MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-128A12
Chromosome	15 (Build37)
Map Location	77,170,278 - 77,171,381
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Cyc1, Sharpin, Maf1, EG626280, Brp16, Tssk5, Bop1, Scx, Hsf1, Dgat1, Scrt1, LOC666497, EG666504, Fbxl6, Gpr172b, Adck5, Cpsf1, Slc39a4, Vps28, Nfkbil2, Cyhr1, Kifc2, Foxh1, Ppp1r16a, Gpt1, Mfsd3, Recql4, Lrrc14, Lrrc24, C030006K11Rik, D15Wsu169e, Zfp251, Zfp7, Commd5, Rpl8, Zfp647, 1110038F14Rik, Mb, Apol6, Rbm9
Downstream gene	LOC100042318, Apol3, BC020489, BC085284, LOC624454, EG666639, 9030421J09Rik, EG626615, 2210421G13Rik, 9130218O11Rik, LOC666661, A330102K04Rik, EG545115, LOC666348, LOC666679, 2310016F22Rik, Apol2, Myh9, Txn2, Foxred2, Eif3s7, Cacng2, Rabl4, Pvalb, Ncf4, Csf2rb2, Csf2rb1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cyc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66445 MGI:1913695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sharpin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106025 MGI:1913331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68877 MGI:1916127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626280 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626280 MGI:3647392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Brp16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59053 MGI:1930628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73542 MGI:1920792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bop1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12181 MGI:1334460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20289 MGI:102934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15499 MGI:96238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13350 MGI:1333825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scrt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170729 MGI:2176606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins pseudo : _no_value

name	EG666504 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666504 MGI:3647471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Fbxl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30840 MGI:1354705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr172b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52710 MGI:1289288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adck5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268822 MGI:2679274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94230 MGI:2679722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72027 MGI:1919277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66914 MGI:1914164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfkbil2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72749 MGI:1919999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyhr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54151 MGI:1859320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kifc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16581 MGI:109187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14106 MGI:1347465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r16a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73062 MGI:1920312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76282 MGI:95802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfsd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69572 MGI:1916822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Recql4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79456 MGI:1931028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223664 MGI:2445060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378937 MGI:3605040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030006K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223665 MGI:1925941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	D15Wsu169e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223666 MGI:107858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp251 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71591 MGI:1918841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223669 MGI:99208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Commd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66398 MGI:1913648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26961 MGI:1350927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp647 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239546 MGI:3052806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110038F14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117171 MGI:2152337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17189 MGI:96922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apol6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71939 MGI:1919189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 2 Proteins

name	Rbm9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93686 MGI:1933973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Apol3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75761 MGI:1923011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC020489 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223672 MGI:3606001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 70 ESTs, 16 Proteins

name	BC085284 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278679 MGI:3583950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs

name	EG666639 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666639 MGI:3646501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	9030421J09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245282 MGI:3036238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626615 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626615 MGI:3649094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins

name	2210421G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108956 MGI:1920912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130218O11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328561 MGI:3043522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666661 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 54 ESTs, 16 Proteins

name	A330102K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328563 MGI:3036248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 2 Proteins

name	EG545115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545115 MGI:3646982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666348 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 16 Proteins

name	LOC666679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	2310016F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71898 MGI:1919148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apol2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239552 MGI:2444921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 19 Proteins

name	Myh9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17886 MGI:107717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56551 MGI:1929468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxred2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239554 MGI:106315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55944 MGI:1933181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12300 MGI:1316660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67042 MGI:1914292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pvalb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19293 MGI:97821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17972 MGI:109186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf2rb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12984 MGI:1339760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf2rb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12983 MGI:1339759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363130 GeneID:66445 MGI:1913695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c-1 transcript_id : NM_025567.2

name	Sharpin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076870 GeneID:106025 MGI:1913331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SHANK-associated RH domain interacting protein transcript_id : NM_025340.1

name	Maf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982639 GeneID:68877 MGI:1916127
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAF1 homolog (S. cerevisiae) transcript_id : NM_026859.2

name	EG626280 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266671 GeneID:626280 MGI:3647392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG626280 transcript_id : XM_890873.3

name	Brp16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946997 GeneID:59053 MGI:1930628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain protein 16 transcript_id : NM_021555.1

name	Tssk5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676381 GeneID:73542 MGI:1920792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 5 transcript_id : NM_183099.2

name	Bop1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304930 GeneID:12181 MGI:1334460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : block of proliferation 1 transcript_id : NM_013481.1

name	Scx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254412 GeneID:20289 MGI:102934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scleraxis transcript_id : NM_198885.2

name	Hsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130831 GeneID:15499 MGI:96238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock factor 1 transcript_id : NM_008296.2

name	Dgat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981804 GeneID:13350 MGI:1333825
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol O-acyltransferase 1 transcript_id : NM_010046.2

name	Scrt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722996 GeneID:170729 MGI:2176606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scratch homolog 1, zinc finger protein (Drosophila) transcript_id : NM_130893.3

name	EG666504 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398749 GeneID:666504 MGI:3647471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : predicted gene, EG666504 transcript_id : XM_984290.1

name	Fbxl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305044 GeneID:30840 MGI:1354705
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 6 transcript_id : NM_013909.1

name	Gpr172b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378563 GeneID:52710 MGI:1289288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 172B transcript_id : NM_029643.3

name	Adck5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801210 GeneID:268822 MGI:2679274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aarF domain containing kinase 5 transcript_id : NM_172960.2

name	Cpsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16751834 GeneID:94230 MGI:2679722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage and polyadenylation specific factor 1 transcript_id : NM_053193.1

name	Slc39a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754010 GeneID:72027 MGI:1919277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 4 transcript_id : NM_028064.2

name	Vps28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801279 GeneID:66914 MGI:1914164
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 28 (yeast) transcript_id : NM_025842.2

name	Nfkbil2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048406 GeneID:72749 MGI:1919999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2 transcript_id : NM_183091.2

name	Cyhr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130778 GeneID:54151 MGI:1859320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine and histidine rich 1 transcript_id : NM_019396.2

name	Cyhr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30725866 GeneID:54151 MGI:1859320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine and histidine rich 1 transcript_id : NM_180962.1

name	Kifc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168296 GeneID:16581 MGI:109187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member C2 transcript_id : NM_010630.2

name	Foxh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382506 GeneID:14106 MGI:1347465
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box H1 transcript_id : NM_007989.2

name	Ppp1r16a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67514552 GeneID:73062 MGI:1920312
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 16A transcript_id : NM_033371.2

name	Gpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33413403 GeneID:76282 MGI:95802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamic pyruvic transaminase 1, soluble transcript_id : NM_182805.1

name	Mfsd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387831 GeneID:69572 MGI:1916822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major facilitator superfamily domain containing 3 transcript_id : NM_027122.3

name	Recql4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815827 GeneID:79456 MGI:1931028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RecQ protein-like 4 transcript_id : NM_058214.2

name	Lrrc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130136 GeneID:223664 MGI:2445060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 14 transcript_id : NM_145471.2

name	Lrrc24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375956 GeneID:378937 MGI:3605040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 24 transcript_id : NM_198119.2

name	C030006K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21735488 GeneID:223665 MGI:1925941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030006K11 gene transcript_id : NM_145472.1

name	C030006K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802964 GeneID:223665 MGI:1925941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030006K11 gene transcript_id : NM_176828.3

name	D15Wsu169e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38259213 GeneID:223666 MGI:107858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 15, Wayne State University 169, expressed transcript_id : NM_198420.1

name	Zfp251 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131107 GeneID:71591 MGI:1918841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 251 transcript_id : NM_001007568.2

name	Zfp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095020 GeneID:223669 MGI:99208
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 7 transcript_id : NM_145916.1

name	Commd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802424 GeneID:66398 MGI:1913648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COMM domain containing 5 transcript_id : NM_025536.2

name	Rpl8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755357 GeneID:26961 MGI:1350927
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L8 transcript_id : NM_012053.1

name	Zfp647 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801961 GeneID:239546 MGI:3052806
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 647 transcript_id : NM_172817.2

name	1110038F14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982592 GeneID:117171 MGI:2152337
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110038F14 gene transcript_id : NM_054099.2

name	Mb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21359819 GeneID:17189 MGI:96922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myoglobin transcript_id : NM_013593.2

name	Apol6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266677 GeneID:71939 MGI:1919189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 2 Proteins product : apolipoprotein L, 6 transcript_id : XM_001481299.1

name	Rbm9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379910 GeneID:93686 MGI:1933973
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 9 transcript_id : NM_053104.4

name	Rbm9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129875 GeneID:93686 MGI:1933973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 9 transcript_id : NM_175387.2

name	LOC100042318 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266721 GeneID:100042318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to thymosin, beta 10 transcript_id : XM_001478851.1

name	Apol3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037428 GeneID:75761 MGI:1923011
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein L 3 transcript_id : NM_029419.1

name	BC020489 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266725 GeneID:223672 MGI:3606001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 16 Proteins product : cDNA sequence BC020489, transcript variant 1 transcript_id : XM_128064.8

name	BC085284 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701567 GeneID:278679 MGI:3583950
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC085284 transcript_id : NM_001024848.1

name	LOC624454 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266726 GeneID:624454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs product : hypothetical LOC624454 transcript_id : XM_001478894.1

name	9030421J09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802549 GeneID:245282 MGI:3036238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030421J09 gene transcript_id : NM_177744.2

name	EG626615 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398759 GeneID:626615 MGI:3649094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : predicted gene, EG626615 transcript_id : XM_891223.2

name	2210421G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347723 GeneID:108956 MGI:1920912
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210421G13 gene transcript_id : NM_175391.3

name	9130218O11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362704 GeneID:328561 MGI:3043522
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130218O11 gene transcript_id : NM_177820.3

name	LOC666661 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266679 GeneID:666661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 54 ESTs, 16 Proteins product : apolipoprotein L, 3-like transcript_id : XM_001476404.1

name	EG545115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398766 GeneID:545115 MGI:3646982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG545115 transcript_id : XM_619334.3

name	LOC666348 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94398732 GeneID:666348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 17 ESTs, 16 Proteins product : hypothetical LOC666348, transcript variant 3 transcript_id : XM_992460.1

name	2310016F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803109 GeneID:71898 MGI:1919148
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310016F22 gene transcript_id : NM_173743.3

name	Apol2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266685 GeneID:239552 MGI:2444921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 19 Proteins product : apolipoprotein L, 2 transcript_id : XM_139463.7

name	Myh9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326445 GeneID:17886 MGI:107717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 9, non-muscle transcript_id : NM_022410.2

name	Txn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370902 GeneID:56551 MGI:1929468
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin 2 transcript_id : NM_019913.4

name	Foxred2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972420 GeneID:239554 MGI:106315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FAD-dependent oxidoreductase domain containing 2 transcript_id : NM_001017983.1

name	Eif3s7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628628 GeneID:55944 MGI:1933181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 7 (zeta) transcript_id : NM_018749.2

name	Cacng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680825 GeneID:12300 MGI:1316660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, gamma subunit 2 transcript_id : NM_007583.1

name	Rabl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754106 GeneID:67042 MGI:1914292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB, member of RAS oncogene family-like 4 transcript_id : NM_025931.2

name	Pvalb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130845 GeneID:19293 MGI:97821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : parvalbumin transcript_id : NM_013645.3

name	Ncf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679021 GeneID:17972 MGI:109186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neutrophil cytosolic factor 4 transcript_id : NM_008677.1

name	Csf2rb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131167 GeneID:12984 MGI:1339760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) transcript_id : NM_007781.2

name	Csf2rb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375090 GeneID:12983 MGI:1339759
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 2 receptor, beta 1, low-affinity (granulocyte-macrophage) transcript_id : NM_007780.3

name	Cyc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385006 CCDS:CCDS27567.1 GeneID:66445 MGI:1913695
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : cytochrome c-1 protein_id : NP_079843.1

name	Sharpin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076871 GeneID:106025 MGI:1913331
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : protein kinase C-interacting protein RBCC like 1 product : shank-interacting protein-like 1 protein_id : NP_079616.1

name	Maf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982640 CCDS:CCDS27568.1 GeneID:68877 MGI:1916127
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : repressor of RNA polymerase III transcription MAF1 protein_id : NP_081135.2

name	EG626280 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266672 GeneID:626280 MGI:3647392
definition	codon_start : 1 product : similar to KIAA1875 protein protein_id : XP_895966.3

name	Brp16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946998 CCDS:CCDS27569.1 GeneID:59053 MGI:1930628
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : brain protein 16 protein_id : NP_067530.1

name	Tssk5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676382 GeneID:73542 MGI:1920792
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : testis-specific serine kinase 5 protein_id : NP_898922.2

name	Bop1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304931 CCDS:CCDS27570.1 GeneID:12181 MGI:1334460
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0043021 - ribonucleoprotein binding [Evidence IDA] GO_process : GO:0042273 - ribosomal large subunit biogenesis [Evidence IMP]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IMP] codon_start : 1 product : block of proliferation 1 protein_id : NP_038509.1

name	Scx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38566694 CCDS:CCDS27571.1 GeneID:20289 MGI:102934
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : scleraxis protein_id : NP_942588.1

name	Hsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859480 CCDS:CCDS27572.1 GeneID:15499 MGI:96238
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0045120 - pronucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IGI]; GO:0006457 - protein folding [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : heat shock transcription factor 1 product : heat shock factor 1 protein_id : NP_032322.1

name	Dgat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753632 CCDS:CCDS27573.1 GeneID:13350 MGI:1333825
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0003846 - 2-acylglycerol O-acyltransferase activity [Evidence IDA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004144 - diacylglycerol O-acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : diacylglycerol acyltransferase; diacylglycerol acyltransferase 1 product : diacylglycerol O-acyltransferase 1 protein_id : NP_034176.1

name	Scrt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700038 GeneID:170729 MGI:2176606
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcriptional repressor scratch product : scratch homolog 1, zinc finger protein protein_id : NP_570963.1

name	EG666504 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398750 GeneID:666504 MGI:3647471
definition	codon_start : 1 product : similar to hCG2036558 protein_id : XP_989384.1

name	Fbxl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305045 GeneID:30840 MGI:1354705
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box protein containing leucine repeats 6 product : F-box and leucine-rich repeat protein 6 protein_id : NP_038937.1

name	Gpr172b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313230 CCDS:CCDS27575.1 GeneID:52710 MGI:1289288
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 172B protein_id : NP_083919.1

name	Adck5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370472 CCDS:CCDS27576.1 GeneID:268822 MGI:2679274
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : aarF domain containing kinase 5 protein_id : NP_766548.1

name	Cpsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16751835 CCDS:CCDS27577.1 GeneID:94230 MGI:2679722
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : CPSF160; cleavage and polyadenylation specificity factor 1 product : cleavage and polyadenylation specific factor 1 protein_id : NP_444423.1

name	Slc39a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312508 CCDS:CCDS27578.1 GeneID:72027 MGI:1919277
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005768 - endosome [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence IDA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence IDA]; GO:0006829 - zinc ion transport [Evidence IDA] codon_start : 1 product : solute carrier family 39, member 4 protein_id : NP_082340.1

name	Vps28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385320 CCDS:CCDS27579.1 GeneID:66914 MGI:1914164
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005768 - endosome [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 28 protein_id : NP_080118.1

name	Nfkbil2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048407 CCDS:CCDS27580.1 GeneID:72749 MGI:1919999
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : I-kappa-B-related protein protein_id : NP_898914.2

name	Cyhr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506491 CCDS:CCDS27581.1 GeneID:54151 MGI:1859320
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; cysteine and histidine-rich cytoplasmic protein product : cysteine and histidine rich 1 isoform 1 protein_id : NP_062269.1

name	Cyhr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725867 CCDS:CCDS27582.1 GeneID:54151 MGI:1859320
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; cysteine and histidine-rich cytoplasmic protein product : cysteine and histidine rich 1 isoform 2 protein_id : NP_851293.1

name	Kifc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168297 CCDS:CCDS27583.1 GeneID:16581 MGI:109187
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 product : kinesin family member C2 protein_id : NP_034760.2

name	Foxh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679845 CCDS:CCDS27584.1 GeneID:14106 MGI:1347465
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0048318 - axial mesoderm development [Evidence IMP]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0035054 - embryonic heart tube anterior/posterior pattern formation [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : forkhead/winged-helix domain transcription factor note : forkhead activin signal transducer 2 product : forkhead box H1 protein_id : NP_032015.1

name	Ppp1r16a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930481 CCDS:CCDS27585.1 GeneID:73062 MGI:1920312
definition	GO_component : GO:0005829 - cytosol [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : myosin phosphatase, target subunit 3; mFLJ00392 protein product : protein phosphatase 1, regulatory (inhibitor) subunit 16A protein_id : NP_203535.1

name	Gpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33413404 CCDS:CCDS27586.1 GeneID:76282 MGI:95802
definition	GO_function : GO:0004021 - alanine transaminase activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : glutamic pyruvic transaminase 1, soluble protein_id : NP_877957.1

name	Mfsd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560112 CCDS:CCDS27587.1 GeneID:69572 MGI:1916822
definition	codon_start : 1 product : major facilitator superfamily domain containing 3 protein_id : NP_081398.2

name	Recql4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815828 CCDS:CCDS27588.1 GeneID:79456 MGI:1931028
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA] codon_start : 1 note : RecQ helicase protein-like 4 product : RecQ protein-like 4 protein_id : NP_478121.2

name	Lrrc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703932 CCDS:CCDS27589.1 GeneID:223664 MGI:2445060
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 14 protein_id : NP_663446.1

name	Lrrc24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674275 CCDS:CCDS27590.1 GeneID:378937 MGI:3605040
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 24 protein_id : NP_932787.1

name	C030006K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735489 CCDS:CCDS27591.1 GeneID:223665 MGI:1925941
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC223665 protein_id : NP_663447.1

name	C030006K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849877 CCDS:CCDS27591.1 GeneID:223665 MGI:1925941
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC223665 protein_id : NP_789798.1

name	D15Wsu169e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259214 CCDS:CCDS27592.1 GeneID:223666 MGI:107858
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein 9530053N22 protein_id : NP_940812.1

name	Zfp251 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090226 CCDS:CCDS27593.1 GeneID:71591 MGI:1918841
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 251 protein_id : NP_001007569.1

name	Zfp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095021 GeneID:223669 MGI:99208
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger protein 86, related sequence 1 product : zinc finger protein 7 protein_id : NP_666021.1

name	Commd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313478 CCDS:CCDS27594.1 GeneID:66398 MGI:1913648
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : hypertension-related, calcium regulated product : COMM domain containing 5 protein_id : NP_079812.1

name	Rpl8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755358 CCDS:CCDS27595.1 GeneID:26961 MGI:1350927
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0019843 - rRNA binding [Evidence IEA] codon_start : 1 product : ribosomal protein L8 protein_id : NP_036183.1

name	Zfp647 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370220 CCDS:CCDS27596.1 GeneID:239546 MGI:3052806
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : KRAB zinc-finger protein product : zinc finger protein 647 protein_id : NP_766405.1

name	1110038F14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905135 GeneID:117171 MGI:2152337
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC117171 protein_id : NP_473440.1

name	Mb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21359820 CCDS:CCDS27597.1 GeneID:17189 MGI:96922
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0043353 - enucleate erythrocyte differentiation [Evidence IMP]; GO:0015671 - oxygen transport [Evidence IEA]; GO:0001666 - response to hypoxia [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : myoglobin protein_id : NP_038621.2

name	Apol6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266678 GeneID:71939 MGI:1919189
definition	codon_start : 1 exception : unclassified translation discrepancy product : apolipoprotein L, 6 protein_id : XP_001481349.1

name	Rbm9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30524922 CCDS:CCDS27598.1 GeneID:93686 MGI:1933973
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] [Evidence ISS]; GO:0003714 - transcription corepressor activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0016070 - RNA metabolism [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; fox-1 homolog; hexaribonucleotide binding protein 2; Fyn-binding molecule 2 product : RNA binding motif protein 9 isoform 2 protein_id : NP_780596.1

name	Rbm9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30524926 GeneID:93686 MGI:1933973
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] [Evidence ISS]; GO:0003714 - transcription corepressor activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0016070 - RNA metabolism [Evidence ISS] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; fox-1 homolog; hexaribonucleotide binding protein 2; Fyn-binding molecule 2 product : RNA binding motif protein 9 isoform 1 protein_id : NP_444334.2

name	LOC100042318 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266722 GeneID:100042318
definition	codon_start : 1 product : similar to thymosin, beta 10 protein_id : XP_001478901.1

name	Apol3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037429 GeneID:75761 MGI:1923011
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : apolipoprotein L 3 protein_id : NP_083695.1

name	BC020489 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20902713 GeneID:223672 MGI:3606001
definition	codon_start : 1 product : hypothetical protein LOC223672 isoform 1 protein_id : XP_128064.1

name	BC085284 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701568 CCDS:CCDS27600.1 GeneID:278679 MGI:3583950
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC278679 protein_id : NP_001020019.1

name	LOC624454 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266727 GeneID:624454
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478944.1

name	9030421J09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46810299 CCDS:CCDS27601.1 GeneID:245282 MGI:3036238
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245282 protein_id : NP_808412.1

name	EG626615 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957574 GeneID:626615 MGI:3649094
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896316.1

name	2210421G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425100 GeneID:108956 MGI:1920912
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC108956 protein_id : NP_780600.1

name	9130218O11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244374 GeneID:328561 MGI:3043522
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC328561 protein_id : NP_808488.1

name	LOC666661 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266680 GeneID:666661
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476454.1

name	EG545115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398767 GeneID:545115 MGI:3646982
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619334.3

name	LOC666348 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94398733 GeneID:666348
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_997554.1

name	2310016F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424585 CCDS:CCDS27604.1 GeneID:71898 MGI:1919148
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 note : Apolipoprotein L product : hypothetical protein LOC71898 protein_id : NP_776104.1

name	Apol2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266686 GeneID:239552 MGI:2444921
definition	codon_start : 1 product : apolipoprotein L, 2 protein_id : XP_139463.5

name	Myh9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326446 CCDS:CCDS27605.1 GeneID:17886 MGI:107717
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0000904 - cellular morphogenesis during differentiation [Evidence IMP]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; myosin heavy chain IX product : myosin, heavy polypeptide 9, non-muscle isoform 1 protein_id : NP_071855.2

name	Txn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9903609 CCDS:CCDS27606.1 GeneID:56551 MGI:1929468
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : thioredoxin nuclear gene encoding mitochondrial protein; thioredoxin, mitochondrial product : thioredoxin 2 protein_id : NP_064297.1

name	Foxred2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972421 CCDS:CCDS27607.1 GeneID:239554 MGI:106315
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : FAD-dependent oxidoreductase domain containing 2 protein_id : NP_001017983.1

name	Eif3s7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628629 GeneID:55944 MGI:1933181
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : translation initiation factor eIF3 p66; mouse translation initiation factor eIF3 p66 product : eukaryotic translation initiation factor 3, subunit 7 (zeta) protein_id : NP_061219.2

name	Cacng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680826 CCDS:CCDS27608.1 GeneID:12300 MGI:1316660
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0019226 - transmission of nerve impulse [Evidence IGI]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : voltage-dependent calcium channel gamma-2 subunit protein_id : NP_031609.1

name	Rabl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313158 GeneID:67042 MGI:1914292
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAB, member of RAS oncogene family-like 4 protein_id : NP_080207.1

name	Pvalb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980767 CCDS:CCDS27609.1 GeneID:19293 MGI:97821
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : parvalbumin protein_id : NP_038673.2

name	Ncf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679022 CCDS:CCDS27610.1 GeneID:17972 MGI:109186
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 exception : mismatches in translation product : neutrophil cytosolic factor 4 protein_id : NP_032703.1

name	Csf2rb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681049 CCDS:CCDS27611.1 GeneID:12984 MGI:1339760
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IEA] codon_start : 1 product : colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) protein_id : NP_031807.1

name	Csf2rb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677418 CCDS:CCDS27612.1 GeneID:12983 MGI:1339759
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : common beta chain product : colony stimulating factor 2 receptor, beta 1, low-affinity (granulocyte-macrophage) protein_id : NP_031806.2

name	EG666639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666639
definition	number : 2 pseudo : _no_value

name	EG666639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666639
definition	number : 1 pseudo : _no_value

name	LOC666679 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666679
definition	number : 1 pseudo : _no_value

name	LOC666497 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266675 GeneID:666497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins product : similar to OTTHUMP00000017090 pseudo : _no_value transcript_id : XR_032628.1

name	A330102K04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149266730 GeneID:328563 MGI:3036248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 2 Proteins product : RIKEN cDNA A330102K04 gene transcript_id : XR_033988.1

clone name	MSMg01-375O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548N09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-275G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548N09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-438L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479B14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-537E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-280O01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-461J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447E14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-232E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399O12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423O21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464N23
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-151F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-128A12.b	B6Ng01-128A12.g
ACC	DH929989	DH929990
length	1,253	1,087
definition	DH929989\|Mus musculus domesticus DNA, BAC clone: B6Ng01-128A12, 5' end.	DH929990\|Mus musculus domesticus DNA, BAC clone: B6Ng01-128A12, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcatggccaccgtggtacaaagcaagttccaggtaaagaaaagctt aggtccaggcatagtacatgcctttaatccctgcactcaggagacaggca tgcagatctctgaggtcaaagtcagtccatagagagcaaattccaggata gcccttcttaggcagtgaaggaaatcaccataaacagaaagttggtgaag atataataaaacaaaggggccatgttccagccccagcaagcagcagctac tgccacgtacctctagctttggagtcaagaatagaagaggttactggtac aattgatgctggttagctggagctaagaaattaatggtgattaagaagag accagcatcactgaggtgaaatcttctgggaagtgttacctgagagtaca aagaagctgtgttctagagatagacatcatgctggcagccggacttggta atgtgtaagagtcacccaggtggactggttttgaagacatgaagaggtca cagagagcagctgaggcttggcactgtgagaggccaggagagaccattgg tgaaggtgcagcctcagtgtcagctgaaggcccaggactgaaggggtcat gaaaagaagttgaagcttggcaccataaacagagcctatgaaaggctatt ggtgaaagtgcagcccagttgtagcatcattttagagatgctagtactgt gggatgaacaatacgaacagcagcagaatctgtatcctaaaagctgtgca aacgaactatgattgccttgagaccctaagaggttatagagatgccagag tcatgggaaacctggcaaagaaagttgctaacagcccaagataaagagtt gtgttgtagtcaacaaaacagaaaggagttggacatcagacatagagata tagagtgtggagtttgcccagctggcttttggtcttgctttggtccagta ttcccttaccatgatgttgtagaatggtatgtatatactgtgatgtggga ggttggtgatcctgattttgatttgatttagttttgattttgatttagtc agtgatagtaagtgattgcatgaatcttcagaagaggactttgaccttgg actttaaacattgtgaggatgtggagcttggggactttgagattgacata tggcattgcattatgtatgcatcaagcctatggggccatcatggaatgga tgcaaggtttaaggtggctctctgaatcatggtgtgagagcctgggtcag ctg	gaattcctttctcacacctgcctgtttactcaagcttagttgaggtcttt aataaacaaggctttaaaaactatttctgtgcaaaagagcatttggaacc tgatactaggcaatacctgcagggcaaccagggcagtaagaagaggaagg gaggcaccaaggaagtatgtgttgtcaaggcaacagcctctccatcaacc atgctgggaaatgccagggtggagcaagctcagactcattccagccaagg tgtgggagaaaagaggtgtctattccaggtcctgtccaccattggctgag ggccacttccagaagagggcatgttagtttttttgatacatcagaaaggt acacagttggtaaacagaaccctggagatgaatgaggggaaaaaaattca attaaagaaataacgttggcttcctgttggagttggagtcactgtgaacc agagtggttctaggcaaggattcatgagcaagggatctatacaattgaat taatggcttcatggttgtctcacacgcctctgaggatagttaatgacccc attatggtccttcctctttccttaagtgctgacccatatgttatggagcc tggtgctggcttctctctaatggttttgtcctttattgctttcagaggct tttgtcatttgcctggagcccggggagaggatgagacagagtgtggcact ctactctcaaggctgccttgggacaatggttgtccctcagctgccaggca cagtctcatttcctatttctcccatcttcctctgagatttgcccctaggg tctggagtcaagagctgctgctcactgcttccttgcagagagaaaacaga acggatacaagttgagacttctcaaacatctgaacactgtcttcttggta acctcagcccttcctaccccctcagatgtgctggggaatttgggaaactc caaggactccctggttcccctcctgtacatagtctagcccaaactctcca tgtttctggtgtatctccttcagaatctctttctctcctggtgattcgtt ctgttccagacttgtgtgagtctatgtttgcttgttt
quality values	Open. Hide. 61 30 38 30 61 38 28 61 61 61 53 38 23 61 61 61 55 61 61 61 55 55 43 55 55 13 16 20 11 9 18 19 15 22 23 39 59 59 61 61 61 61 61 61 61 61 59 61 61 55 55 44 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 59 44 44 37 59 52 61 61 61 61 61 61 55 55 59 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 53 61 61 61 53 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 39 61 61 61 61 61 50 50 47 47 61 61 61 61 61 53 61 52 61 47 61 47 61 61 61 35 61 53 61 47 61 61 61 61 61 42 61 61 61 61 47 61 45 61 61 53 47 61 61 61 61 47 42 61 61 52 53 53 61 61 61 61 61 53 36 47 27 42 47 40 52 57 47 47 57 57 57 57 50 57 57 53 53 53 53 47 57 57 57 57 57 53 57 57 39 47 53 53 57 57 53 53 53 53 57 36 47 36 24 47 43 53 53 53 47 53 43 53 57 50 53 57 47 53 45 57 57 57 53 53 57 31 53 45 53 47 43 37 50 52 45 57 57 36 37 52 50 50 33 47 57 34 36 45 47 53 53 38 41 39 52 42 50 52 40 52 43 57 45 53 36 53 33 29 20 52 45 50 45 43 41 45 52 50 57 42 47 57 53 33 25 53 52 34 38 34 53 52 43 53 33 43 52 39 47 37 52 50 38 52 34 24 41 29 50 40 38 57 34 24 31 34 34 31 38 53 44 34 38 37 39 44 40 50 38 34 52 31 40 20 53 35 40 37 34 37 44 53 29 27 33 30 48 33 37 53 40 24 40 33 46 36 42 25 37 29 52 12 43 10 41 32 33 37 25 40 34 33 34 40 34 53 23 24 57 14 36 44 24 30 53 34 32 47 57 37 19 53 31 29 39 23 32 53 31 20 45 45 30 31 33 37 30 29 30 22 47 30 29 36 31 31 31 24 29 35 41 34 38 47 30 27 47 25 25 30 30 27 33 19 29 29 29 33 23 26 37 25 39 28 30 45 47 29 29 21 19 43 45 24 16 29 30 15 34 33 29 41 34 22 28 35 28 22 15 29 17 11 23 23 25 29 24 27 20 25 21 26 15 30 22 29 39 16 41 29 31 20 18 39 32 26 17 41 29 15 28 31 29 29 33 20 24 51 51 28 26 41 18 23 8 33 29 24 31 41 24 29 28 25 34 28 20 22 22 13 7 19 19 51 32 26 27 30 25 29 18 21 34 31 23 41 21 31 21 14 27 12 30 31 21 34 31 9 15 9 36 8 14 28 20 18 36 23 20 22 14 23 9 8 21 10 6 31 12 32 6 11 32 9 12 14 5 7 23 33 24 31 33 28 28 22 36 11 25 7 6 21 38 22 24 22 30 31 6 8 14 23 30 35 9 12 24 15 38 39 12 18 23 15 39 31 15 7 4 3 9 8 6 10 26 31 24 15 33 13 9 6 4 9 14 16 14 20 23 11 26 4 4 10 17 10 6 5 4 7 8 29 5 5 6 4 4 7 12 15 34 19 3 6 3 11 9 20 25 8 5 8 23 13 22 9 21 9 18 12 29 22 4 3 4 19 11 8 11 18 5 4 7 3 4 4 3 4 6 9 11 30 11 5 3 6 14 21 6 12 9 4 4 8 27 5 4 8 5 24 4 8 10 15 7 12 24 8 14 11 20 12 13 8 11 16 4 6 18 7 4 13 5 3 13 6 20 7 4 5 3 3 13 13 18 6 18 3 3 3 1 3 6 4 10 14 4 9 7 2 5 10 2 3 3 4 3 5 8 4 11 13 4 7 3 2 12 3 2 6 4 11 3 2 11 7 2 3 6 7 4 2 4 1 3 3 6 6 4 2 4 7 16 27 16 4 6 15 4 4 5 3 6	Open. Hide. 61 61 49 49 61 16 18 11 12 12 12 18 7 10 28 20 59 59 59 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 52 52 39 28 30 28 28 28 36 52 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 40 61 61 61 57 57 57 53 47 53 47 47 35 47 57 57 53 57 57 57 53 57 57 53 53 57 57 52 53 57 57 53 53 57 57 57 57 53 57 57 57 57 50 57 53 53 52 57 53 53 57 53 53 53 53 57 57 45 57 57 57 57 53 52 52 53 53 57 53 57 53 52 52 57 53 43 12 47 43 39 53 53 45 50 45 53 43 46 47 37 57 57 57 43 52 57 53 52 46 57 37 57 53 52 52 53 46 45 53 50 57 50 50 57 37 39 40 33 42 53 53 36 52 53 40 23 57 57 36 41 50 53 53 39 34 37 42 57 46 41 25 52 57 37 53 46 36 57 36 52 57 40 37 53 53 48 39 53 42 52 37 34 52 32 57 46 23 38 34 34 53 37 48 53 40 57 40 30 32 53 44 29 37 57 47 47 37 13 53 13 53 21 44 57 57 43 40 29 40 30 40 57 32 30 32 36 44 39 33 32 25 47 45 32 24 44 45 31 51 18 31 9 17 30 22 29 43 18 36 32 31 21 44 23 30 31 18 25 26 34 28 39 43 34 35 34 36 41 41 35 35 23 32 23 30 21 29 29 24 36 32 16 24 30 26 12 15 23 24 28 33 21 11 31 35 31 33 31 20 24 29 26 19 29 29 26 21 33 24 14 36 27 29 24 15 14 13 28 29 33 29 31 51 27 30 31 29 38 29 51 30 27 12 21 43 28 29 28 28 32 21 28 31 28 21 9 21 34 21 35 27 46 23 28 28 51 51 29 27 28 18 14 24 17 23 9 29 33 34 19 33 27 31 13 11 34 12 27 33 30 34 28 28 29 33 26 11 18 28 28 17 22 17 13 31 29 10 28 16 28 8 29 7 33 16 9 5 10 11 18 9 10 20 13 4 5 7 7 6 6 5 10 34 23 20 28 19 31 9 29 22 27 33 19 14 9 11 44 16 9 12 5 5 10 18 30 32 19 29 13 16 14 8 23 26 14 20 8 30 19 35 15 30 10 25 14 15 21 29 31 19 35 19 13 18 21 23 31 18 20 21 33 27 8 12 13 12 9 11 5 13 8 13 20 17 26 34 37 17 12 14 18 29 7 13 22 7 15 33 22 7 11 5 9 5 8 17 19 21 22 29 29 42 29 4 11 8 8 9 18 36 32 9 11 7 26 17 24 5 5 9 12 17 15 6 4 8 10 27 9 18 26 19 3 27 20 13 27 9 5 5 19 4 3 6 6 26 24 15 15 8 6 3 3 3 4 5 8 12 8 18 7 10 10 4 7 5 23 11 7 6 13 6 13 9 5 3 7 7 7 11 12 10 17 4 4 3 1 4 7 2 3 3 3 3 5 9 11 3 7 5 3 11 5 5 9 6 5 16 5 4 5 3 4 11 4 6 15 10 8 24 13 3 1 4 5 5 11 22 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_77170278_77171381
seq2: B6Ng01-128A12.g_70_1156 (reverse)

seq1  AAACAA--AACAATAGACTCACACACAAGTCTGGAAAACAGACAGGAATA  48
      ||||||  ||  |||||||  |||||||||||||  |||||| | ||  |
seq2  AAACAAGCAAACATAGACT--CACACAAGTCTGG--AACAGA-ACGA--A  43

seq1  TCACCA-GAGAGAAAGAGATTCCTGAAGGAGATACACACAGAAACATGGA  97
      |||||| |||||||||||||| ||||||||||||||| ||||||||||||
seq2  TCACCAGGAGAGAAAGAGATT-CTGAAGGAGATACAC-CAGAAACATGGA  91

seq1  GAAGTTTGGGGCTTAGACTATGTACAGGAGGGGAACCAGGGGAGTCCCTG  147
      | ||||||||   ||||||||||||||||||||||||| |||||||| ||
seq2  G-AGTTTGGG--CTAGACTATGTACAGGAGGGGAACCA-GGGAGTCCTTG  137

seq1  GAGTTTCCCAAATCCCCCAGCACATCTGA-GGGGTAGGAAGGGCTTGAGG  196
      ||||||||||||| ||||||||||||||| |||||||||||||| |||||
seq2  GAGTTTCCCAAATTCCCCAGCACATCTGAGGGGGTAGGAAGGGC-TGAGG  186

seq1  TTACCAAGAAGACAGTTGTTTCAGATGTTTTGAGAAGTCTCAACTTGTTA  246
      ||||||||||||||||   |||||||| ||||||||||||||||||||  
seq2  TTACCAAGAAGACAGT--GTTCAGATG-TTTGAGAAGTCTCAACTTGT--  231

seq1  ATCCCTTCTGTTCTCCTCTCTGCAAGGAAGCAGTGAGCAGCAGCTCTTGA  296
      |||| ||||||| | |||||||||||||||||||||||||||||||||||
seq2  ATCCGTTCTGTT-TTCTCTCTGCAAGGAAGCAGTGAGCAGCAGCTCTTGA  280

seq1  CTCCAGACCCTAGGGGCAAATCTCAGAGGAAGATGGGAGAAATAGGAAAT  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAGACCCTAGGGGCAAATCTCAGAGGAAGATGGGAGAAATAGGAAAT  330

seq1  GAGACTGTGCCTGGCAGCTGAGGGACAACCATTGTCCCCAAGGCAGCCTT  396
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  GAGACTGTGCCTGGCAGCTGAGGGACAACCATTGT-CCCAAGGCAGCCTT  379

seq1  GAGAGTAGAGTGCCACACTCTGTCTCATCCTCTCCCCGGGCTCCAGGCAA  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGTAGAGTGCCACACTCTGTCTCATCCTCTCCCCGGGCTCCAGGCAA  429

seq1  ATGACAAAAGCCTCTGAAAGCAATAAAGGACAAAACCATTAGAGAGAAGC  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACAAAAGCCTCTGAAAGCAATAAAGGACAAAACCATTAGAGAGAAGC  479

seq1  CAGCACCAGGCTCCATAACATATGGGTCAGCACTTAAGGAAAGAGGAAGG  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCACCAGGCTCCATAACATATGGGTCAGCACTTAAGGAAAGAGGAAGG  529

seq1  ACCATAATGGGGTCATTAACTATCCTCAGAGGCGTGTGAGACAACCATGA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATAATGGGGTCATTAACTATCCTCAGAGGCGTGTGAGACAACCATGA  579

seq1  AGCCATTAATTCAATTGTATAGATCCCTTGCTCATGAATCCTTGCCTAGA  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCATTAATTCAATTGTATAGATCCCTTGCTCATGAATCCTTGCCTAGA  629

seq1  ACCACTCTGGTTCACAGTGACTCCAACTCCAACAGGAAGCCAACGTTATT  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACTCTGGTTCACAGTGACTCCAACTCCAACAGGAAGCCAACGTTATT  679

seq1  TCTTTAATTGAATTTTTTTCCCCTCATTCATCTCCAGGGTTCTGTTTACC  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTAATTGAATTTTTTTCCCCTCATTCATCTCCAGGGTTCTGTTTACC  729

seq1  AACTGTGTACCTTTCTGATGTATCAAAAAAACTAACATGCCCTCTTCTGG  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGTGTACCTTTCTGATGTATCAAAAAAACTAACATGCCCTCTTCTGG  779

seq1  AAGTGGCCCTCAGCCAATGGTGGACAGGACCTGGAATAGACACCTCTTTT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGGCCCTCAGCCAATGGTGGACAGGACCTGGAATAGACACCTCTTTT  829

seq1  CTCCCACACCTTGGCTGGAATGAGTCTGAGCTTGCTCCACCCTGGCATTT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCACACCTTGGCTGGAATGAGTCTGAGCTTGCTCCACCCTGGCATTT  879

seq1  CCCAGCATGGTTGATGGAGAGGCTGTTGCCTTGACAACACATACTTCCTT  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCATGGTTGATGGAGAGGCTGTTGCCTTGACAACACATACTTCCTT  929

seq1  GGTGCCTCCCTTCCTCTTCTTACTGCCCTGGTTGCCCTGCAGGTATTGCC  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCCTCCCTTCCTCTTCTTACTGCCCTGGTTGCCCTGCAGGTATTGCC  979

seq1  TAGTATCAGGTTCCAAATGCTCTTTTGCACAGAAATAGTTTTTAAAGCCT  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTATCAGGTTCCAAATGCTCTTTTGCACAGAAATAGTTTTTAAAGCCT  1029

seq1  TGTTTATTAAAGACCTCAACTAAGCTTGAGTAAACAGGCAGGTGTGAGAA  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTATTAAAGACCTCAACTAAGCTTGAGTAAACAGGCAGGTGTGAGAA  1079

seq1  AGGAATTC  1104
      ||||||||
seq2  AGGAATTC  1087

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information