MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-319O24
Chromosome	14 (Build37)
Map Location	32,628,342 - 32,820,291
singlet/doublet	doublet
Overlap gene	Ankrd28
Upstream gene	Sfmbt1, Tmem110, Mustn1, Itih4, Itih3, Itih1, Nek4, Spcs1, Glt8d1, Gnl3, Pbrm1, EG432834, Nt5dc2, Stab1, Nisch, Tnnc1, Sema3g, Phf7, Bap1, Dnahc1, Capn7, Sh3bp5, Mettl6, Eaf1, Colq, Hacl1, Btd
Downstream gene	Galntl2, Dph3, Oxnad1, Msmb, Ncoa4, Timm23, Parg, LOC665601, Ogdhl, 1700024G13Rik, Chat, Slc18a3, LOC100040834, EG665618, Ercc6, 9430077A04Rik, Prrxl1, 3425401B19Rik, 1810011H11Rik, 4922501K12Rik, E130203B14Rik, EG665658, Lrrc18
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sfmbt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54650 MGI:1859609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69179 MGI:1921500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mustn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66175 MGI:1913425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itih4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16427 MGI:109536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itih3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16426 MGI:96620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itih1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16424 MGI:96618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23955 MGI:1344404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spcs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69019 MGI:1916269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glt8d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76485 MGI:1923735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30877 MGI:1353651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pbrm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66923 MGI:1923998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432834 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432834 MGI:3643518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 558 ESTs, 13 Proteins

name	Nt5dc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70021 MGI:1917271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192187 MGI:2178742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nisch (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64652 MGI:1928323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnnc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21924 MGI:98779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema3g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218877 MGI:3041242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71838 MGI:1919088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104416 MGI:1206586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnahc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110084 MGI:107721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 12 Proteins

name	Capn7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12339 MGI:1338030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3bp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24056 MGI:1344391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mettl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67011 MGI:1914261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eaf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74427 MGI:1921677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Colq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382864 MGI:1338761
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hacl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56794 MGI:1929657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26363 MGI:1347001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105522 MGI:2145661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galntl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78754 MGI:1926004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dph3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105638 MGI:1922658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Oxnad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218885 MGI:1916953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msmb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17695 MGI:97166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncoa4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27057 MGI:1350932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Timm23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53600 MGI:1858317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26430 MGI:1347094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665601 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Ogdhl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239017 MGI:3616088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700024G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67085 MGI:1914335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12647 MGI:88392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc18a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20508 MGI:1101061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG665618 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665618 MGI:3644631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Ercc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319955 MGI:1100494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9430077A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320321 MGI:2443810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Prrxl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107751 MGI:2148204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3425401B19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432836 MGI:3588196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	1810011H11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69069 MGI:1916319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	4922501K12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105511 MGI:2145650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 1 Protein

name	E130203B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320736 MGI:2444633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665658 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665658 MGI:3644157
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	Lrrc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67580 MGI:1914830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfmbt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9507088 GeneID:54650 MGI:1859609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Scm-like with four mbt domains 1 transcript_id : NM_019460.1

name	Tmem110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802607 GeneID:69179 MGI:1921500
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 110 transcript_id : NM_028839.3

name	Mustn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802278 GeneID:66175 MGI:1913425
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : musculoskeletal, embryonic nuclear protein 1 transcript_id : NM_181390.2

name	Itih4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382967 GeneID:16427 MGI:109536
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inter alpha-trypsin inhibitor, heavy chain 4 transcript_id : NM_018746.2

name	Itih3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680495 GeneID:16426 MGI:96620
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inter-alpha trypsin inhibitor, heavy chain 3 transcript_id : NM_008407.1

name	Itih1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385310 GeneID:16424 MGI:96618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inter-alpha trypsin inhibitor, heavy chain 1 transcript_id : NM_008406.3

name	Nek4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893154 GeneID:23955 MGI:1344404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 4 transcript_id : NM_011849.2

name	Spcs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386308 GeneID:69019 MGI:1916269
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal peptidase complex subunit 1 homolog (S. cerevisiae) transcript_id : NM_026911.2

name	Glt8d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313215 GeneID:76485 MGI:1923735
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycosyltransferase 8 domain containing 1 transcript_id : NM_029626.1

name	Gnl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363446 GeneID:30877 MGI:1353651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein-like 3 (nucleolar) transcript_id : NM_178846.2

name	Gnl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802620 GeneID:30877 MGI:1353651
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein-like 3 (nucleolar) transcript_id : NM_153547.3

name	Pbrm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486950 GeneID:66923 MGI:1923998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polybromo 1 transcript_id : NM_001081251.1

name	EG432834 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265389 GeneID:432834 MGI:3643518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 558 ESTs, 13 Proteins product : predicted gene, EG432834 transcript_id : XM_484358.5

name	Nt5dc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625754 GeneID:70021 MGI:1917271
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5'-nucleotidase domain containing 2 transcript_id : NM_027289.1

name	Stab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149761 GeneID:192187 MGI:2178742
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stabilin 1 transcript_id : NM_138672.1

name	Nisch (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158671 GeneID:64652 MGI:1928323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nischarin transcript_id : NM_022656.2

name	Tnnc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892226 GeneID:21924 MGI:98779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : troponin C, cardiac/slow skeletal transcript_id : NM_009393.2

name	Sema3g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794604 GeneID:218877 MGI:3041242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G transcript_id : NM_001025379.1

name	Phf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313645 GeneID:71838 MGI:1919088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 7 transcript_id : NM_027949.1

name	Bap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92110038 GeneID:104416 MGI:1206586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Brca1 associated protein 1 transcript_id : NM_027088.2

name	Dnahc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396881 GeneID:110084 MGI:107721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs, 12 Proteins product : dynein, axonemal, heavy chain 1 transcript_id : XM_977593.1

name	Capn7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061447 GeneID:12339 MGI:1338030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 7 transcript_id : NM_009796.2

name	Sh3bp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109150404 GeneID:24056 MGI:1344391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain binding protein 5 (BTK-associated) transcript_id : NM_011894.2

name	Mettl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129886 GeneID:67011 MGI:1914261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase like 6 transcript_id : NM_025907.3

name	Eaf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362843 GeneID:74427 MGI:1921677
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELL associated factor 1 transcript_id : NM_028932.3

name	Colq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114703722 GeneID:382864 MGI:1338761
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase transcript_id : NM_009937.1

name	Hacl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560354 GeneID:56794 MGI:1929657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2-hydroxyacyl-CoA lyase 1 transcript_id : NM_019975.2

name	Btd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349017 GeneID:26363 MGI:1347001
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biotinidase transcript_id : NM_025295.2

name	Ankrd28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131111 GeneID:105522 MGI:2145661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 28 transcript_id : NM_001024604.2

name	Galntl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803181 GeneID:78754 MGI:1926004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2 transcript_id : NM_030166.2

name	Dph3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145562 GeneID:105638 MGI:1922658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DPH3 homolog (KTI11, S. cerevisiae) transcript_id : NM_001047433.1

name	Dph3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145549 GeneID:105638 MGI:1922658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DPH3 homolog (KTI11, S. cerevisiae) transcript_id : NM_172254.3

name	Oxnad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703913 GeneID:218885 MGI:1916953
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxidoreductase NAD-binding domain containing 1 transcript_id : NM_145460.1

name	Msmb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130511 GeneID:17695 MGI:97166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-microseminoprotein transcript_id : NM_020597.2

name	Ncoa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404401 GeneID:27057 MGI:1350932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor coactivator 4 transcript_id : NM_001033988.1

name	Ncoa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404403 GeneID:27057 MGI:1350932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor coactivator 4 transcript_id : NM_019744.3

name	Timm23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12025535 GeneID:53600 MGI:1858317
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 23 homolog (yeast) transcript_id : NM_016897.1

name	Parg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444911 GeneID:26430 MGI:1347094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) glycohydrolase transcript_id : NM_011960.2

name	Ogdhl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487482 GeneID:239017 MGI:3616088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxoglutarate dehydrogenase-like transcript_id : NM_001081130.1

name	1700024G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404226 GeneID:67085 MGI:1914335
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700024G13 gene transcript_id : NM_001034037.1

name	Chat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802071 GeneID:12647 MGI:88392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : choline acetyltransferase transcript_id : NM_009891.2

name	Slc18a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83716010 GeneID:20508 MGI:1101061
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 18 (vesicular monoamine), member 3 transcript_id : NM_021712.2

name	LOC100040834 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265404 GeneID:100040834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040834 transcript_id : XM_001476221.1

name	EG665618 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396887 GeneID:665618 MGI:3644631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG665618 transcript_id : XM_978193.1

name	Ercc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487018 GeneID:319955 MGI:1100494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : excision repair cross-complementing rodent repair deficiency, complementation group 6 transcript_id : NM_001081221.1

name	Prrxl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372915 GeneID:107751 MGI:2148204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired related homeobox protein-like 1 transcript_id : NM_001001796.2

name	3425401B19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396894 GeneID:432836 MGI:3588196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : RIKEN cDNA 3425401B19 gene transcript_id : XM_484361.3

name	1810011H11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396896 GeneID:69069 MGI:1916319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : RIKEN cDNA 1810011H11 gene, transcript variant 1 transcript_id : XM_358452.4

name	4922501K12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265411 GeneID:105511 MGI:2145650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : RIKEN cDNA 4922501K12 gene transcript_id : XM_138964.7

name	E130203B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373556 GeneID:320736 MGI:2444633
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130203B14 gene transcript_id : NM_178791.3

name	Lrrc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742873 GeneID:67580 MGI:1914830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 18 transcript_id : NM_026253.3

name	Sfmbt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507089 CCDS:CCDS26897.1 GeneID:54650 MGI:1859609
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : Scm-related gene containing four mbt domains 1 product : Scm-like with four mbt domains 1 protein_id : NP_062333.1

name	Tmem110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980784 CCDS:CCDS26899.1 GeneID:69179 MGI:1921500
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69179 protein_id : NP_083115.2

name	Mustn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088922 GeneID:66175 MGI:1913425
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] codon_start : 1 product : musculoskeletal, embryonic nuclear protein 1 protein_id : NP_852055.1

name	Itih4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055252 CCDS:CCDS26901.1 GeneID:16427 MGI:109536
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA]; GO:0005540 - hyaluronic acid binding [Evidence IDA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0030212 - hyaluronan metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PK-120 product : inter alpha-trypsin inhibitor, heavy chain 4 protein_id : NP_061216.1

name	Itih3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680496 GeneID:16426 MGI:96620
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0030212 - hyaluronan metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : inter-alpha trypsin inhibitor, heavy chain 3 protein_id : NP_032433.1

name	Itih1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249351 GeneID:16424 MGI:96618
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0030212 - hyaluronan metabolism [Evidence IEA] codon_start : 1 note : inter-alpha (globulin) inhibitor, H1 polypeptide product : inter-alpha trypsin inhibitor, heavy chain 1 protein_id : NP_032432.2

name	Nek4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754822 CCDS:CCDS26902.1 GeneID:23955 MGI:1344404
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 note : NIMA-related expressed kinase 4 product : NIMA (never in mitosis gene a)-related expressed kinase 4 protein_id : NP_035979.1

name	Spcs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16975492 CCDS:CCDS26903.1 GeneID:69019 MGI:1916269
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA]; GO:0005787 - signal peptidase complex [Evidence ISS] [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0009003 - signal peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence ISS]; GO:0006465 - signal peptide processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : signal peptidase 12kDa protein_id : NP_081187.1

name	Glt8d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313216 CCDS:CCDS26904.1 GeneID:76485 MGI:1923735
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0016051 - carbohydrate biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycosyltransferase 8 domain containing 1 protein_id : NP_083902.1

name	Gnl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281913 GeneID:30877 MGI:1353651
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005730 - nucleolus [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence ISS] [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence ISS] codon_start : 1 note : short isoform is encoded by transcript variant 2; nucleostemin product : guanine nucleotide binding protein-like 3 (nucleolar) short isoform protein_id : NP_849174.1

name	Gnl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30524920 CCDS:CCDS26905.1 GeneID:30877 MGI:1353651
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005730 - nucleolus [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence ISS] [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence ISS] codon_start : 1 note : long isoform is encoded by transcript variant 1; nucleostemin product : guanine nucleotide binding protein-like 3 (nucleolar) long isoform protein_id : NP_705775.2

name	Pbrm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486951 GeneID:66923 MGI:1923998
definition	GO_component : GO:0000776 - kinetochore [Evidence IDA]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0001890 - placenta development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : 2310032M22Rik product : polybromo 1 protein_id : NP_001074720.1

name	EG432834 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63663484 GeneID:432834 MGI:3643518
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484358.2

name	Nt5dc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625755 GeneID:70021 MGI:1917271
definition	GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IEA] codon_start : 1 product : 5'-nucleotidase domain containing 2 protein_id : NP_081565.1

name	Stab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149762 CCDS:CCDS26906.1 GeneID:192187 MGI:2178742
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008367 - bacterial binding [Evidence ISS]; GO:0005041 - low-density lipoprotein receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence ISS] GO_process : GO:0007155 - cell adhesion [Evidence ISS]; GO:0007267 - cell-cell signaling [Evidence ISS]; GO:0042742 - defense response to bacterium [Evidence ISS]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0016525 - negative regulation of angiogenesis [Evidence ISS]; GO:0006898 - receptor mediated endocytosis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : stabilin-1 product : stabilin 1 protein_id : NP_619613.1

name	Nisch (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158672 GeneID:64652 MGI:1928323
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005178 - integrin binding [Evidence IDA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0016601 - Rac protein signal transduction [Evidence IDA] codon_start : 1 note : imidazoline receptor I-1-like protein product : nischarin protein_id : NP_073147.2

name	Tnnc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678369 GeneID:21924 MGI:98779
definition	GO_component : GO:0005861 - troponin complex [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0006937 - regulation of muscle contraction [Evidence IEA] codon_start : 1 product : troponin C, cardiac/slow skeletal protein_id : NP_033419.1

name	Sema3g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794605 CCDS:CCDS26908.1 GeneID:218877 MGI:3041242
definition	GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 note : Semaphorin 3G product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G protein_id : NP_001020550.1

name	Phf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313646 CCDS:CCDS26909.1 GeneID:71838 MGI:1919088
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : PHD finger protein 7 protein_id : NP_082225.1

name	Bap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076917 CCDS:CCDS26910.1 GeneID:104416 MGI:1206586
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004221 - ubiquitin thiolesterase activity [Evidence ISS] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0016579 - protein deubiquitination [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin C-terminal hydrolase X4 product : Brca1 associated protein 1 protein_id : NP_081364.1

name	Dnahc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396882 GeneID:110084 MGI:107721
definition	codon_start : 1 note : overriding stop codons product : similar to KIAA1410 protein protein_id : XP_982687.1 transl_except : (pos:complement(32082742..32082744),aa:OTHER)

name	Capn7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753258 CCDS:CCDS26911.1 GeneID:12339 MGI:1338030
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : calpain 7 protein_id : NP_033926.1

name	Sh3bp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109150405 GeneID:24056 MGI:1344391
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence ISS]; GO:0017124 - SH3 domain binding [Evidence TAS] [Evidence ISS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0006469 - negative regulation of protein kinase activity [Evidence IDA] codon_start : 1 product : SH3-domain binding protein 5 (BTK-associated) protein_id : NP_036024.2

name	Mettl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385400 CCDS:CCDS26913.1 GeneID:67011 MGI:1914261
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : methyltransferase like 6 protein_id : NP_080183.1

name	Eaf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229210 CCDS:CCDS26914.1 GeneID:74427 MGI:1921677
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : ELL associated factor 1 protein_id : NP_083208.1

name	Colq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114703723 GeneID:382864 MGI:1338761
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0045202 - synapse [Evidence IEA] GO_process : GO:0042135 - neurotransmitter catabolism [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : AChE Q; acetylcholinesterase-associated collagen product : collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase protein_id : NP_034067.1

name	Hacl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560355 CCDS:CCDS26915.1 GeneID:56794 MGI:1929657
definition	GO_component : GO:0005777 - peroxisome [Evidence TAS] [Evidence ISS] GO_function : GO:0016830 - carbon-carbon lyase activity [Evidence ISS] [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IDA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030976 - thiamin pyrophosphate binding [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001561 - fatty acid alpha-oxidation [Evidence ISS]; GO:0006629 - lipid metabolism [Evidence IDA] codon_start : 1 note : phytanoyl-CoA 2-hydroxylase 2 product : 2-hydroxyphytanoyl-CoA lyase protein_id : NP_064359.2

name	Btd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384648 GeneID:26363 MGI:1347001
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0043204 - perikaryon [Evidence IDA] GO_function : GO:0047708 - biotinidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016811 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides [Evidence IEA] codon_start : 1 product : biotinidase protein_id : NP_079571.1

name	Ankrd28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66841376 GeneID:105522 MGI:2145661
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ankyrin repeat domain 28 protein_id : NP_001019775.1

name	Galntl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58000467 GeneID:78754 MGI:1926004
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0004653 - polypeptide N-acetylgalactosaminyltransferase activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2 protein_id : NP_084442.1

name	Dph3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145563 GeneID:105638 MGI:1922658
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0050709 - negative regulation of protein secretion [Evidence ISS]; GO:0017183 - peptidyl-diphthamide biosynthesis from peptidyl-histidine [Evidence ISS]; GO:0051099 - positive regulation of binding [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; zinc finger, CSL domain containing 2 product : zinc finger, CSL domain containing 2 isoform 2 protein_id : NP_001040898.1

name	Dph3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986537 GeneID:105638 MGI:1922658
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0050709 - negative regulation of protein secretion [Evidence ISS]; GO:0017183 - peptidyl-diphthamide biosynthesis from peptidyl-histidine [Evidence ISS]; GO:0051099 - positive regulation of binding [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; zinc finger, CSL domain containing 2 product : zinc finger, CSL domain containing 2 isoform 1 protein_id : NP_758458.1

name	Oxnad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703914 CCDS:CCDS26918.1 GeneID:218885 MGI:1916953
definition	codon_start : 1 exception : mismatches in translation product : oxidoreductase NAD-binding domain containing 1 protein_id : NP_663435.1

name	Msmb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181104 GeneID:17695 MGI:97166
definition	codon_start : 1 note : beta-inhibin; prostatic inhibin protein product : beta-microseminoprotein protein_id : NP_065622.1

name	Ncoa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404402 GeneID:27057 MGI:1350932
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 product : nuclear receptor coactivator 4 protein_id : NP_001029160.1

name	Ncoa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56118312 GeneID:27057 MGI:1350932
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 product : nuclear receptor coactivator 4 protein_id : NP_062718.2

name	Timm23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12025536 GeneID:53600 MGI:1858317
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence IEA]; GO:0005758 - mitochondrial intermembrane space [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0015450 - protein translocase activity [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : translocase of inner mitochondrial membrane 23 homolog protein_id : NP_058593.1

name	Parg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444912 GeneID:26430 MGI:1347094
definition	GO_component : GO:0005829 - cytosol [Evidence IMP]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004649 - poly(ADP-ribose) glycohydrolase activity [Evidence IMP] GO_process : GO:0016045 - detection of bacterium [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IMP] codon_start : 1 product : poly (ADP-ribose) glycohydrolase protein_id : NP_036090.2

name	Ogdhl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487483 GeneID:239017 MGI:3616088
definition	codon_start : 1 product : oxoglutarate dehydrogenase-like protein_id : NP_001074599.1

name	1700024G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404227 GeneID:67085 MGI:1914335
definition	codon_start : 1 product : hypothetical protein LOC67085 protein_id : NP_001029209.1

name	Chat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45476575 CCDS:CCDS26920.1 GeneID:12647 MGI:88392
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004102 - choline O-acetyltransferase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007628 - adult walking behavior [Evidence IMP]; GO:0016358 - dendrite development [Evidence IMP]; GO:0007529 - establishment of synaptic specificity at neuromuscular junction [Evidence IMP]; GO:0007517 - muscle development [Evidence IMP]; GO:0007274 - neuromuscular synaptic transmission [Evidence IMP]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0042136 - neurotransmitter biosynthesis [Evidence IEA]; GO:0007622 - rhythmic behavior [Evidence IMP]; GO:0043179 - rhythmic excitation [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IMP] codon_start : 1 product : choline acetyltransferase protein_id : NP_034021.1

name	Slc18a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83716011 GeneID:20508 MGI:1101061
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0005277 - acetylcholine transporter activity [Evidence ISS]; GO:0005386 - carrier activity [Evidence IEA]; GO:0008504 - monoamine transporter activity [Evidence TAS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015870 - acetylcholine transport [Evidence ISS]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : vesicular acetylcholine transporter protein_id : NP_068358.2

name	LOC100040834 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265405 GeneID:100040834
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476271.1

name	EG665618 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396888 GeneID:665618 MGI:3644631
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983287.1

name	Ercc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487019 GeneID:319955 MGI:1100494
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA] GO_process : GO:0006290 - pyrimidine dimer repair [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006283 - transcription-coupled nucleotide-excision repair [Evidence IMP] codon_start : 1 note : CS group B correcting product : excision repair cross-complementing rodent repair deficiency, complementation group 6 protein_id : NP_001074690.1

name	Prrxl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49169835 CCDS:CCDS26922.1 GeneID:107751 MGI:2148204
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0007409 - axonogenesis [Evidence IMP]; GO:0009593 - detection of chemical stimulus [Evidence IMP]; GO:0016048 - detection of temperature stimulus [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0050954 - sensory perception of mechanical stimulus [Evidence IMP] codon_start : 1 note : paired homeodomain protein DRG11 product : paired related homeobox protein-like 1 protein_id : NP_001001796.1

name	3425401B19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265410 GeneID:432836 MGI:3588196
definition	codon_start : 1 product : similar to Uncharacterized protein C10orf71 protein_id : XP_484361.3

name	1810011H11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38075907 GeneID:69069 MGI:1916319
definition	codon_start : 1 product : hypothetical protein LOC69069 isoform 1 protein_id : XP_358452.1

name	4922501K12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265412 GeneID:105511 MGI:2145650
definition	codon_start : 1 product : hypothetical protein LOC105511 protein_id : XP_138964.6

name	E130203B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520277 CCDS:CCDS26923.1 GeneID:320736 MGI:2444633
definition	codon_start : 1 product : hypothetical protein LOC320736 protein_id : NP_848906.1

name	LOC665601 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665601
definition	number : 1 pseudo : _no_value

name	EG665658 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665658
definition	number : 1 pseudo : _no_value

name	9430077A04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265374 GeneID:320321 MGI:2443810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 9430077A04 gene transcript_id : XR_035224.1

clone name	MSMg01-438O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-292C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-319O24.b	B6Ng01-319O24.g
ACC	GA109445	GA109446
length	457	827
definition	B6Ng01-319O24.b	B6Ng01-319O24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(32,628,342 - 32,628,773)	(32,819,578 - 32,820,291)
sequence	tggcgaaaaagcatgatagaatatgcctggaatctctgcacttggagcag ctgaggcagaaggatcttaagtttaaggacagcctatgctatattcaaaa caaaccagaataaacaagactaatctgagtactataatgagcaatcctac ctgtttctttgtcctgcctgagtattacagtattgctaacagacatagta tatatagacactaatatggaacaatatgtaggaagggggtaagaattaaa aacaaaactaagggattatttttctaaatttcagttaatataagattaag aatatatttgggggtagggggagaatgttaatttccctgagcctggatta agagcaacgggttgaacttatataatgcccaaaaacctgtgttcaatctc gacgagggcaagggggagggaaaggaggcagggaaaagagtgggtttaca gttagag	gaattcagcatagcgacacactattggcttattcaaacattaacagaaag aacacagtgcatcaggactttgttcctgtgggctgggggcttatctttgt tcacatagcaaccagttgatgtgtgacttttacccggcgccaaggggcaa tagacagaggggagattccggccagatggtgttgactcagataatatagc cctgctatgtcttcacagtcccctttatcttatggtcaagatgttcccag gaatgttttaactacgaggcatacccaggtttgtttttctcttttctcag ccccaggcagcctctaggctcacaaacaaccagcaatttctgagtacttt atatgacttacaggtcttgaaatttcatctttctttcacagactcaaata gactataaacacaaagagtgctttattctgcagaagttcagcatgctggg gtctccccattaccaagatagagagacacccaagtgagctcacaggcctg atttaaagcacactaggaaattctggggtagaaacttgctgggaagtcta gaaactaatgctgaggaagtagctgagaaagtctggaaactgctgctgac ccattgtccttgcctcaggccagggggcagggcagcttctgaggcctgga cttgcctggaattgcccaggtcttggaaacagagatttaggcctagtttc cttaactgtcagtttgaagcctgccgtggaatcagcccagccttctcacc acaaaagcaaacaaataataacagagtttatttagggcatgggaagggga gttgagaaagggaagagagagggagaa
quality values	Open. Hide. 42 58 49 58 54 45 52 46 62 62 54 62 54 47 62 47 47 62 62 62 54 54 56 47 43 62 50 41 38 50 44 62 54 62 62 62 62 62 62 62 59 62 62 62 62 26 37 38 62 62 62 62 62 59 59 59 62 62 62 62 62 59 62 59 49 62 49 62 59 56 56 62 62 62 62 54 54 54 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 54 62 59 51 41 43 30 34 46 50 23 34 43 19 27 23 23 13 34 27 6 8 18 18 43 19 23 13 10 18 11 12 34 10 13 10 30 30 13 13 34 34 43 34 30 16 13 18 23 23 41 34 18 28 18 23 18 28 19 18 28 34 11 18 13 23 23 34 18 23 30 19 13 13 18 12 10 8 16 14 11 23 8 10 13 13 10 10 23 27 17 13 23 18 12 21 24 16 17 16 18 11 22 10 18 10 11 21 34 14 21 13 22 13 28 34 13 17 34 18 10 28 11 21 12 11 31 16 23 13 23 30 39 30	Open. Hide. 62 59 51 59 62 59 43 59 62 34 41 34 18 28 27 28 43 28 51 49 59 59 59 62 62 62 54 62 62 59 62 62 62 59 40 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 49 62 43 48 59 59 51 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 59 62 62 62 54 59 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 41 62 62 49 34 34 52 58 58 58 58 54 52 54 54 58 58 54 54 58 58 58 58 58 58 58 58 54 58 52 54 58 58 58 58 58 45 54 58 54 54 58 58 58 58 54 58 58 58 58 58 54 58 58 58 54 42 58 58 58 58 58 58 58 54 58 52 58 58 58 51 58 58 58 58 58 58 58 58 58 58 51 51 52 51 53 52 58 58 58 51 58 42 58 58 58 50 58 58 45 22 58 58 58 50 53 53 51 58 58 58 58 31 58 58 58 50 54 51 58 58 41 39 49 58 49 58 58 51 54 58 48 54 54 39 25 54 49 53 53 49 58 49 46 49 51 58 51 50 54 51 41 40 17 51 37 51 40 50 51 58 58 58 40 52 41 49 35 50 51 41 54 51 54 52 51 54 36 18 41 27 58 44 54 46 35 38 45 51 50 40 54 41 52 54 39 42 39 51 44 50 54 49 37 31 54 42 52 53 54 50 39 50 54 47 49 30 41 54 32 39 35 54 53 43 52 54 21 35 39 47 26 54 54 30 27 37 45 53 29 40 39 40 52 42 40 37 40 53 54 47 52 42 53 35 34 32 39 53 53 47 31 32 37 36 53 32 34 31 33 40 53 49 36 36 39 46 38 38 47 40 39 40 30 28 40 32 47 45 52 52 46 32 42 33 52 52 32 28 46 45 42 26 42 42 31 43 45 34 31 46 18 46 51 39 31 31 51 45 31 42 51 51 28 31 31 33 46 40 46 51 19 51 46 33 46 24 31 46 25 40 21 31 48 14 24 46 17 46 34 11 46 12 46 12 20 10 46 39 37 6 16 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_32628342_32628773
seq2: B6Ng01-319O24.b_49_481

seq1  GAATTCTGGCGAAAAAGCATGATAGAATATGCCTGGAATCTCTGCACTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGGCGAAAAAGCATGATAGAATATGCCTGGAATCTCTGCACTTG  50

seq1  GAGCAGCTGAGGCAGAAGGATCTTAAGTTTAAGGACAGCCTATGCTATAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCAGCTGAGGCAGAAGGATCTTAAGTTTAAGGACAGCCTATGCTATAT  100

seq1  TCAAAACAAACCAGAATAAACAAGACTAATCTGAGTACTATAATGAGCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAACAAACCAGAATAAACAAGACTAATCTGAGTACTATAATGAGCAA  150

seq1  TCCTACCTGTTTCTTTGTCCTGCCTGAGTATTACAGTATTGCTAACAGAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTACCTGTTTCTTTGTCCTGCCTGAGTATTACAGTATTGCTAACAGAC  200

seq1  ATAGTATATATAGACACTAATATGGAACAATATGTAGGAAGGGGGTAAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTATATATAGACACTAATATGGAACAATATGTAGGAAGGGGGTAAGA  250

seq1  ATTAAAAACAAAACTAAGGGATTATTTTTCTAAATTTCAGTTAATATAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAAAAACAAAACTAAGGGATTATTTTTCTAAATTTCAGTTAATATAAG  300

seq1  ATTAAGAATATATTTGGGGGTAGGGGGAGAATGTTAATTTCCTTGAGCCA  350
      |||||||||||||||||||||||||||||||||||||||||| |||||| 
seq2  ATTAAGAATATATTTGGGGGTAGGGGGAGAATGTTAATTTCCCTGAGCCT  350

seq1  AGATAAAGAAGAGAGGGTTGAACTTATATAATGCCCAAGAACCTGTGTTC  400
       ||| ||||  |  |||||||||||||||||||||||| |||||||||||
seq2  GGATTAAGAGCAACGGGTTGAACTTATATAATGCCCAAAAACCTGTGTTC  400

seq1  AATCTCCACAACAAGGAGGGGGAGGG-GAGGAG  432
      |||||| || |     ||||||||||  |||||
seq2  AATCTCGACGAGGGCAAGGGGGAGGGAAAGGAG  433

seq1: chr14_32819578_32820291
seq2: B6Ng01-319O24.g_332_894 (reverse)

seq1  TTCTCCCTCTCTCCATCTCTCCCTTTCCCCTTTCCCTTTCTCCCTCTTCA  50
                                                        
seq2  --------------------------------------------------  0

seq1  TGTGTTCCAGATTGGCTCTCTCCTCTCCTCCCCTCCCCTCCCCTCTCCCT  100
                                                        
seq2  --------------------------------------------------  0

seq1  CTCCCTCTCCCTCTCCCTCTCCCTCTCCCTCTCCCTCTCCCTCTCCCTCT  150
                                                        
seq2  --------------------------------------------------  0

seq1  CCCTCTCCCTCTCTCTTCCC-TTCTCAACTCCCCTTCCCATGCCCTAAAT  199
         ||||||||||||||||| |||||||||||||||||||||||||||||
seq2  --TTCTCCCTCTCTCTTCCCTTTCTCAACTCCCCTTCCCATGCCCTAAAT  48

seq1  AAACTCTGTTATTATTTGTTTGCTTTTGTGGTGAGAAGGCTGGGCTGATT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCTGTTATTATTTGTTTGCTTTTGTGGTGAGAAGGCTGGGCTGATT  98

seq1  CCACGGCAGGCTTCAAACTGACAGTTAAGGAAACTAGGCCTAAATCTCTG  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACGGCAGGCTTCAAACTGACAGTTAAGGAAACTAGGCCTAAATCTCTG  148

seq1  TTTCCAAGACCTGGGCAATTCCAGGCAAGTCCAGGCCTCAGAAGCTGCCC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCAAGACCTGGGCAATTCCAGGCAAGTCCAGGCCTCAGAAGCTGCCC  198

seq1  TGCCCCCTGGCCTGAGGCAAGGACAATGGGTCAGCAGCAGTTTCCAGACT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCCCTGGCCTGAGGCAAGGACAATGGGTCAGCAGCAGTTTCCAGACT  248

seq1  TTCTCAGCTACTTCCTCAGCATTAGTTTCTAGACTTCCCAGCAAGTTTCT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCAGCTACTTCCTCAGCATTAGTTTCTAGACTTCCCAGCAAGTTTCT  298

seq1  ACCCCAGAATTTCCTAGTGTGCTTTAAATCAGGCCTGTGAGCTCACTTGG  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCAGAATTTCCTAGTGTGCTTTAAATCAGGCCTGTGAGCTCACTTGG  348

seq1  GTGTCTCTCTATCTTGGTAATGGGGAGACCCCAGCATGCTGAACTTCTGC  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCTCTCTATCTTGGTAATGGGGAGACCCCAGCATGCTGAACTTCTGC  398

seq1  AGAATAAAGCACTCTTTGTGTTTATAGTCTATTTGAGTCTGTGAAAGAAA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATAAAGCACTCTTTGTGTTTATAGTCTATTTGAGTCTGTGAAAGAAA  448

seq1  GATGAAATTTCAAGACCTGTAAGTCATATAAAGTACTCAGAAATTGCTGG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAAATTTCAAGACCTGTAAGTCATATAAAGTACTCAGAAATTGCTGG  498

seq1  TTGTTTGTGAGCCTAGAGGCTGCCTGGGGCTGAGAAAAGAGAAAAACAAA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTGTGAGCCTAGAGGCTGCCTGGGGCTGAGAAAAGAGAAAAACAAA  548

seq1  CCTGGGTATGCCTCG  714
      |||||||||||||||
seq2  CCTGGGTATGCCTCG  563

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information