MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-419O17
Chromosome	14 (Build37)
Map Location	26,049,642 - 26,049,875
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Dlg5, LOC100039335, E330034G19Rik, LOC669325, Polr3a, Rps24, LOC669315, LOC100039411
Downstream gene	Zmiz1, I920194n01, LOC100039007, 4931406H21Rik, Ppif, 2310047A01Rik, Anxa11, Plac9, D14Ertd449e, Cphx, 1110051B16Rik, LOC100039468, LOC100039484, LOC100039175, LOC100039192, LOC100039213, LOC100039227, LOC100039503, LOC100039246, LOC100039257, LOC100039280
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dlg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71228 MGI:1918478
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 177 ESTs, 3 Proteins

name	LOC100039335 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	E330034G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105418 MGI:2145557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Polr3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218832 MGI:2681836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20088 MGI:98147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC669315 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100039411 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Zmiz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328365 MGI:3040693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	I920194n01 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100039007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4931406H21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77592 MGI:1924842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppif (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105675 MGI:2145814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310047A01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71918 MGI:1919168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 134 ESTs, 2 Proteins

name	Anxa11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11744 MGI:108481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plac9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211623 MGI:2663998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D14Ertd449e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66039 MGI:1196450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cphx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105594 MGI:2145733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110051B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278672 MGI:1916048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC100039484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 3 Proteins

name	LOC100039175 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 99 ESTs, 2 Proteins

name	LOC100039192 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 204 ESTs, 5 Proteins

name	LOC100039213 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 54 ESTs, 2 Proteins

name	LOC100039227 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 24 ESTs, 1 Protein

name	LOC100039503 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 4 Proteins

name	LOC100039246 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 99 ESTs, 2 Proteins

name	LOC100039257 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 197 ESTs, 5 Proteins

name	LOC100039280 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 54 ESTs, 2 Proteins

name	Dlg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396719 GeneID:71228 MGI:1918478
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 173 ESTs, 2 Proteins product : discs, large homolog 5 (Drosophila), transcript variant 2 transcript_id : XM_977694.1

name	Dlg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396721 GeneID:71228 MGI:1918478
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 176 ESTs, 2 Proteins product : discs, large homolog 5 (Drosophila), transcript variant 1 transcript_id : XM_907765.2

name	E330034G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367336 GeneID:105418 MGI:2145557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330034G19 gene transcript_id : NM_001033214.2

name	LOC669325 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265260 GeneID:669325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC669325 transcript_id : XM_001474368.1

name	Polr3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486962 GeneID:218832 MGI:2681836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) III (DNA directed) polypeptide A transcript_id : NM_001081247.1

name	Rps24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46519159 GeneID:20088 MGI:98147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S24 transcript_id : NM_207635.1

name	Rps24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46519155 GeneID:20088 MGI:98147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S24 transcript_id : NM_011297.2

name	Rps24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46519157 GeneID:20088 MGI:98147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S24 transcript_id : NM_207634.1

name	LOC669315 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265351 GeneID:669315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to C33G8.2 transcript_id : XM_001472822.1

name	Zmiz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41053863 GeneID:328365 MGI:3040693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MIZ-type containing 1 transcript_id : NM_183208.2

name	I920194n01 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265325 GeneID:328364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : RIKEN cDNA I920194N01gene transcript_id : XM_001472051.1

name	LOC100039007 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265323 GeneID:100039007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039007 transcript_id : XM_001472026.1

name	4931406H21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350685 GeneID:77592 MGI:1924842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931406H21 gene transcript_id : NM_175264.3

name	Ppif (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527309 GeneID:105675 MGI:2145814
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase F (cyclophilin F) transcript_id : NM_134084.1

name	2310047A01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265327 GeneID:71918 MGI:1919168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 134 ESTs, 2 Proteins product : RIKEN cDNA 2310047A01 gene transcript_id : XM_975187.2

name	Anxa11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304884 GeneID:11744 MGI:108481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A11 transcript_id : NM_013469.1

name	Plac9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402208 GeneID:211623 MGI:2663998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : placenta specific 9 transcript_id : NM_207229.1

name	D14Ertd449e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313631 GeneID:66039 MGI:1196450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 14, ERATO Doi 449, expressed transcript_id : NM_025311.1

name	Cphx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802126 GeneID:105594 MGI:2145733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytoplasmic polyadenylated homeobox transcript_id : NM_175342.3

name	1110051B16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34419644 GeneID:278672 MGI:1916048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110051B16 gene transcript_id : NM_183389.1

name	LOC100039468 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265353 GeneID:100039468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : similar to Ubtf protein transcript_id : XM_001472941.1

name	LOC100039484 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265355 GeneID:100039484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 3 Proteins product : similar to Annexin A11 transcript_id : XM_001472963.1

name	LOC100039175 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265328 GeneID:100039175
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 99 ESTs, 2 Proteins product : similar to Placenta specific 9 transcript_id : XM_001472394.1

name	LOC100039192 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265330 GeneID:100039192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 187 ESTs, 4 Proteins product : similar to D14Ertd449e protein, transcript variant 1 transcript_id : XM_001472492.1

name	LOC100039192 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265332 GeneID:100039192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 106 ESTs, 1 Protein product : similar to D14Ertd449e protein, transcript variant 2 transcript_id : XM_001472510.1

name	LOC100039213 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265334 GeneID:100039213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 54 ESTs, 2 Proteins product : hypothetical protein LOC100039213 transcript_id : XM_001472528.1

name	LOC100039227 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265336 GeneID:100039227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 24 ESTs, 1 Protein product : similar to RIKEN cDNA 1110051B16 gene transcript_id : XM_001472554.1

name	LOC100039503 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265357 GeneID:100039503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 4 Proteins product : similar to Annexin A11 transcript_id : XM_001473015.1

name	LOC100039246 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265338 GeneID:100039246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 99 ESTs, 2 Proteins product : similar to Placenta specific 9 transcript_id : XM_001472576.1

name	LOC100039257 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265340 GeneID:100039257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 180 ESTs, 4 Proteins product : similar to D14Ertd449e protein, transcript variant 1 transcript_id : XM_001472657.1

name	LOC100039257 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265342 GeneID:100039257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 105 ESTs, 1 Protein product : similar to D14Ertd449e protein, transcript variant 2 transcript_id : XM_001472673.1

name	LOC100039280 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265344 GeneID:100039280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 54 ESTs, 2 Proteins product : hypothetical protein LOC100039280 transcript_id : XM_001472694.1

name	Dlg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396722 GeneID:71228 MGI:1918478
definition	codon_start : 1 product : discs large homolog 5 isoform 1 protein_id : XP_912858.2

name	Dlg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396720 GeneID:71228 MGI:1918478
definition	codon_start : 1 product : discs large homolog 5 isoform 2 protein_id : XP_982788.1

name	E330034G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701716 GeneID:105418 MGI:2145557
definition	codon_start : 1 product : hypothetical protein LOC105418 protein_id : NP_001028386.1

name	LOC669325 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265261 GeneID:669325
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474418.1

name	Polr3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486963 GeneID:218832 MGI:2681836
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : polymerase (RNA) III (DNA directed) polypeptide A, 155kDa protein_id : NP_001074716.1

name	Rps24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519158 GeneID:20088 MGI:98147
definition	GO_component : GO:0005843 - cytosolic small ribosomal subunit (sensu Eukaryota) [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; MRP S24 product : ribosomal protein S24 isoform 2 protein_id : NP_997517.1

name	Rps24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519156 GeneID:20088 MGI:98147
definition	GO_component : GO:0005843 - cytosolic small ribosomal subunit (sensu Eukaryota) [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; MRP S24 product : ribosomal protein S24 isoform 1 protein_id : NP_035427.2

name	Rps24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519160 GeneID:20088 MGI:98147
definition	GO_component : GO:0005843 - cytosolic small ribosomal subunit (sensu Eukaryota) [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; MRP S24 product : ribosomal protein S24 isoform 3 protein_id : NP_997518.1

name	LOC669315 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265352 GeneID:669315
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472872.1

name	I920194n01 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265326 GeneID:328364
definition	codon_start : 1 product : hypothetical protein LOC328364 protein_id : XP_001472101.1

name	LOC100039007 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265324 GeneID:100039007
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472076.1

name	Zmiz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41053864 CCDS:CCDS26873.1 GeneID:328365 MGI:3040693
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : retinoic acid induced 17 protein_id : NP_899031.2

name	4931406H21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424914 GeneID:77592 MGI:1924842
definition	codon_start : 1 product : hypothetical protein LOC77592 protein_id : NP_780473.1

name	Ppif (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527310 CCDS:CCDS26874.1 GeneID:105675 MGI:2145814
definition	EC_number : 5.2.1.8 GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0042277 - peptide binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : rotamase; cyclophilin F; peptidyl-prolyl cis-trans isomerase; cyclophilin D product : peptidylprolyl isomerase F protein_id : NP_598845.1

name	2310047A01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396733 GeneID:71918 MGI:1919168
definition	codon_start : 1 product : hypothetical protein LOC71918 protein_id : XP_980281.1

name	Anxa11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304885 CCDS:CCDS26875.1 GeneID:11744 MGI:108481
definition	GO_component : GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0008429 - phosphatidylethanolamine binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS] codon_start : 1 exception : mismatches in translation note : annexin XI product : annexin A11 protein_id : NP_038497.1

name	Plac9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402209 GeneID:211623 MGI:2663998
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : placenta specific 9 protein_id : NP_997112.1

name	D14Ertd449e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313632 CCDS:CCDS26876.1 GeneID:66039 MGI:1196450
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66039 protein_id : NP_079587.1

name	Cphx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425034 CCDS:CCDS26877.1 GeneID:105594 MGI:2145733
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cytoplasmic polyadenylated homeobox protein_id : NP_780551.1

name	1110051B16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34419645 CCDS:CCDS26878.1 GeneID:278672 MGI:1916048
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC278672 protein_id : NP_899245.1

name	LOC100039468 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265354 GeneID:100039468
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472991.1

name	LOC100039484 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265356 GeneID:100039484
definition	codon_start : 1 product : similar to Annexin A11 protein_id : XP_001473013.1

name	LOC100039175 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265329 GeneID:100039175
definition	codon_start : 1 product : similar to Placenta specific 9 protein_id : XP_001472444.1

name	LOC100039192 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265331 GeneID:100039192
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472542.1

name	LOC100039192 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265333 GeneID:100039192
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472560.1

name	LOC100039213 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265335 GeneID:100039213
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472578.1

name	LOC100039227 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265337 GeneID:100039227
definition	codon_start : 1 product : similar to RIKEN cDNA 1110051B16 gene protein_id : XP_001472604.1

name	LOC100039503 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265358 GeneID:100039503
definition	codon_start : 1 product : similar to Annexin A11 protein_id : XP_001473065.1

name	LOC100039246 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265339 GeneID:100039246
definition	codon_start : 1 product : similar to Placenta specific 9 protein_id : XP_001472626.1

name	LOC100039257 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265341 GeneID:100039257
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472707.1

name	LOC100039257 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265343 GeneID:100039257
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472723.1

name	LOC100039280 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265345 GeneID:100039280
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472744.1

name	LOC100039335 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039335
definition	number : 5 pseudo : _no_value

name	LOC100039335 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039335
definition	number : 4 pseudo : _no_value

name	LOC100039335 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039335
definition	number : 3 pseudo : _no_value

name	LOC100039335 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039335
definition	number : 2 pseudo : _no_value

name	LOC100039335 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039335
definition	number : 1 pseudo : _no_value

name	LOC100039411 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039411
definition	number : 1 pseudo : _no_value

clone name	MSMg01-369M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-468A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-189N01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-266B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-462I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331D02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-278A22
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-006G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291M02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-419O17.T7 (MSMg01no419_o17.b1)	MSMg01-419O17.TJ (MSMg01no419_o17.g1)
ACC	AG514907	AG514908
length	779	786
length of high quality (start - end)	231 (92 - 322)	512 (61 - 572)
definition	CHROMAT_FILE: MSMg01no419_o17.b1 PHD_FILE: MSMg01no419_o17.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:39:36 2005	CHROMAT_FILE: MSMg01no419_o17.g1 PHD_FILE: MSMg01no419_o17.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:39:36 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CACTTTCCTCAAAAATTGTGGGGCGAAAAGAGNNNCATATCTTTCAAAAA CGGGGGAANNCCAGGCTTTCCCCCAATGGATTTGTAACTCAGGGGAAACA ATCTGACCCATGTATTCTTCAGTCTGTTCAACCAGAAAATATGGTAATTA TATTTCAATCTCCAGAAATTACGGAGGGAAATCAGCAATGAATTAAGTCA CCTAGGCAAGGCTTCTGGGTGGTTGAGTGTCTCCTGGCTGGGGCAGAATA AGTGAACTCTTATTTTATTTTTTAATTATTATTTTTTTTACCATGGTGCA TCTCTTCTGGTCTACACATCTTCTTTTCTGAATTCAGTGGTGGAAGTGTG GCTTTCCATTCAGCCTTTTGTGTATGGTGTTGNAGNTTAATTAGAAATGC TTTTTCTGTCCTGGNAGCATGTACCCTAATGACCTGGCTTATAAGGGAAG ACACTGAAGTACAATCAACTGAGGTTTATCTATGTGGGTAACTCCTGGGG CTCCCTGCTCTGAACTGAAACCGGAAGGCCACTTATTGATCCCCACCGCC CGGTGGTGCCCCGGGCTTCCTCAGTAAAAATGGTTGGGGAGGGCCATCGG TGTTTCCCCCCCCCCTAGATCTGGCCCTCTAAAATATTGATCCCCCTTGT CTCCCTCCTTTTTTTTTCCCCCCCCCTCTCCCCCGTGTCCCACTAAATTA TAACACCACTTTTCCCTTTTTTTTTTTTTTAATTTTTACCCCCGTCTAAT ATTCCCCCGTTTTATTTTTTTTCTCTCCC	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXCACTCCCTGGCGACTATGTTTTCAAATATATGAGCCTATG GGTGCCATCTTATTCAAATCACCACAGTGTCCATATAAAGAATCAGCAAG GAGCCATTCACCCATCTTTAAAATTTTTGACCCAGAATTGCTCCTGTCTA AAGGAAATGCAGGAACAAAAATGGAGCTGAAACTGAAGGAAAGGCCATCC AGATACCTGCCCAATTTAGGATCCATCCCATGCTCAGGCACCAAACCCTG ACACCATTACTGATGTCTTGTTGTACTTGCAGACAGGAGCTAGCATGGCT GTCCTCTGAGAGGCTCACCATCAGCTGACTGAGACAGATGCTGATACTTA GAGCCAATCATTGGACTGAGGTCAGGGACCCCTATGGAAGAGTTAGGGGA AGGACTGAATGAGCTGAAGGGGATGGCAACCCCGTAGGAAGAACAACACT ATCAACTAATCGAGACCTCTCAAAGCTCCCAGAGAAGAAGCTACCANACA AAGAGCATTCATGGGCTGGTCTGTGGCCTCTTCTACATTTGTAGCAGAGG ATTTGCTTGTCTGGGCTAAATGGGAAAGGACGTGCTTAATTAATCCTGGA GAAACTTGAGCCCCACGAAAGGGGATGCTATTGGGTGAAGGGGGGAATGC TGTTCTTNGTTCCCTTTTTCTTCACCTTTTTCCTCCAATATTCTTTCATT ACTCTCTCTATCTCTCCTTTCTCATTTCCCCTTCCN
quality values	Open. Hide. 7 8 8 10 8 6 6 6 6 6 8 11 14 8 8 8 8 8 8 8 8 10 10 8 7 8 9 10 10 13 10 3 0 0 0 3 8 8 6 7 10 8 8 8 8 8 10 10 10 10 10 9 9 8 9 8 12 3 0 0 3 8 8 8 6 9 9 9 9 9 9 9 15 11 9 9 9 9 9 11 18 14 14 9 9 9 12 15 16 16 13 13 20 30 37 29 19 17 18 18 22 27 40 40 43 40 33 37 39 39 47 47 57 47 50 50 50 50 50 50 48 48 48 48 57 48 42 42 39 39 42 48 48 54 54 54 50 51 48 50 50 50 50 47 41 47 50 50 50 50 57 68 50 50 50 46 46 41 50 57 57 57 47 47 48 57 57 57 57 57 47 48 48 48 57 57 57 54 50 57 57 57 57 47 48 57 57 57 57 50 54 54 57 57 54 54 59 57 57 57 57 52 57 52 52 52 57 57 52 57 52 57 57 57 57 57 57 57 50 50 50 47 47 43 44 43 43 43 40 40 40 57 57 57 57 44 44 47 48 59 57 59 59 59 57 57 57 57 57 57 57 57 57 48 57 57 57 57 57 57 57 59 59 57 57 57 57 57 57 54 54 54 57 57 68 68 68 68 57 68 57 57 57 57 59 59 57 57 57 57 57 57 57 57 57 59 59 48 48 48 59 59 59 59 59 59 59 44 41 37 44 41 47 47 47 50 50 47 47 27 21 8 8 8 8 8 11 11 11 18 12 15 23 25 37 41 50 50 53 50 57 57 57 59 57 48 48 48 43 43 43 43 48 48 44 48 47 47 47 41 37 37 30 25 22 30 34 47 39 32 34 28 35 31 27 30 19 19 11 11 11 3 0 3 3 0 3 27 27 41 39 39 36 36 30 36 27 37 37 37 39 59 59 59 59 30 26 17 17 18 27 21 15 3 0 3 17 22 34 34 21 20 12 12 12 22 27 25 25 16 16 11 11 11 14 19 20 18 10 10 8 8 8 13 18 26 22 28 16 12 10 11 11 10 15 15 16 12 12 14 19 11 12 9 14 11 9 8 10 11 10 8 10 12 10 12 12 15 8 8 9 10 10 10 10 10 9 11 10 10 9 9 10 14 13 13 11 10 10 9 10 10 10 10 10 10 10 10 10 13 8 8 8 8 8 8 10 9 8 8 8 10 10 11 11 8 8 6 6 6 6 8 8 8 8 8 8 8 9 11 10 10 18 8 7 7 8 8 8 9 8 8 8 7 10 10 10 11 12 11 18 10 10 10 10 10 10 8 8 6 6 6 10 8 8 8 12 11 6 6 6 6 6 8 11 11 11 9 9 10 10 10 10 10 8 6 6 8 6 7 6 8 8 15 10 10 13 18 21 22 9 9 9 10 10 10 8 8 6 6 8 10 10 8 8 11 10 8 8 8 8 8 10 12 15 10 9 8 6 6 6 6 10 8 12 12 12 8 8 8 8 8 8 13 10 9 9 10 10 10 18 31 37 41 27 22 18 15 14 9 10 9 9 9 9 11 10 10 9 10 9 6 8 8 8 8 8 8 10 10 10 12 12 13 12 13 12 12 7 6 6 6 6 8 8 6 7 6 6 8 6 7 11 9 9 10 11 12 13 10 10 10 10 12 12 12 10 8 8 8 10 10 10 9 8 10 8 6 6 10 10 8 8 8 8 10 6 6 6 6 7 7 11 11 13 8 8 9 9 10 12 11 8 8 8 8 9 13 16 13 10 10 9 9 9 9 14 19 19	Open. Hide. 26 26 31 31 39 39 39 39 39 39 39 39 44 44 39 47 47 27 27 9 11 9 8 8 8 10 8 10 11 11 12 13 28 21 28 28 37 33 33 50 50 50 50 50 50 33 21 21 11 11 10 10 13 9 9 9 18 23 30 31 33 33 33 33 59 59 59 59 59 59 57 57 57 57 57 57 57 57 59 57 47 47 42 42 42 53 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 50 50 47 47 47 51 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 68 68 68 68 68 68 68 68 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 59 57 57 57 57 68 68 57 57 57 57 59 59 59 59 68 68 68 57 57 47 47 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 57 53 53 50 50 53 57 53 53 59 59 59 59 59 36 27 12 8 8 8 10 10 15 18 30 30 47 59 59 59 59 59 59 57 57 57 57 53 53 53 53 53 53 57 59 59 59 59 68 68 68 68 68 68 68 68 68 57 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 59 59 59 57 68 57 57 57 57 59 59 59 59 68 68 68 53 53 48 50 50 54 57 68 68 68 68 59 59 59 57 57 57 57 57 57 59 59 59 59 59 48 48 48 48 48 48 48 59 59 59 59 46 39 37 43 39 34 36 43 44 37 37 30 32 27 29 39 43 41 41 37 43 43 34 34 34 29 36 37 37 39 37 37 41 41 41 41 46 46 47 41 41 41 41 37 40 36 31 31 43 43 47 37 37 30 26 26 32 30 15 9 9 9 9 17 20 39 39 37 37 24 24 20 15 15 15 15 18 28 32 37 37 34 19 16 3 0 3 23 19 37 35 37 35 30 35 39 34 34 25 25 25 30 30 34 39 32 30 17 19 12 22 12 8 8 8 8 8 10 13 19 19 28 28 20 12 10 11 11 10 10 8 8 8 8 6 6 9 9 9 10 9 8 8 8 11 9 11 10 14 23 21 20 18 9 10 10 7 7 6 9 10 19 19 19 19 10 8 8 8 8 8 8 11 15 15 14 11 8 8 8 8 8 8 8 8 8 8 8 8 10 6 7 6 6 6 7 10 12 12 10 10 9 7 7 7 8 9 9 9 10 10 18 16 12 18 13 8 8 6 6 8 6 9 8 8 13 10 8 8 8 9 9 9 11 10 10 10 8 8 8 8 8 8 11 8 3 0 3 7 8 8 15 21 22 34 26 15 10 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 8 6 6 8 6 9 9 10 13 10 10 8 8 8 8 9 9 6 8 6 6 12 12 10 8 8 8 15 8 10 10 15 17 19 10 8 8 8 8 8 8 8 8 8 8 8 9 10 9 9 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no419_o17.b1 MSMg01no419_o17.b1 CHROMAT_FILE:
MSMg01no419_o17.b1 PHD_FILE: MSMg01no419_o17.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:39:36 2005
         (231 letters)



>mm_chr14_26049508_26050138
          Length = 631

 Score =  422 bits (218), Expect = e-122
 Identities = 229/234 (97%), Gaps = 3/234 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   ggggaaacaatctgacccatgtattcttcagtctgttcaaccagaaaatatggtaattat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 368 ggggaaacaatctgacccatgtattcttcagtctgttcaaccagaaaatatggtaattat 309

                                                                       
Query: 61  atttcaatctccagaaattacggagggaaatcagcaatgaattaagtcacctaggcaagg 120
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 308 atttcaatctccagaaattacggagggaaattagcaatgaattaagtcacctaggcaagg 249

                                                                       
Query: 121 cttctgggtggttgagtgtctcctggctggggcagaataagtgaactcttattttatttt 180
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 248 cttctgggtggttgagtgtctcctggctggggcagaataagcgaactcttattttatttt 189

                                                                 
Query: 181 ttaattattatt---ttttttaccatggtgcatctcttctggtctacacatctt 231
           ||||||||||||   |||||||||||||||||||||||||||||||||||||||
Sbjct: 188 ttaattattattattttttttaccatggtgcatctcttctggtctacacatctt 135


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 11
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 231
Length of database: 631
Length adjustment: 9
Effective length of query: 222
Effective length of database: 622
Effective search space:   138084
Effective search space used:   138084
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information