MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-343K12
Chromosome	14 (Build37)
Map Location	43,981,784 - 44,066,833
singlet/doublet	doublet
Overlap gene	LOC666492, 1700001F09Rik, LOC673380
Upstream gene	LOC100040771, EG666253, EG666264, LOC100040787, EG666280, EG666285, LOC666298, LOC100042031, EG666318, EG546249, LOC100040863, LOC100040875, LOC100040890, LOC100042055, LOC635209, 1700091H14Rik, EG666415, LOC100040976, LOC100040983, LOC100042114, LOC666370, EG666376, LOC100041025, EG666396, LOC100041046, LOC100042130, LOC624893, LOC100041069, EG666420, LOC666436, EG638353, LOC666454, LOC100041106, EG638262, EG640992, EG666471, LOC666481, LOC100041143, EG666485, 1700049E17Rik
Downstream gene	LOC100042326, EG666502, LOC545039, LOC100041227, LOC100041235, LOC100042342, LOC666322, EG666556, EG666561, LOC676304, Rbmxrtp, LOC673132, LOC100041300, LOC624717, LOC672977, EG666590, LOC100041327, EG623592, Ear1, Ear-ps12, Ear-ps9, Ear-ps8, Ang-ps3, Ear10, EG666451, LOC672161, Ang3, Ear-ps7, Ear-ps10, EG630952, EG666621, LOC100041356, LOC100041364, LOC100041371, LOC100041376, Ear-ps2, Ang-ps1, Ear2, LOC100041393, LOC100041422, EG666638, 4930503E14Rik, EG666647, EG624862, EG666660, EG666667, EG546250, EG666675, LOC100041494, LOC100041497, EG666678, LOC676402
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040771 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG666253 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666253 MGI:3645411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	EG666264 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666264 MGI:3648646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 11 Proteins pseudo : _no_value

name	LOC100040787 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666280 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666280 MGI:3647991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 Proteins

name	EG666285 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666285 MGI:3647989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins

name	LOC666298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100042031 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	EG666318 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666318 MGI:3647083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG546249 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546249 MGI:3646763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 5 Proteins pseudo : _no_value

name	LOC100040863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins pseudo : _no_value

name	LOC100040875 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 5 Proteins

name	LOC100040890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 4 Proteins

name	LOC635209 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635209
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	1700091H14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73553 MGI:1920803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	EG666415 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666415 MGI:3642978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100040976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100040983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 4 Proteins

name	LOC666370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG666376 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666376 MGI:3646354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	LOC100041025 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666396 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666396 MGI:3646131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 5 Proteins

name	LOC100041046 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041046
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042130 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 4 Proteins

name	LOC624893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG666420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666420 MGI:3645750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC666436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 14 Proteins pseudo : _no_value

name	EG638353 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638353 MGI:3646628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 54 ESTs, 5 Proteins pseudo : _no_value

name	LOC666454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041106 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins

name	EG638262 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638262 MGI:3648176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 14 Proteins pseudo : _no_value

name	EG640992 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640992 MGI:3645493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG666471 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666471 MGI:3648566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC666481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 15 Proteins pseudo : _no_value

name	LOC100041143 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG666485 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666485 MGI:3646865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	1700049E17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73415 MGI:1920665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC666492 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	1700001F09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71826 MGI:1919076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC673380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100042326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	EG666502 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666502 MGI:3647466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC545039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 14 Proteins pseudo : _no_value

name	LOC100041227 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	LOC100041235 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 1 Protein

name	LOC666322 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG666556 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666556 MGI:3644714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666561 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666561 MGI:3648126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC676304 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Rbmxrtp (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:652988
definition	note : Rbmxrt pseudogene pseudo : _no_value

name	LOC673132 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC100041300 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC624717 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC672977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666590 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666590 MGI:3643326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100041327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG623592 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623592 MGI:3646923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 50 ESTs, 1 Protein

name	Ear1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13586 MGI:108021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ear-ps12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503849 MGI:3528644
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 12 pseudo : _no_value

name	Ear-ps9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503493 MGI:3528636
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 9 pseudo : _no_value

name	Ear-ps8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497109 MGI:3528634
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 8 pseudo : _no_value

name	Ang-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497104 MGI:3528607
definition	note : angiogenin, ribonuclease A family, pseudogene 3 pseudo : _no_value

name	Ear10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93725 MGI:1890464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666451 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666451 MGI:3648791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 49 ESTs, 1 Protein

name	LOC672161 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672161
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Ang3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11730 MGI:1201793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	Ear-ps7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497105 MGI:3528630
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 7 pseudo : _no_value

name	Ear-ps10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503495 MGI:3528640
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 10 pseudo : _no_value

name	EG630952 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630952 MGI:3646399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	EG666621 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666621 MGI:3643352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041356 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100041364 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100041371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100041376 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ear-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93743 MGI:1890466
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 2 pseudo : _no_value

name	Ang-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11728 MGI:104986
definition	note : angiogenin, ribonuclease A family, pseudogene 1 pseudo : _no_value

name	Ear2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13587 MGI:108020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041393 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041393
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041422 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG666638 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666638 MGI:3646502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	4930503E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74954 MGI:1922204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666647 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666647 MGI:3643591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	EG624862 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624862 MGI:3646742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 113 ESTs, 7 Proteins

name	EG666660 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666660 MGI:3643828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	EG666667 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666667 MGI:3643831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG546250 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546250 MGI:3643645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	EG666675 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666675 MGI:3646979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	LOC100041494 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	EG666678 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666678 MGI:3648583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	LOC676402 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	EG666253 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265398 GeneID:666253 MGI:3645411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : predicted gene, EG666253 transcript_id : XM_982603.2

name	EG666280 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265400 GeneID:666280 MGI:3647991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 Proteins product : predicted gene, EG666280 transcript_id : XM_982721.2

name	EG666285 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265402 GeneID:666285 MGI:3647989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : predicted gene, EG666285 transcript_id : XM_982757.2

name	LOC100042031 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265524 GeneID:100042031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to CDNA sequence BC061237 transcript_id : XM_001477912.1

name	EG666318 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396952 GeneID:666318 MGI:3647083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG666318 transcript_id : XM_983023.1

name	LOC100040875 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265408 GeneID:100040875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 5 Proteins product : similar to CDNA sequence BC061237 transcript_id : XM_001475427.1

name	LOC100042055 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265526 GeneID:100042055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 4 Proteins product : hypothetical protein LOC100042055 transcript_id : XM_001477921.1

name	1700091H14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265413 GeneID:73553 MGI:1920803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 1700091H14 gene transcript_id : XM_983279.2

name	EG666415 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265415 GeneID:666415 MGI:3642978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : predicted gene, EG666415 transcript_id : XM_983688.2

name	LOC100040976 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265418 GeneID:100040976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to CDNA sequence BC061237 transcript_id : XM_001475591.1

name	LOC100042114 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265529 GeneID:100042114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 4 Proteins product : hypothetical protein LOC100042114 transcript_id : XM_001477944.1

name	EG666376 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265421 GeneID:666376 MGI:3646354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : predicted gene, EG666376 transcript_id : XM_983444.2

name	EG666396 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265425 GeneID:666396 MGI:3646131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 5 Proteins product : predicted gene, EG666396 transcript_id : XM_983581.2

name	LOC100042130 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265531 GeneID:100042130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 4 Proteins product : hypothetical protein LOC100042130 transcript_id : XM_001477972.1

name	EG666420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396966 GeneID:666420 MGI:3645750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666420 transcript_id : XM_983726.1

name	LOC100041106 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265428 GeneID:100041106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to CDNA sequence BC061237 transcript_id : XM_001475808.1

name	EG666471 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396978 GeneID:666471 MGI:3648566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666471 transcript_id : XM_984060.1

name	LOC100041143 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265432 GeneID:100041143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041143 transcript_id : XM_001475870.1

name	EG666485 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265434 GeneID:666485 MGI:3646865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG666485 transcript_id : XM_984157.2

name	1700049E17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265438 GeneID:73415 MGI:1920665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : RIKEN cDNA 1700049E17 gene transcript_id : XM_001475911.1

name	1700001F09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380583 GeneID:71826 MGI:1919076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001F09 gene transcript_id : NM_027940.2

name	LOC100042326 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265540 GeneID:100042326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : hypothetical protein LOC100042326 transcript_id : XM_001478043.1

name	EG666502 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396982 GeneID:666502 MGI:3647466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666502 transcript_id : XM_984287.1

name	LOC100042342 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265542 GeneID:100042342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 1 Protein product : similar to 1700001F09Rik protein transcript_id : XM_001478056.1

name	LOC666322 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265445 GeneID:666322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical LOC666322 transcript_id : XM_001476034.1

name	EG666561 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396990 GeneID:666561 MGI:3648126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666561 transcript_id : XM_984613.1

name	LOC673132 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265447 GeneID:673132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : hypothetical LOC673132 transcript_id : XM_001476105.1

name	EG623592 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265550 GeneID:623592 MGI:3646923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 50 ESTs, 1 Protein product : predicted gene, EG623592 transcript_id : XM_891634.3

name	Ear1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33636772 GeneID:13586 MGI:108021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 1 transcript_id : NM_007894.2

name	Ear10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426866 GeneID:93725 MGI:1890464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 10 transcript_id : NM_053112.1

name	EG666451 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265553 GeneID:666451 MGI:3648791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 49 ESTs, 1 Protein product : predicted gene, EG666451, transcript variant 1 transcript_id : XM_988902.2

name	Ang3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265556 GeneID:11730 MGI:1201793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : angiogenin, ribonuclease A family, member 3 transcript_id : XM_001478112.1

name	EG630952 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396995 GeneID:630952 MGI:3646399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG630952 transcript_id : XM_984982.1

name	LOC100041356 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265452 GeneID:100041356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041356 transcript_id : XM_001476232.1

name	LOC100041364 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265454 GeneID:100041364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041364 transcript_id : XM_001476245.1

name	LOC100041371 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265456 GeneID:100041371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041371 transcript_id : XM_001476263.1

name	LOC100041376 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265458 GeneID:100041376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041376 transcript_id : XM_001476280.1

name	Ear2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328111 GeneID:13587 MGI:108020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 2 transcript_id : NM_007895.2

name	LOC100041393 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265460 GeneID:100041393
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041393 transcript_id : XM_001476317.1

name	LOC100041422 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265462 GeneID:100041422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to CDNA sequence BC061237 transcript_id : XM_001476355.1

name	EG666638 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265465 GeneID:666638 MGI:3646502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG666638 transcript_id : XM_985112.2

name	4930503E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371426 GeneID:74954 MGI:1922204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930503E14 gene transcript_id : NM_029131.2

name	EG666647 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397002 GeneID:666647 MGI:3643591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : predicted gene, EG666647 transcript_id : XM_985174.1

name	EG624862 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397004 GeneID:624862 MGI:3646742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 113 ESTs, 7 Proteins product : predicted gene, EG624862 transcript_id : XM_889408.2

name	EG666660 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397006 GeneID:666660 MGI:3643828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : predicted gene, EG666660 transcript_id : XM_985247.1

name	EG666667 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265467 GeneID:666667 MGI:3643831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG666667 transcript_id : XM_985276.2

name	EG546250 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397010 GeneID:546250 MGI:3643645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG546250 transcript_id : XM_486530.3

name	EG666675 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265469 GeneID:666675 MGI:3646979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : predicted gene, EG666675 transcript_id : XM_985343.2

name	LOC100041497 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265472 GeneID:100041497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to HN1-like protein transcript_id : XM_001476466.1

name	EG666678 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397014 GeneID:666678 MGI:3648583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : predicted gene, EG666678 transcript_id : XM_985370.1

name	LOC676402 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265581 GeneID:676402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : hypothetical LOC676402 transcript_id : XM_001478175.1

name	EG666253 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265399 GeneID:666253 MGI:3645411
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987697.2

name	EG666280 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265401 GeneID:666280 MGI:3647991
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_987815.2

name	EG666285 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265403 GeneID:666285 MGI:3647989
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_987851.2

name	LOC100042031 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265525 GeneID:100042031
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001477962.1

name	EG666318 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396953 GeneID:666318 MGI:3647083
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988117.1

name	LOC100040875 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265409 GeneID:100040875
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001475477.1

name	LOC100042055 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265527 GeneID:100042055
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477971.1

name	1700091H14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265414 GeneID:73553 MGI:1920803
definition	codon_start : 1 product : hypothetical protein LOC73553 protein_id : XP_988373.2

name	EG666415 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265416 GeneID:666415 MGI:3642978
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988782.2

name	LOC100040976 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265419 GeneID:100040976
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001475641.1

name	LOC100042114 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265530 GeneID:100042114
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477994.1

name	EG666376 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265422 GeneID:666376 MGI:3646354
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988538.2

name	EG666396 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265426 GeneID:666396 MGI:3646131
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_988675.2

name	LOC100042130 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265532 GeneID:100042130
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478022.1

name	EG666420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396967 GeneID:666420 MGI:3645750
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988820.1

name	LOC100041106 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265429 GeneID:100041106
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001475858.1

name	EG666471 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396979 GeneID:666471 MGI:3648566
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_989154.1

name	LOC100041143 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265433 GeneID:100041143
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475920.1

name	EG666485 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265435 GeneID:666485 MGI:3646865
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_989251.2

name	1700049E17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265439 GeneID:73415 MGI:1920665
definition	codon_start : 1 product : hypothetical protein LOC73415 protein_id : XP_001475961.1

name	1700001F09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386270 GeneID:71826 MGI:1919076
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71826 protein_id : NP_082216.1

name	LOC100042326 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265541 GeneID:100042326
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478093.1

name	EG666502 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396983 GeneID:666502 MGI:3647466
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989381.1

name	LOC100042342 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265543 GeneID:100042342
definition	codon_start : 1 product : similar to 1700001F09Rik protein protein_id : XP_001478106.1

name	LOC666322 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265446 GeneID:666322
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476084.1

name	EG666561 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396991 GeneID:666561 MGI:3648126
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989707.1

name	LOC673132 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265448 GeneID:673132
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476155.1

name	EG623592 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396969 GeneID:623592 MGI:3646923
definition	codon_start : 1 product : similar to LOC635138 protein protein_id : XP_896727.2

name	Ear1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681249 CCDS:CCDS26964.1 GeneID:13586 MGI:108021
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : eosinophil-associated ribonuclease 1 product : eosinophil-associated, ribonuclease A family, member 1 protein_id : NP_031920.1

name	Ear10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426867 CCDS:CCDS26965.1 GeneID:93725 MGI:1890464
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA]; GO:0004540 - ribonuclease activity [Evidence ISS] [Evidence IDA] codon_start : 1 note : eosinophil-associated ribonuclease 10 product : eosinophil-associated, ribonuclease A family, member 10 protein_id : NP_444342.1

name	EG666451 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396972 GeneID:666451 MGI:3648791
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_993996.1

name	Ang3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265557 GeneID:11730 MGI:1201793
definition	codon_start : 1 product : angiogenin, ribonuclease A family, member 3 protein_id : XP_001478162.1

name	EG630952 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396996 GeneID:630952 MGI:3646399
definition	codon_start : 1 product : similar to angiogenin ribonuclease 6 protein_id : XP_990076.1

name	LOC100041356 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265453 GeneID:100041356
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476282.1

name	LOC100041364 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265455 GeneID:100041364
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476295.1

name	LOC100041371 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265457 GeneID:100041371
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476313.1

name	LOC100041376 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265459 GeneID:100041376
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476330.1

name	Ear2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681251 CCDS:CCDS26968.1 GeneID:13587 MGI:108020
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] [Evidence IDA] codon_start : 1 note : eosinophil-associated ribonuclease 2; eosinophil-derived neurotoxin; eosinophil-derived neurotoxin, liver; ribonuclease, RNase A family, 2 (liver,eosinophil-derived neurotoxin); eosinophil-associated ribonuclease 13 product : eosinophil-associated, ribonuclease A family, member 2 protein_id : NP_031921.1

name	LOC100041393 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265461 GeneID:100041393
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476367.1

name	LOC100041422 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265463 GeneID:100041422
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001476405.1

name	EG666638 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265466 GeneID:666638 MGI:3646502
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_990206.2

name	4930503E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729771 GeneID:74954 MGI:1922204
definition	codon_start : 1 product : hypothetical protein LOC74954 protein_id : NP_083407.1

name	EG666647 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397003 GeneID:666647 MGI:3643591
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990268.1

name	EG624862 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397005 GeneID:624862 MGI:3646742
definition	codon_start : 1 product : similar to E1B 19K/Bcl-2-binding protein homolog protein_id : XP_894501.2

name	EG666660 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397007 GeneID:666660 MGI:3643828
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990341.1

name	EG666667 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265468 GeneID:666667 MGI:3643831
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_990370.2

name	EG546250 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397011 GeneID:546250 MGI:3643645
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486530.3

name	EG666675 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265470 GeneID:666675 MGI:3646979
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990437.2

name	LOC100041497 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265473 GeneID:100041497
definition	codon_start : 1 product : similar to HN1-like protein protein_id : XP_001476516.1

name	EG666678 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397015 GeneID:666678 MGI:3648583
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990464.1

name	LOC676402 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265582 GeneID:676402
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478225.1

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 1 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 2 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 3 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 4 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 5 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 5 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 4 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 3 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 2 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 1 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 1 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 2 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 3 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 4 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 5 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 6 pseudo : _no_value

name	LOC100040890 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040890
definition	number : 3 pseudo : _no_value

name	LOC100040890 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040890
definition	number : 2 pseudo : _no_value

name	LOC100040890 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040890
definition	number : 1 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 1 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 2 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 3 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 4 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 5 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 6 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 7 pseudo : _no_value

name	LOC100040983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040983
definition	number : 4 pseudo : _no_value

name	LOC100040983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040983
definition	number : 3 pseudo : _no_value

name	LOC100040983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040983
definition	number : 2 pseudo : _no_value

name	LOC100040983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040983
definition	number : 1 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 1 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 2 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 3 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 4 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 5 pseudo : _no_value

name	LOC100041025 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041025
definition	number : 4 pseudo : _no_value

name	LOC100041025 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041025
definition	number : 3 pseudo : _no_value

name	LOC100041025 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041025
definition	number : 2 pseudo : _no_value

name	LOC100041025 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041025
definition	number : 1 pseudo : _no_value

name	LOC100041046 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041046
definition	number : 4 pseudo : _no_value

name	LOC100041046 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041046
definition	number : 3 pseudo : _no_value

name	LOC100041046 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041046
definition	number : 2 pseudo : _no_value

name	LOC100041046 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041046
definition	number : 1 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 1 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 2 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 3 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 4 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 5 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 6 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 5 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 4 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 3 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 2 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 1 pseudo : _no_value

name	LOC666454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666454
definition	number : 4 pseudo : _no_value

name	LOC666454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666454
definition	number : 3 pseudo : _no_value

name	LOC666454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666454
definition	number : 2 pseudo : _no_value

name	LOC666454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666454
definition	number : 1 pseudo : _no_value

name	EG640992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640992
definition	number : 4 pseudo : _no_value

name	EG640992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640992
definition	number : 3 pseudo : _no_value

name	EG640992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640992
definition	number : 2 pseudo : _no_value

name	EG640992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640992
definition	number : 1 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 6 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 5 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 4 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 3 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 2 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 1 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 1 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 2 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 3 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 4 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 5 pseudo : _no_value

name	LOC100041235 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041235
definition	number : 4 pseudo : _no_value

name	LOC100041235 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041235
definition	number : 3 pseudo : _no_value

name	LOC100041235 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041235
definition	number : 2 pseudo : _no_value

name	LOC100041235 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041235
definition	number : 1 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 4 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 3 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 2 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 1 pseudo : _no_value

name	LOC676304 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676304
definition	number : 4 pseudo : _no_value

name	LOC676304 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676304
definition	number : 3 pseudo : _no_value

name	LOC676304 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676304
definition	number : 2 pseudo : _no_value

name	LOC676304 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676304
definition	number : 1 pseudo : _no_value

name	LOC100041300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041300
definition	number : 1 pseudo : _no_value

name	LOC100041300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041300
definition	number : 2 pseudo : _no_value

name	LOC100041300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041300
definition	number : 3 pseudo : _no_value

name	LOC100041300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041300
definition	number : 4 pseudo : _no_value

name	LOC624717 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624717
definition	number : 1 pseudo : _no_value

name	LOC624717 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624717
definition	number : 2 pseudo : _no_value

name	LOC624717 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624717
definition	number : 3 pseudo : _no_value

name	LOC624717 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624717
definition	number : 4 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 6 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 5 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 4 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 3 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 2 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 1 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 5 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 4 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 3 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 2 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 1 pseudo : _no_value

name	LOC100041327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041327
definition	number : 1 pseudo : _no_value

name	LOC100041327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041327
definition	number : 2 pseudo : _no_value

name	LOC100041327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041327
definition	number : 3 pseudo : _no_value

name	LOC100041327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041327
definition	number : 4 pseudo : _no_value

name	LOC672161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672161
definition	number : 1 pseudo : _no_value

name	LOC672161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672161
definition	number : 2 pseudo : _no_value

name	LOC672161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672161
definition	number : 3 pseudo : _no_value

name	EG666621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666621
definition	number : 1 pseudo : _no_value

name	LOC100041494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041494
definition	number : 1 pseudo : _no_value

name	LOC100041494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041494
definition	number : 2 pseudo : _no_value

name	LOC100041494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041494
definition	number : 3 pseudo : _no_value

name	LOC100041494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041494
definition	number : 4 pseudo : _no_value

name	EG666264 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94396946 GeneID:666264 MGI:3648646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 11 Proteins product : predicted gene, EG666264 pseudo : _no_value transcript_id : XR_002297.1

name	EG546249 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265406 GeneID:546249 MGI:3646763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 5 Proteins product : predicted gene, EG546249 pseudo : _no_value transcript_id : XR_032222.1

name	LOC100040863 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265407 GeneID:100040863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins product : hypothetical protein LOC100040863 pseudo : _no_value transcript_id : XR_032231.1

name	LOC666436 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265528 GeneID:666436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 14 Proteins product : hypothetical LOC666436 pseudo : _no_value transcript_id : XR_033458.1

name	EG638353 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265427 GeneID:638353 MGI:3646628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 54 ESTs, 5 Proteins product : predicted gene, EG638353 pseudo : _no_value transcript_id : XR_032418.1

name	EG638262 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94396975 GeneID:638262 MGI:3648176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 14 Proteins product : predicted gene, EG638262 pseudo : _no_value transcript_id : XR_001875.1

name	LOC666481 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265535 GeneID:666481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 15 Proteins product : hypothetical LOC666481 pseudo : _no_value transcript_id : XR_033489.1

name	LOC545039 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265539 GeneID:545039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 14 Proteins product : hypothetical LOC545039 pseudo : _no_value transcript_id : XR_033508.1

name	LOC100041227 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265442 GeneID:100041227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to CDNA sequence BC061237 pseudo : _no_value transcript_id : XR_032515.1

clone name	MSMg01-274B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-161F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349I19
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-013O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262G15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-343K12.b	B6Ng01-343K12.g
ACC	GA126379	GA126380
length	1,100	1,139
definition	B6Ng01-343K12.b	B6Ng01-343K12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(44,065,731 - 44,066,833)	(43,981,784 - 43,982,934)
sequence	gaattccttgtacttgtcaatggaatcagttattgactgcttcatttttt ccatatccaacattgtcttctcatgttgtgatttaatgatggtgaattca gtgttcatcctgtggtagagcatggcccaaagaataaatcatcctctgaa ctaagcaaccaagtatcatgtgcaaaaaggctgtatctggaattcccaag gaaattgtatgccacatccttgctccttccaactgggtcctattggtact gattaaacttattatcttgggcagaggacagagagccaggggaccaaatg gagatagctgacgctcaagaaatcttaggtgagcctgaaggaatacacta gttctgtgaaatgtttctactagattgtcccacaggctttggtccttagt tttaaggctttttttcccctcttagttttaaggcagggataatcctttgt tcttattgctacatgaattctcagagggcataactagtatataacggaaa aggctttataacacttcctactccaggagaatcctatgtgacaccaagga aaacacagggaataaagaaccctgatgatcaatttgggcctctaagggct caacactatcattccctacaaactgtgcatcacacacatcctaagacccc atcaaaggtcccacaaccccagatcctgaacaaaacacacacaactaact tcacacacagaaaaaaaattaaaatgccaaataaatccaggtaggctcca tagtctcagagtacaatgaataaaacaagagtaaagcagtaatggcctgc agacattggattcttacacagtaaggcagctattgtgaccaggtccttcc agctgttgacaaaaccaatcagactccaagcacctcaaggccaagtacaa aagaggatgaccatacacacacatcacttatctcatccaacaatttaaca actgtcaagacttcttataatgaatgtgagagatgacacactcattcatg ggagaaaaatgtgggtcaacagagaagggcacaatacagtcaacaagata ctggggcataatttacctgtagtcaaatcagtatcatgtcaatgtcaaga	gaattcccatagctgtgctgcaaaacaggacgtttcaggagccccttgag ggtcataataatctaaagaactcacactattttatctgtgtagcattctg caattgctgttattcaaaatcattttatcagagttagaatgagcctaaat gggggttgggagaattgaggaacttcagacaggtctggtagtataaaatc aggtaggtgtttgagaagcaaggttcagaaagtagaaaagaatttcccct tgacccagagattccaaaaaaaaaagagtagatatacacagaatctctag ggcacatgaggtctgtaatggtcctcagagtagtctggaagaagatgata tcctgatgtccatcagctaaagagtgaaaatgtactatgtgatgcagccc tttcatgaactatggctcagtgtgagataatttatgcaagtatttgacct tcaactagttagcctcatattactcaaaatatccctgacacagttatatt atttgaagaacattgttccattggatcctatttataatgacttcctattt ttctgggatcatacctttggacaccaagtaggtcaggcaatgataaaggg agcctctaatggaaggaactgtttaatttgggacaagactgaaacagtga aggagaggctagtccaccaccaacacgtgatcctttgctggcagagaagc ctactctacacagtctttggaacttgctaagacagattgaataatgtacc aagaaccctggttcatgaggggaaagcatatcactgactgagctgtctat atgctttgcccactatatacctatctcatttaagatttgttttttatgtc tacaaaatatcctggagatttttataatagcattaactggggaatctaag cagtttgcttaaatataagtgctagtgttatgtgaatacaaataatttgt atatttgacagagtgctctacacaggcttagatttacagtgtgtgtatat ctttcatgccatcactttaaaattcagttctagcatgggaatatttttca ggtagcaattcctttctgatttaagacccatgcaggctgtgatccatgtt gatattgcttttctctgttatttccgatataggaattga
quality values	Open. Hide. 58 42 23 31 58 62 62 62 62 62 47 56 62 62 62 62 62 38 32 56 54 62 62 62 56 47 47 39 43 45 35 32 44 56 56 29 46 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 49 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 49 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 49 49 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 56 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 62 48 49 62 62 62 62 62 62 62 62 58 58 54 54 54 41 58 54 58 58 58 58 52 54 52 58 54 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 42 54 58 54 42 54 54 58 58 58 58 58 58 54 54 58 58 54 54 42 58 34 58 58 49 58 54 54 54 52 54 58 58 49 58 51 50 58 58 58 58 58 58 51 51 50 58 58 58 58 58 54 58 58 50 58 50 48 49 50 51 53 54 52 58 51 58 52 52 58 46 51 40 58 58 54 47 51 49 39 31 48 41 58 50 49 49 46 35 50 42 50 49 58 54 54 30 50 47 50 50 52 52 58 51 50 50 39 58 58 50 52 50 52 53 53 50 50 58 50 50 51 40 49 50 51 54 53 42 53 41 52 52 51 41 42 54 54 54 54 54 54 54 37 32 51 37 27 33 44 49 50 47 49 31 54 53 40 31 54 32 52 39 39 24 37 50 38 45 41 54 45 40 26 34 28 45 33 30 40 53 45 37 35 34 51 18 42 26 37 32 26 37 53 53 54 42 39 54 54 47 40 39 45 39 54 21 53 52 52 52 31 34 32 31 52 32 32 35 53 32 24 51 31 34 32 32 26 29 23 18 17 30 27 33 15 16 34 45 28 33 28 31 24 33 28 31 31 32 19 13 25 13 32 28 31 43 31 33 25 33 30 42 36 32 33 26 30 31 31 37 29 22 31 30 12 17 32 31 31 31 30 33 31 31 30 31 48 46 33 26 37 31 31 31 36 28 19 42 28 43 18 32 28 31 31 34 31 24 22 31 31 25 17 19 16 27 28 25 31 27 32 22 23 30 46 48 41 31 46 25 33 31 29 32 28 16 21 12 41 27 30 46 16 23 29 26 29 24 43 32 32 32 27 30 14 25 32 33 32 25 31 21 30 21 26 33 21 17 30 48 33 12 21 30 21 20 32 30 31 20 32 20 22 25 25 21 21 24 31 26 19 31 17 24 15 20 21 30 28 27 30 20 24 33 22 37 18 14 9 24 10 11 7 19 12 30 24 30 18 25 17 30 17 25 23 48 16 26 7 6 37 47 47 19 23 32 21 25 48 25 17 23 25 10 20 16 13 17 5 6 9 11 34 27 17 11 10 11 15 27 20 22 14 18 13 19 26 9 12 13 20 14 20 20 20 23 24 16 32 40 14 16 20 26 10 16 10 32 27 11 19 13 14 25 14 27 6 4 6 15 29 11 11 17 20 7 6 6 28 10 16 16 19 9 17 17 19 6 8 16 19 10 12 16 16	Open. Hide. 49 35 44 44 62 62 62 46 43 56 44 32 32 48 33 50 59 62 62 59 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 59 49 59 62 59 62 62 62 62 62 62 62 59 54 62 62 62 62 62 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 54 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 58 58 58 58 58 47 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 45 58 58 58 58 58 58 58 49 58 58 58 58 58 58 58 58 58 58 58 58 54 54 48 58 54 58 58 46 58 58 58 58 58 58 58 52 54 58 58 49 58 54 58 58 37 58 51 51 54 30 58 49 51 58 58 58 51 53 53 58 58 42 58 49 58 50 48 54 51 52 54 50 58 52 58 43 58 58 35 58 54 48 37 58 58 50 58 51 50 48 37 58 58 58 53 51 51 37 39 51 52 44 36 51 58 58 49 49 51 52 52 51 51 51 54 24 58 58 33 39 31 49 39 54 40 50 33 53 42 42 37 49 50 49 50 39 51 49 39 51 53 47 39 38 49 35 51 50 54 40 51 53 42 42 34 26 45 42 54 28 54 51 31 53 51 45 41 33 53 53 35 40 53 39 52 40 39 41 52 45 54 47 54 32 33 35 35 46 51 47 41 32 18 54 37 34 30 52 37 45 37 51 46 35 32 33 27 51 42 53 34 35 29 41 32 53 41 53 33 22 40 40 32 32 33 32 31 31 31 40 45 51 19 49 40 51 53 52 41 30 35 31 37 39 34 36 31 31 30 39 31 31 30 43 37 18 45 32 31 30 43 31 38 43 31 45 43 38 32 46 32 33 31 51 40 34 31 31 31 31 31 31 31 31 42 31 31 31 31 31 31 31 29 48 42 31 37 28 37 18 47 31 40 30 46 46 48 48 26 26 31 41 31 33 36 25 30 21 46 46 34 29 23 30 19 32 27 26 24 28 14 18 9 48 48 48 38 31 32 28 25 31 31 23 31 24 25 38 23 29 25 26 38 44 41 31 17 23 18 32 32 22 31 19 42 34 28 30 44 25 29 31 33 35 19 44 30 16 21 27 21 5 4 6 24 27 33 27 21 16 31 19 23 20 31 32 23 18 25 16 32 22 23 13 40 19 25 10 22 22 47 22 32 24 32 27 17 19 48 33 27 30 22 31 21 37 10 19 25 9 28 27 27 24 20 34 20 16 15 16 18 27 20 29 13 11 6 9 9 10 23 9 11 3 7 11 8 11 5 4 4 8 4 13 25 5 28 10 28 20 15 11 3 5 10 11 14 21 11 27 47 23 18 47 40 17 11 18 20 20 12 11 13 25 6 18 5 17 9 16 14 16 15 17 17 7 4 4 27 30 25 13 16 16 9 7 13 11 15 9 5 2 6 12 9 6 8 29 7 13 13 17 22 12 28 18 6 6 11 5 4 25 11 11 6 8 21 2 1 2 3 1 5 5 7 3 3 1 6 20 5 8 7 5 6 6 4 5 5 10 3 1 10 18 22 10 9 7 13 7 3 1 2 6 5 13 16 3 9 7 19 4 4 6 4 5 12 2 4 8 4 7 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_44065731_44066833
seq2: B6Ng01-343K12.b_45_1144 (reverse)

seq1  TCTTGGACATTGACATGAATACTGATTTGAACTACAGGTAAAATTATG-C  49
      |||| |||||||||||| ||||||||||| ||||||||| |||||||| |
seq2  TCTT-GACATTGACATG-ATACTGATTTG-ACTACAGGT-AAATTATGCC  46

seq1  CCAGTATCTTGTTGACTGTATTGTGCCC-TCTCTGTTGACCCACA-TTTT  97
      |||||||||||||||||||||||||||| |||||||||||||||| ||||
seq2  CCAGTATCTTGTTGACTGTATTGTGCCCTTCTCTGTTGACCCACATTTTT  96

seq1  CTCCCATGAATGGAGTGTGTCATCTCTCACATTCATTATAAGAAGTCTTG  147
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  CTCCCATGAAT-GAGTGTGTCATCTCTCACATTCATTATAAGAAGTCTTG  145

seq1  ACAGTTGTTAAATTGTTGGATGAGATAAGTGATGTGTGTTGTATGGTCAT  197
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  ACAGTTGTTAAATTGTTGGATGAGATAAGTGATGTGTG-TGTATGGTCAT  194

seq1  CCTCTTTTGTACTTGGCCTTGAGGTGCTTGGAGTCTGATTGGTTTTGTCA  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTTTTGTACTTGGCCTTGAGGTGCTTGGAGTCTGATTGGTTTTGTCA  244

seq1  ACAGCTGGAAGGACCTGGTCACAATAGCTGCCTTACTGTGTAAGAATCCA  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCTGGAAGGACCTGGTCACAATAGCTGCCTTACTGTGTAAGAATCCA  294

seq1  ATGTCTGCAGGCCATTACTGCTTTACTCTTGTTTTATTCATTGTACTCTG  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCTGCAGGCCATTACTGCTTTACTCTTGTTTTATTCATTGTACTCTG  344

seq1  AGACTATGGAGCCTACCTGGATTTATTTGGCATTTTAATTTTTTTTCTGT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTATGGAGCCTACCTGGATTTATTTGGCATTTTAATTTTTTTTCTGT  394

seq1  GTGTGAAGTTAGTTGTGTGTGTTTTGTTCAGGATCTGGGGTTGTGGGACC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGAAGTTAGTTGTGTGTGTTTTGTTCAGGATCTGGGGTTGTGGGACC  444

seq1  TTTGATGGGGTCTTAGGATGTGTGTGATGCACAGTTTGTAGGGAATGATA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGATGGGGTCTTAGGATGTGTGTGATGCACAGTTTGTAGGGAATGATA  494

seq1  GTGTTGAGCCCTTAGAGGCCCAAATTGATCATCAGGGTTCTTTATTCCCT  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTGAGCCCTTAGAGGCCCAAATTGATCATCAGGGTTCTTTATTCCCT  544

seq1  GTGTTTTCCTTGGTGTCACATAGGATTCTCCTGGAGTAGGAAGTGTTATA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTTTCCTTGGTGTCACATAGGATTCTCCTGGAGTAGGAAGTGTTATA  594

seq1  AAGCCTTTTCCGTTATATACTAGTTATGCCCTCTGAGAATTCATGTAGCA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCTTTTCCGTTATATACTAGTTATGCCCTCTGAGAATTCATGTAGCA  644

seq1  ATAAGAACAAAGGATTATCCCTGCCTTAAAACTAAGAGGGGAAAAAAAGC  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGAACAAAGGATTATCCCTGCCTTAAAACTAAGAGGGGAAAAAAAGC  694

seq1  CTTAAAACTAAGGACCAAAGCCTGTGGGACAATCTAGTAGAAACATTTCA  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAAAACTAAGGACCAAAGCCTGTGGGACAATCTAGTAGAAACATTTCA  744

seq1  CAGAACTAGTGTATTCCTTCAGGCTCACCTAAGATTTCTTGAGCGTCAGC  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAACTAGTGTATTCCTTCAGGCTCACCTAAGATTTCTTGAGCGTCAGC  794

seq1  TATCTCCATTTGGTCCCCTGGCTCTCTGTCCTCTGCCCAAGATAATAAGT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCTCCATTTGGTCCCCTGGCTCTCTGTCCTCTGCCCAAGATAATAAGT  844

seq1  TTAATCAGTACCAATAGGACCCAGTTGGAAGGAGCAAGGATGTGGCATAC  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATCAGTACCAATAGGACCCAGTTGGAAGGAGCAAGGATGTGGCATAC  894

seq1  AATTTCCTTGGGAATTCCAGATACAGCCTTTTTGCACATGATACTTGGTT  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTCCTTGGGAATTCCAGATACAGCCTTTTTGCACATGATACTTGGTT  944

seq1  GCTTAGTTCAGAGGATGATTTATTCTTTGGGCCATGCTCTACCACAGGAT  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTAGTTCAGAGGATGATTTATTCTTTGGGCCATGCTCTACCACAGGAT  994

seq1  GAACACTGAATTCACCATCATTAAATCACAACATGAGAAGACAATGTTGG  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACACTGAATTCACCATCATTAAATCACAACATGAGAAGACAATGTTGG  1044

seq1  ATATGGAAAAAATGAAGCAGTCAATAACTGATTCCATTGACAAGTACAAG  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGGAAAAAATGAAGCAGTCAATAACTGATTCCATTGACAAGTACAAG  1094

seq1  GAATTC  1103
      ||||||
seq2  GAATTC  1100

seq1: chr14_43981784_43982934
seq2: B6Ng01-343K12.g_66_1204

seq1  GAATTCCCATAGCTGTGCTGCAAAACAGGACGTTTCAGGAGCCCCTTGAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCATAGCTGTGCTGCAAAACAGGACGTTTCAGGAGCCCCTTGAG  50

seq1  GGTCATAATAATCTAAAGAACTCACACTATTTTATCTGTGTAGCATTCTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCATAATAATCTAAAGAACTCACACTATTTTATCTGTGTAGCATTCTG  100

seq1  CAATTGCCGTTATTCAAAATCATTTTATCAGAGTTAGAATGAGCCTAAAT  150
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  CAATTGCTGTTATTCAAAATCATTTTATCAGAGTTAGAATGAGCCTAAAT  150

seq1  GGGGGTTGGGAGAATTGAGGAACTTCAGACAGGTCTGGTAGTATAAAATC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGTTGGGAGAATTGAGGAACTTCAGACAGGTCTGGTAGTATAAAATC  200

seq1  AGGTAGGTGTTTGAGAAGCAAGGTTCAGAAAGTAGAAAAGAATTTCCCCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTAGGTGTTTGAGAAGCAAGGTTCAGAAAGTAGAAAAGAATTTCCCCT  250

seq1  TGACCCAGAGATTCC--AAAACAAGGAGTAGATATACACAGAGTCTCTAG  298
      |||||||||||||||  |||| || ||||||||||||||||| |||||||
seq2  TGACCCAGAGATTCCAAAAAAAAAAGAGTAGATATACACAGAATCTCTAG  300

seq1  GGCACATGAGGTCTGTAATGGTCCTCAGAGTAGTCCAGAAGAAGATGATA  348
      |||||||||||||||||||||||||||||||||||  |||||||||||||
seq2  GGCACATGAGGTCTGTAATGGTCCTCAGAGTAGTCTGGAAGAAGATGATA  350

seq1  TCCTGATGTCCATCAGCTAAAGAGTGAAAATGTACTATGTGATGCAGCCC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGATGTCCATCAGCTAAAGAGTGAAAATGTACTATGTGATGCAGCCC  400

seq1  TTTCATGAACTATTGCTCAGTGTGAGATAATCCATGCAAGTATTTGACCT  448
      ||||||||||||| |||||||||||||||||  |||||||||||||||||
seq2  TTTCATGAACTATGGCTCAGTGTGAGATAATTTATGCAAGTATTTGACCT  450

seq1  TCAACTAGTTAGCCTCATATTACTCCAAATATCCCTGACACAGTTATATT  498
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TCAACTAGTTAGCCTCATATTACTCAAAATATCCCTGACACAGTTATATT  500

seq1  ATTTGAAGAACATTGTTCCATTGGATCCTATTTATAATGACTTCCTATGT  548
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  ATTTGAAGAACATTGTTCCATTGGATCCTATTTATAATGACTTCCTATTT  550

seq1  TTCTGGGATCATACCTTTGGATACCAAATAGGTCAGGCAATGATAAAGGG  598
      ||||||||||||||||||||| ||||| ||||||||||||||||||||||
seq2  TTCTGGGATCATACCTTTGGACACCAAGTAGGTCAGGCAATGATAAAGGG  600

seq1  AACCTCTAATGGAAGGAACTGTTTACTTTGGGACAAGACTGAAACAGTGA  648
      | ||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  AGCCTCTAATGGAAGGAACTGTTTAATTTGGGACAAGACTGAAACAGTGA  650

seq1  AGGAGAGGCTAGTCCACCACCAACACGTGATCCTTTGCTGGCAGAGAAGC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGAGGCTAGTCCACCACCAACACGTGATCCTTTGCTGGCAGAGAAGC  700

seq1  CTACTCTACACATCCTTTGGAACTTGCTAAGACAGATTGAATAATGTACC  748
      ||||||||||||  ||||||||||||||||||||||||||||||||||||
seq2  CTACTCTACACAGTCTTTGGAACTTGCTAAGACAGATTGAATAATGTACC  750

seq1  AAGAACCCCGGTTCATGAGGGGAAAGCATATCACTGACTGAGCTGTCTAT  798
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  AAGAACCCTGGTTCATGAGGGGAAAGCATATCACTGACTGAGCTGTCTAT  800

seq1  ATGCTTTGCCCACTATGTACCTATCCCATTTAAGATTTGTTTTTTATGTC  848
      |||||||||||||||| |||||||| ||||||||||||||||||||||||
seq2  ATGCTTTGCCCACTATATACCTATCTCATTTAAGATTTGTTTTTTATGTC  850

seq1  TACAAAATATCCTGGGAGATTTTTATAATAGCATTAACTGGGGAATCTAA  898
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TACAAAATATCCT-GGAGATTTTTATAATAGCATTAACTGGGGAATCTAA  899

seq1  ACAGTTTGCTGAAGTATAAGGTGCTAGTGTTATGTGAATACAAATAATTT  948
       ||||||||| || ||||| ||||||||||||||||||||||||||||||
seq2  GCAGTTTGCTTAAATATAA-GTGCTAGTGTTATGTGAATACAAATAATTT  948

seq1  GTATATTTGACAGAGTGCTCTACAACAGGCTTAGATATACAGGTGTGTTG  998
      ||||||||||||||||||||||| |||||||||||| |||| ||||||  
seq2  GTATATTTGACAGAGTGCTCTAC-ACAGGCTTAGATTTACA-GTGTGT--  994

seq1  TTATATTCCTTCATGGCCATCACTTTTAAAATTCAGTTCCTAGCCATGGG  1048
       |||| || ||||| |||||||| |||||||||||||| |||| ||||||
seq2  GTATA-TCTTTCAT-GCCATCAC-TTTAAAATTCAGTT-CTAG-CATGGG  1039

seq1  AATA-TTTTCAGTTAGCACATTCTTTCTGATTTTAGTACCCATGCAGTGC  1097
      |||| ||||||| |||||  | ||||||||||| || |||||||||  | 
seq2  AATATTTTTCAGGTAGCAATTCCTTTCTGATTTAAG-ACCCATGCA--GG  1086

seq1  CTGTGGATTTCGTG-TGATAT--GTTTTCTCTGGTTATTTCCAGATATAG  1144
      |||||   | | || ||||||   |||||||| ||||||||| |||||||
seq2  CTGTG--ATCCATGTTGATATTGCTTTTCTCT-GTTATTTCC-GATATAG  1132

seq1  GAATTGA  1151
      |||||||
seq2  GAATTGA  1139

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information