5 12 12 12 16 17 17 29 28 28 28 28 28 13 11 3 6 15 7 5 6 4 6 6 13 12 16 13 7 6 8 13 16 16 5 10 6 5 4 5 17 4 7 7 15 4 4 3	Open. Hide. 62 59 51 59 62 59 43 62 49 62 56 59 45 43 34 34 34 43 48 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 59 62 59 62 62 62 59 59 62 62 62 62 62 59 59 48 54 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 46 49 58 58 58 58 54 47 58 58 58 47 58 58 49 58 58 54 58 58 58 58 58 58 54 49 54 58 54 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 46 58 52 54 39 58 58 54 58 50 58 58 58 58 58 58 54 58 49 54 53 58 37 42 58 58 58 51 58 53 51 58 51 58 58 48 51 58 42 58 58 58 50 37 26 58 58 54 37 49 53 51 41 41 54 58 58 49 49 43 40 58 58 51 30 43 48 44 58 37 40 46 54 51 54 58 30 50 38 58 39 39 58 53 39 42 28 49 49 58 50 52 49 44 51 58 58 43 50 49 50 43 51 58 41 40 29 38 49 50 41 51 44 54 49 49 41 32 32 54 42 42 53 39 32 49 39 37 49 39 39 39 41 54 40 44 49 53 47 40 37 47 40 54 39 37 52 53 33 30 52 49 44 30 41 44 34 27 45 40 42 45 54 40 36 38 45 34 41 31 28 34 40 51 54 51 34 32 40 35 25 51 37 31 29 33 31 37 53 32 38 32 40 36 24 25 45 53 34 34 31 53 32 34 52 20 42 42 32 25 34 31 47 32 37 46 29 30 31 24 46 36 30 34 51 31 34 29 51 34 35 31 40 30 45 44 23 29 33 51 33 31 32 31 33 33 27 40 37 27 26 31 30 32 31 29 23 30 48 48 38 31 38 32 31 31 17 46 41 29 28 38 35 31 42 31 46 46 46 42 35 32 38 31 31 37 41 27 13 42 31 41 29 31 31 32 31 24 18 36 24 30 29 24 32 36 30 23 31 22 21 24 35 33 23 46 31 24 32 22 23 31 31 39 31 34 25 27 32 30 28 35 22 44 24 31 30 24 16 31 27 24 31 27 31 17 30 48 15 33 44 44 38 16 29 19 31 29 23 26 33 34 20 25 31 28 41 26 24 31 25 27 31 40 28 21 29 32 18 18 18 32 19 32 33 37 22 23 24 9 16 4 7 22 18 32 9 26 32 9 10 26 14 43 17 22 9 7 9 21 14 33 14 22 10 19 17 21 30 32 32 22 32 24 24 6 7 25 14 13 6 6 10 28 19 19 27 22 6 7 24 20 20 13 34 19 8 28 20 24 15 13 20 28 47 24 16 14 10 11 9 18 15 18 24 13 28 5 3 3 4 4 11 11 7 19 6 11 7 20 7 17 13 20 6 4 5 3 3 18 5 5 7 12 18 4 6 12 16 5 12 15 13 28 13 3 5 18 16 5 6 7 10 5 17 11 13 13 17 5 6 9 12 13 15 15 5 10 13 6 9 9 5 6 15 16 10 13 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_67171791_67172949
seq2: B6Ng01-300A10.b_48_1204

seq1  GAATTCAATGAATGCTCAAATCATTTCCCAATGTATCAATAATGTTGAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATGAATGCTCAAATCATTTCCCAATGTATCAATAATGTTGAGT  50

seq1  CAAATACTCAGTTTCAAAGAAATGATGGTAACTAATTAACTGTGCTAAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATACTCAGTTTCAAAGAAATGATGGTAACTAATTAACTGTGCTAAAG  100

seq1  CTTAGAACTCATAACTCTGACACAGAGTTGAAAGGTCAGCAATGTGTTGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGAACTCATAACTCTGACACAGAGTTGAAAGGTCAGCAATGTGTTGA  150

seq1  TCTCCATTTTATAGACTAGGAAATGGACTCACGGAGAGTTGAGCTAACTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCATTTTATAGACTAGGAAATGGACTCACGGAGAGTTGAGCTAACTC  200

seq1  CTCAGAGACACAGGTTAGTGTCAAAACGTCTAAATTAGAACCCAAGCAAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGAGACACAGGTTAGTGTCAAAACGTCTAAATTAGAACCCAAGCAAT  250

seq1  CCCTTTTCCAGTCCCTGGCTCACAGTCACTCACACTCTGCTCAAGCCTGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTTTCCAGTCCCTGGCTCACAGTCACTCACACTCTGCTCAAGCCTGG  300

seq1  TGTCACCCGGTGTCGCCAGTAGGCTTTACTGGAACTTCCTATGACTCTAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCACCCGGTGTCGCCAGTAGGCTTTACTGGAACTTCCTATGACTCTAG  350

seq1  TATGGTCTGACTTCTAGATGACTTGGATCTCAAGAGAAAAGGAAGAATTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGGTCTGACTTCTAGATGACTTGGATCTCAAGAGAAAAGGAAGAATTC  400

seq1  AAACGTCACCTGCTTCTCCGATTGTCTGGAGCGTGTTGATGTGGGACAGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACGTCACCTGCTTCTCCGATTGTCTGGAGCGTGTTGATGTGGGACAGA  450

seq1  GGAAAGGGAGTGAACTCTGAGTCACACAGCTGTCAAAGCAGAGTTCTTTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAGGGAGTGAACTCTGAGTCACACAGCTGTCAAAGCAGAGTTCTTTG  500

seq1  CATGTACAGTCTTTGAGTCCACTGAATTCACAGCAATGAATTGATTCTCG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTACAGTCTTTGAGTCCACTGAATTCACAGCAATGAATTGATTCTCG  550

seq1  CACCTGTAAAGTGTAGGTGCCCATCCAAACCTCCTCGTGTCTGTGTGGAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTGTAAAGTGTAGGTGCCCATCCAAACCTCCTCGTGTCTGTGTGGAA  600

seq1  AAAGAGATACCTAGTAACAGAACTGCTAGGCTTCTTCAGTTCCCCTCAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAGATACCTAGTAACAGAACTGCTAGGCTTCTTCAGTTCCCCTCAGG  650

seq1  AGCTGACTAACAGCCAAAATGTCCCCTGTGCTGTTTCCAGCTAACTTAGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGACTAACAGCCAAAATGTCCCCTGTGCTGTTTCCAGCTAACTTAGG  700

seq1  CACTCCTCATAAAGTAAGTATATCAGGTCTCTCGGAACTTGCTTTAAATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCCTCATAAAGTAAGTATATCAGGTCTCTCGGAACTTGCTTTAAATG  750

seq1  AAATTTTCACAAGACTTCCTTCAGAGAGAGTGAAGTCTAACTGGTGTGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTTTCACAAGACTTCCTTCAGAGAGAGTGAAGTCTAACTGGTGTGGT  800

seq1  GGGAAAGTGAACTGAACAAAAAAGCTAATGCAGAAAGGTAGTGGGGGATT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAAGTGAACTGAACAAAAAAGCTAATGCAGAAAGGTAGTGGGGGATT  850

seq1  TTTCCTTTAGAACTTCACACGGAGCTATCACATCCGTAGTCCTCACATGG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCTTTAGAACTTCACACGGAGCTATCACATCCGTAGTCCTCACATGG  900

seq1  CGGCCACTATCCTTTCGCTGGTTTTAGATTTTGATGTCATGGCAGCTTAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCCACTATCCTTTCGCTGGTTTTAGATTTTGATGTCATGGCAGCTTAT  950

seq1  GGCTCACATAAGAGACAAAGGCACA-GAG-AGACAGAAATGATGCTGGGA  998
      ||||||||||||||||||||||||| ||| ||||||||||||||||||||
seq2  GGCTCACATAAGAGACAAAGGCACAGGAGAAGACAGAAATGATGCTGGGA  1000

seq1  AAATAAC-TTTCCACATACAGAGTACTCACAGTTTCCAGCTCCAGCTAGC  1047
      ||||||| ||||||||||||||||||||||||||| ||||||||||||||
seq2  AAATAACTTTTCCACATACAGAGTACTCACAGTTT-CAGCTCCAGCTAGC  1049

seq1  TCATTTCCCCTCGACAGATCTGGCCAAGGGGTAACAACATTCTCATTTAG  1097
      ||| ||||||||||||||||||    ||||||||||||||||||||||||
seq2  TCA-TTCCCCTCGACAGATCTG---CAGGGGTAACAACATTCTCATTTAG  1095

seq1  CATAAAGCTTAAGGGAATGTA-TTTTTTTTTCCTCAGAGAGCTCAG-CTA  1145
      |||||||||    || ||||| |||||||||| ||||||||||||| |||
seq2  CATAAAGCT---AGGCATGTATTTTTTTTTTCTTCAGAGAGCTCAGCCTA  1142

seq1  G-CAGTAATGTCAGA  1159
      | |||||||||||||
seq2  GCCAGTAATGTCAGA  1157

seq1: chr14_67219764_67220336
seq2: B6Ng01-300A10.g_623_1190 (reverse)

seq1  AGTGAT-GCACCTCCTCACA-CATCCACAGTGATGGCCCTTGCTGAGCCA  48
      |||||| |||||| |||||| ||||||||||||||  || ||||||| ||
seq2  AGTGATGGCACCT-CTCACACCATCCACAGTGATG--CCCTGCTGAG-CA  46

seq1  GTCTTCATTTGTACATAGAAGTCACTATGTCTAGAAGAGTAAATGTCACA  98
      ||| ||| |||||||||||||||||| |||||||||||||||||||||||
seq2  GTC-TCA-TTGTACATAGAAGTCACT-TGTCTAGAAGAGTAAATGTCACA  93

seq1  TTTATTCACCAGATGTGTTTCAGTCTAGGAATTGCCT-CACAAACCACAA  147
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TTTATTCACCAGATGTGTTTCAGTCTAGGAATTGCCTCCACAAACCACAA  143

seq1  GAACACCGATCTCAGTAAGATAGGGATAGTTTATTGAGTATACACCCCAA  197
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACA-CGATCTCAGTAAGATAGGGATAGTTTATTGAGTATACACCCCAA  192

seq1  ACTGATTGACCAGGGCCATGGTCCAGACTTGGGAACTGAGTCATGACTCT  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGATTGACCAGGGCCATGGTCCAGACTTGGGAACTGAGTCATGACTCT  242

seq1  GAGTTAAGGTCCTAGACTTTTTAAGTCTGGGATCTACAAATGTCCATGCC  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTAAGGTCCTAGACTTTTTAAGTCTGGGATCTACAAATGTCCATGCC  292

seq1  AAATTATTTCACCAGTTAGGATTTAGGGATAGGGGGAGTTCCTTAGGAAC  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTATTTCACCAGTTAGGATTTAGGGATAGGGGGAGTTCCTTAGGAAC  342

seq1  ATGTCGAACACTTATCCTGCTCCCATTGGTATTCAACTGTGGCAGGGGAC  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCGAACACTTATCCTGCTCCCATTGGTATTCAACTGTGGCAGGGGAC  392

seq1  TTGCCTTGTCTAACATTCATGTCTAATTTGTCAAACAGGGTGTCAGTTGC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCTTGTCTAACATTCATGTCTAATTTGTCAAACAGGGTGTCAGTTGC  442

seq1  CCACTTACAAGTCTCCTTCTGCCAACTAAAAGGTCAGTTTCCAGGGAGGT  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTTACAAGTCTCCTTCTGCCAACTAAAAGGTCAGTTTCCAGGGAGGT  492

seq1  CTTGGAAACTTAAACTTGACTCAACCACTACTCAAAATGGAAATCTTATT  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGAAACTTAAACTTGACTCAACCACTACTCAAAATGGAAATCTTATT  542

seq1  TCAAATAGTTTCTTATATCTCTTATG  573
      ||||||||||||||||||||||||||
seq2  TCAAATAGTTTCTTATATCTCTTATG  568

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information