MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-210N03
Chromosome	15 (Build37)
Map Location	79,556,252 - 79,557,302
singlet/doublet	singlet
Overlap gene	Unc84b
Upstream gene	Mfng, Card10, LOC641104, LOC100041601, Cdc42ep1, Lgals2, Gga1, Sh3bp1, Pdxp, Lgals1, Nol12, Triobp, H1f0, Gcat, Galr3, LOC100042603, Ankrd54, Eif3s6ip, 1700088E04Rik, Polr2f, Sox10, LOC100041655, Pick1, Slc16a8, Baiap2l2, Pla2g6, Maff, 4732495E13Rik, Csnk1e, LOC675798, LOC100041676, Kcnj4, Kdelr3, Ddx17, Dmc1, 4933432B09Rik, Pgea1, Tomm22, Josd1, Gtpbp1
Downstream gene	Dnalc4, Npcd, Nptxr, Cbx6, LOC100042748, Apobec3, Cbx7, Pdgfb, Rpl3, Syngr1, Map3k7ip1, Mgat3, EG666948, Smcr7l, Atf4, Rps19bp1, Cacna1i, Enthd1, Grap2, AW544981, Tnrc6b
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mfng (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17305 MGI:1095404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Card10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105844 MGI:2146012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC641104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041601 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Cdc42ep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104445 MGI:1929763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107753 MGI:895068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gga1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106039 MGI:2146207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20401 MGI:104603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdxp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57028 MGI:1919282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16852 MGI:96777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97961 MGI:2146285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Triobp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110253 MGI:1349410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	H1f0 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14958 MGI:95893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26912 MGI:1349389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14429 MGI:1329003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042603 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ankrd54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223690 MGI:2444209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s6ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223691 MGI:2386251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700088E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27660 MGI:1920774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr2f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69833 MGI:1349393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20665 MGI:98358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 116 ESTs, 29 Proteins

name	LOC100041655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pick1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18693 MGI:894645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc16a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57274 MGI:1929519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Baiap2l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207495 MGI:2652819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53357 MGI:1859152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maff (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17133 MGI:96910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732495E13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223693 MGI:2445179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csnk1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27373 MGI:1351660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675798 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Kcnj4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16520 MGI:104743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kdelr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105785 MGI:2145953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67040 MGI:1914290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Dmc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13404 MGI:105393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933432B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75729 MGI:1922979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Pgea1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73739 MGI:1920989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tomm22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223696 MGI:2450248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Josd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74158 MGI:1921408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtpbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14904 MGI:109443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc84b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223697 MGI:2443011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnalc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54152 MGI:1859217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npcd (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:504193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nptxr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73340 MGI:1920590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:494448 MGI:3512628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042748 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Apobec3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80287 MGI:1933111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52609 MGI:1196439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdgfb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18591 MGI:97528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27367 MGI:1351605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syngr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20972 MGI:1328323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Map3k7ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66513 MGI:1913763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgat3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17309 MGI:104532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666948 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666948 MGI:3644819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Smcr7l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239555 MGI:2146020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11911 MGI:88096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps19bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66538 MGI:1913788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna1i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239556 MGI:2178051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Enthd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383075 MGI:2686088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	Grap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17444 MGI:1333842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW544981 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213956 MGI:2146227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213988 MGI:2443730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mfng (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130740 GeneID:17305 MGI:1095404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : manic fringe homolog (Drosophila) transcript_id : NM_008595.2

name	Card10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538833 GeneID:105844 MGI:2146012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase recruitment domain family, member 10 transcript_id : NM_130859.2

name	LOC100041601 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266698 GeneID:100041601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100041601 transcript_id : XM_001476669.1

name	Cdc42ep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802537 GeneID:104445 MGI:1929763
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 effector protein (Rho GTPase binding) 1 transcript_id : NM_027219.2

name	Lgals2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372017 GeneID:107753 MGI:895068
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose-binding, soluble 2 transcript_id : NM_025622.2

name	Gga1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122346 GeneID:106039 MGI:2146207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi associated, gamma adaptin ear containing, ARF binding protein 1 transcript_id : NM_145929.1

name	Sh3bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838508 GeneID:20401 MGI:104603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain binding protein 1 transcript_id : NM_009164.2

name	Pdxp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838507 GeneID:57028 MGI:1919282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyridoxal (pyridoxine, vitamin B6) phosphatase transcript_id : NM_020271.3

name	Lgals1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838506 GeneID:16852 MGI:96777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose binding, soluble 1 transcript_id : NM_008495.2

name	Nol12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838504 GeneID:97961 MGI:2146285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 12 transcript_id : NM_133800.3

name	Triobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88501748 GeneID:110253 MGI:1349410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRIO and F-actin binding protein transcript_id : NM_001039156.1

name	Triobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88501742 GeneID:110253 MGI:1349410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRIO and F-actin binding protein transcript_id : NM_138579.4

name	Triobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88501746 GeneID:110253 MGI:1349410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRIO and F-actin binding protein transcript_id : NM_001039155.1

name	Triobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88501744 GeneID:110253 MGI:1349410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRIO and F-actin binding protein transcript_id : NM_001024716.1

name	H1f0 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838505 GeneID:14958 MGI:95893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H1 histone family, member 0 transcript_id : NM_008197.3

name	Gcat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348705 GeneID:26912 MGI:1349389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine C-acetyltransferase (2-amino-3-ketobutyrate-coenzyme A ligase) transcript_id : NM_013847.3

name	Galr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657113 GeneID:14429 MGI:1329003
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galanin receptor 3 transcript_id : NM_015738.1

name	LOC100042603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266739 GeneID:100042603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042603 transcript_id : XM_001479325.1

name	Ankrd54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450058 GeneID:223690 MGI:2444209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 54 transcript_id : NM_144849.1

name	Eif3s6ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51093839 GeneID:223691 MGI:2386251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 6 interacting protein transcript_id : NM_145139.2

name	1700088E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677332 GeneID:27660 MGI:1920774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700088E04 gene transcript_id : NM_138581.2

name	Polr2f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037180 GeneID:69833 MGI:1349393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide F transcript_id : NM_027231.1

name	Sox10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266700 GeneID:20665 MGI:98358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 116 ESTs, 29 Proteins product : SRY-box containing gene 10, transcript variant 1 transcript_id : XM_128139.6

name	LOC100041655 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266702 GeneID:100041655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041655 transcript_id : XM_001476760.1

name	Pick1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930723 GeneID:18693 MGI:894645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein interacting with C kinase 1 transcript_id : NM_008837.2

name	Pick1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930730 GeneID:18693 MGI:894645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein interacting with C kinase 1 transcript_id : NM_001045558.1

name	Slc16a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982695 GeneID:57274 MGI:1929519
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 8 transcript_id : NM_020516.2

name	Baiap2l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637819 GeneID:207495 MGI:2652819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BAI1-associated protein 2-like 2 transcript_id : NM_177580.3

name	Pla2g6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131199 GeneID:53357 MGI:1859152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group VI transcript_id : NM_016915.3

name	Maff (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130100 GeneID:17133 MGI:96910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian) transcript_id : NM_010755.3

name	4732495E13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61969667 GeneID:223693 MGI:2445179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732495E13 gene transcript_id : NM_172608.1

name	Csnk1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350602 GeneID:27373 MGI:1351660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 1, epsilon transcript_id : NM_013767.4

name	Kcnj4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358361 GeneID:16520 MGI:104743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 4 transcript_id : NM_008427.2

name	Kdelr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527315 GeneID:105785 MGI:2145953
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 transcript_id : NM_134090.1

name	Ddx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93587672 GeneID:67040 MGI:1914290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 transcript_id : NM_001040187.1

name	Ddx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93587676 GeneID:67040 MGI:1914290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 transcript_id : NM_199080.2

name	Ddx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93588009 GeneID:67040 MGI:1914290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 transcript_id : NM_152806.3

name	Ddx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40068490 GeneID:67040 MGI:1914290
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 transcript_id : NM_199079.1

name	Dmc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892178 GeneID:13404 MGI:105393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DMC1 dosage suppressor of mck1 homolog, meiosis-specific homologous recombination (yeast)disrupted meiotic cDNA 1 transcript_id : NM_010059.2

name	4933432B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266747 GeneID:75729 MGI:1922979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 4933432B09 gene transcript_id : XM_001479490.1

name	Pgea1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130505 GeneID:73739 MGI:1920989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PKD2 interactor, golgi and endoplasmic reticulum associated 1 transcript_id : NM_028634.3

name	Tomm22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383435 GeneID:223696 MGI:2450248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of outer mitochondrial membrane 22 homolog (yeast) transcript_id : NM_172609.3

name	Josd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362386 GeneID:74158 MGI:1921408
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Josephin domain containing 1 transcript_id : NM_028792.2

name	Gtpbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778896 GeneID:14904 MGI:109443
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 1 transcript_id : NM_013818.2

name	Unc84b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34996500 GeneID:223697 MGI:2443011
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-84 homolog B (C. elegans) transcript_id : NM_194342.1

name	Dnalc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567345 GeneID:54152 MGI:1859217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, axonemal, light chain 4 transcript_id : NM_017470.1

name	Npcd (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:113374167 GeneID:504193
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal pentraxin with chromo domain transcript_id : NM_001013360.2

name	Npcd (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:113374170 GeneID:504193
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal pentraxin with chromo domain transcript_id : NM_001013362.2

name	Nptxr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133930790 GeneID:73340 MGI:1920590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal pentraxin receptor transcript_id : NM_030689.4

name	Cbx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657983 GeneID:494448 MGI:3512628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 6 transcript_id : NM_028763.3

name	LOC100042748 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266750 GeneID:100042748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical protein LOC100042748 transcript_id : XM_001479562.1

name	Apobec3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861171 GeneID:80287 MGI:1933111
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein B editing complex 3 transcript_id : NM_030255.2

name	Cbx7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270984 GeneID:52609 MGI:1196439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 7 transcript_id : NM_144811.3

name	Pdgfb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118300 GeneID:18591 MGI:97528
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet derived growth factor, B polypeptide transcript_id : NM_011057.3

name	Rpl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305440 GeneID:27367 MGI:1351605
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L3 transcript_id : NM_013762.1

name	Syngr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877047 GeneID:20972 MGI:1328323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 1 transcript_id : NM_207708.1

name	Syngr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877044 GeneID:20972 MGI:1328323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 1 transcript_id : NM_009303.2

name	Map3k7ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328267 GeneID:66513 MGI:1913763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase kinase kinase 7 interacting protein 1 transcript_id : NM_025609.2

name	Mgat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108796646 GeneID:17309 MGI:104532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannoside acetylglucosaminyltransferase 3 transcript_id : NM_010795.3

name	Smcr7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347394 GeneID:239555 MGI:2146020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Smith-Magenis syndrome chromosome region, candidate 7-like (human) transcript_id : NM_178719.4

name	Atf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949820 GeneID:11911 MGI:88096
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 4 transcript_id : NM_009716.2

name	Rps19bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909364 GeneID:66538 MGI:1913788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S19 binding protein 1 transcript_id : NM_175109.3

name	Cacna1i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195695 GeneID:239556 MGI:2178051
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, alpha 1I subunit transcript_id : NM_001044308.1

name	Enthd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398792 GeneID:383075 MGI:2686088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : ENTH domain containing 1 transcript_id : XM_356844.5

name	Grap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130168 GeneID:17444 MGI:1333842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRB2-related adaptor protein 2 transcript_id : NM_010815.2

name	AW544981 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122434 GeneID:213956 MGI:2146227
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW544981 transcript_id : NM_145986.1

name	Tnrc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67782331 GeneID:213988 MGI:2443730
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 6b transcript_id : NM_144812.2

name	Mfng (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678872 CCDS:CCDS27622.1 GeneID:17305 MGI:1095404
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 product : O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase protein_id : NP_032621.1

name	Card10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18699996 CCDS:CCDS27623.1 GeneID:105844 MGI:2146012
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0030159 - receptor signaling complex scaffold activity [Evidence ISS] GO_process : GO:0007250 - activation of NF-kappaB-inducing kinase [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : caspase recruitment domain family, member 10 protein_id : NP_570929.1

name	LOC100041601 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266699 GeneID:100041601
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476719.1

name	Cdc42ep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312428 CCDS:CCDS27624.1 GeneID:104445 MGI:1929763
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008360 - regulation of cell shape [Evidence IEA]; GO:0007266 - Rho protein signal transduction [Evidence IDA] codon_start : 1 note : binder of Rho GTPase 5 product : CDC42 effector protein (Rho GTPase binding) 1 protein_id : NP_081495.1

name	Lgals2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385082 GeneID:107753 MGI:895068
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : lectin, galactose-binding, soluble 2 protein_id : NP_079898.1

name	Gga1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122347 CCDS:CCDS27625.1 GeneID:106039 MGI:2146207
definition	GO_component : GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : golgi associated, gamma adaptin ear containing, ARF binding protein 1 protein_id : NP_666041.1

name	Sh3bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85838509 CCDS:CCDS27626.1 GeneID:20401 MGI:104603
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : SH3-domain binding protein 1 protein_id : NP_033190.2

name	Pdxp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059486 CCDS:CCDS27627.1 GeneID:57028 MGI:1919282
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : PLP-phosophatase product : pyridoxal phosphate phosphatase protein_id : NP_064667.2

name	Lgals1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678682 CCDS:CCDS27628.1 GeneID:16852 MGI:96777
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005534 - galactose binding [Evidence NAS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007157 - heterophilic cell adhesion [Evidence NAS]; GO:0045445 - myoblast differentiation [Evidence IDA] codon_start : 1 note : beta-galactoside binding protein product : lectin, galactose binding, soluble 1 protein_id : NP_032521.1

name	Nol12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542287 CCDS:CCDS27629.1 GeneID:97961 MGI:2146285
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS] [Evidence IDA] GO_function : GO:0019843 - rRNA binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : 25 kDa nucleolar protein product : nucleolar protein 12 protein_id : NP_598561.2

name	Triobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88501749 GeneID:110253 MGI:1349410
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0045159 - myosin II binding [Evidence ISS] GO_process : GO:0030047 - actin modification [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; trio-associated repeat on actin product : TRIO and F-actin binding protein isoform 3 protein_id : NP_001034245.1

name	Triobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88501743 GeneID:110253 MGI:1349410
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0045159 - myosin II binding [Evidence ISS] GO_process : GO:0030047 - actin modification [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; trio-associated repeat on actin product : TRIO and F-actin binding protein isoform 5 protein_id : NP_613045.3

name	Triobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88501747 GeneID:110253 MGI:1349410
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0045159 - myosin II binding [Evidence ISS] GO_process : GO:0030047 - actin modification [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; trio-associated repeat on actin product : TRIO and F-actin binding protein isoform 4 protein_id : NP_001034244.1

name	Triobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88501745 GeneID:110253 MGI:1349410
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0045159 - myosin II binding [Evidence ISS] GO_process : GO:0030047 - actin modification [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; trio-associated repeat on actin product : TRIO and F-actin binding protein isoform 1 protein_id : NP_001019887.1

name	H1f0 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560697 GeneID:14958 MGI:95893
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : H1-0 histone product : H1 histone family, member 0 protein_id : NP_032223.2

name	Gcat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560488 CCDS:CCDS27630.1 GeneID:26912 MGI:1349389
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0008890 - glycine C-acetyltransferase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : aminoacetone synthase product : glycine C-acetyltransferase (2-amino-3-ketobutyrate-coenzyme A ligase) protein_id : NP_038875.2

name	Galr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657114 CCDS:CCDS27631.1 GeneID:14429 MGI:1329003
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004966 - galanin receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : galanin receptor 3 protein_id : NP_056553.1

name	LOC100042603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266740 GeneID:100042603
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479375.1

name	Ankrd54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450059 GeneID:223690 MGI:2444209
definition	codon_start : 1 note : Mus EST 475269; Mus EST 1068184 product : ankyrin repeat domain 54 protein_id : NP_659098.1

name	Eif3s6ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51093840 CCDS:CCDS27632.1 GeneID:223691 MGI:2386251
definition	GO_component : GO:0001650 - fibrillar center [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 note : polymerase-associated factor 67kda product : eukaryotic translation initiation factor 3 subunit 6 interacting protein protein_id : NP_660121.2

name	1700088E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070386 CCDS:CCDS27633.1 GeneID:27660 MGI:1920774
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Mus EST J0827E04 product : hypothetical protein LOC27660 protein_id : NP_613047.1

name	Polr2f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037181 CCDS:CCDS27634.1 GeneID:69833 MGI:1349393
definition	GO_component : GO:0030880 - RNA polymerase complex [Evidence IEA] GO_function : GO:0003899 - DNA-directed RNA polymerase activity [Evidence IDA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006351 - transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : RNA Pol II product : DNA directed RNA polymerase II polypeptide F protein_id : NP_081507.1

name	Sox10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266701 GeneID:20665 MGI:98358
definition	codon_start : 1 product : SRY-box containing gene 10 isoform 1 protein_id : XP_128139.5

name	LOC100041655 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266703 GeneID:100041655
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476810.1

name	Pick1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930731 GeneID:18693 MGI:894645
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0042734 - presynaptic membrane [Evidence ISS]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0016887 - ATPase activity [Evidence IDA] [Evidence ISS]; GO:0046875 - ephrin receptor binding [Evidence ISS]; GO:0051020 - GTPase binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0035256 - metabotropic glutatmate receptor binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA]; GO:0008022 - protein C-terminus binding [Evidence ISS]; GO:0005080 - protein kinase C binding [Evidence TAS] [Evidence ISS] [Evidence IPI]; GO:0030971 - receptor tyrosine kinase binding [Evidence ISS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence NAS]; GO:0015872 - dopamine transport [Evidence ISS]; GO:0015844 - monoamine transport [Evidence ISS]; GO:0045161 - neuronal ion channel clustering [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0051260 - protein homooligomerization [Evidence ISS] [Evidence TAS]; GO:0007205 - protein kinase C activation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence NAS]; GO:0006605 - protein targeting [Evidence IDA]; GO:0043113 - receptor clustering [Evidence IDA]; GO:0050803 - regulation of synapse structure and function [Evidence NAS]; GO:0006890 - retrograde vesicle-mediated transport, Golgi to ER [Evidence ISS] codon_start : 1 note : protein that interacts with C kinase 1; protein kinase C, alpha binding protein product : protein interacting with C kinase 1 protein_id : NP_001039023.1

name	Pick1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930724 CCDS:CCDS27635.1 GeneID:18693 MGI:894645
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0042734 - presynaptic membrane [Evidence ISS]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0016887 - ATPase activity [Evidence IDA] [Evidence ISS]; GO:0046875 - ephrin receptor binding [Evidence ISS]; GO:0051020 - GTPase binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0035256 - metabotropic glutatmate receptor binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA]; GO:0008022 - protein C-terminus binding [Evidence ISS]; GO:0005080 - protein kinase C binding [Evidence TAS] [Evidence ISS] [Evidence IPI]; GO:0030971 - receptor tyrosine kinase binding [Evidence ISS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence NAS]; GO:0015872 - dopamine transport [Evidence ISS]; GO:0015844 - monoamine transport [Evidence ISS]; GO:0045161 - neuronal ion channel clustering [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0051260 - protein homooligomerization [Evidence ISS] [Evidence TAS]; GO:0007205 - protein kinase C activation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence NAS]; GO:0006605 - protein targeting [Evidence IDA]; GO:0043113 - receptor clustering [Evidence IDA]; GO:0050803 - regulation of synapse structure and function [Evidence NAS]; GO:0006890 - retrograde vesicle-mediated transport, Golgi to ER [Evidence ISS] codon_start : 1 note : protein that interacts with C kinase 1; protein kinase C, alpha binding protein product : protein interacting with C kinase 1 protein_id : NP_032863.2

name	Slc16a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048452 CCDS:CCDS27636.1 GeneID:57274 MGI:1929519
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015355 - monocarboxylate porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015711 - organic anion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : monocarboxylate transporter 3; proton-coupled monocarboxylate transporter 3; preferentially expressed in RPE cells and choroid plexus epithelium product : solute carrier family 16, member 8 protein_id : NP_065262.1

name	Baiap2l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243932 GeneID:207495 MGI:2652819
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : BAI1-associated protein 2-like 2 protein_id : NP_808248.1

name	Pla2g6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393978 CCDS:CCDS27637.1 GeneID:53357 MGI:1859152
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA] codon_start : 1 note : 85 kDa calcium-independent phospholipase A2 product : phospholipase A2, group VI protein_id : NP_058611.1

name	Maff (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754608 CCDS:CCDS27638.1 GeneID:17133 MGI:96910
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IGI]; GO:0045604 - regulation of epidermal cell differentiation [Evidence IGI]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : avian musculoaponeurotic fibrosarcoma virus (v-maf) AS42 oncogene, protein F product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F protein_id : NP_034885.1

name	4732495E13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61969668 CCDS:CCDS27639.1 GeneID:223693 MGI:2445179
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC223693 protein_id : NP_766196.1

name	Csnk1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542425 CCDS:CCDS27640.1 GeneID:27373 MGI:1351660
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : KC1 epsilon; CKI, epsilon product : casein kinase 1 epsilon protein_id : NP_038795.3

name	Kcnj4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358362 CCDS:CCDS27641.1 GeneID:16520 MGI:104743
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005242 - inward rectifier potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Kir 2.3 product : potassium inwardly-rectifying channel J4 protein_id : NP_032453.2

name	Kdelr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527316 CCDS:CCDS27642.1 GeneID:105785 MGI:2145953
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046923 - ER retention sequence binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006621 - protein retention in ER [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 protein_id : NP_598851.1

name	Ddx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93587673 GeneID:67040 MGI:1914290
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : DEAD box polypeptide 17 isoform 4 protein_id : NP_001035277.1

name	Ddx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068493 CCDS:CCDS27643.1 GeneID:67040 MGI:1914290
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DEAD box polypeptide 17 isoform 1 protein_id : NP_951062.1

name	Ddx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068489 GeneID:67040 MGI:1914290
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : DEAD box polypeptide 17 isoform 3 protein_id : NP_690019.2

name	Ddx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068491 GeneID:67040 MGI:1914290
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DEAD box polypeptide 17 isoform 2 protein_id : NP_951061.1

name	Dmc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753650 CCDS:CCDS27644.1 GeneID:13404 MGI:105393
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006259 - DNA metabolism [Evidence IEA]; GO:0007126 - meiosis [Evidence IEA]; GO:0007131 - meiotic recombination [Evidence IEA]; GO:0001541 - ovarian follicle development [Evidence IMP] codon_start : 1 product : disrupted meiotic cDNA 1 homolog protein_id : NP_034189.1

name	4933432B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266748 GeneID:75729 MGI:1922979
definition	codon_start : 1 product : hypothetical protein LOC75729 protein_id : XP_001479540.1

name	Pgea1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312052 CCDS:CCDS27645.1 GeneID:73739 MGI:1920989
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : PKD2 interactor, golgi and endoplasmic reticulum associated 1 protein_id : NP_082910.1

name	Tomm22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982091 CCDS:CCDS27646.1 GeneID:223696 MGI:2450248
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : translocase of outer mitochondrial membrane 22 homolog protein_id : NP_766197.2

name	Josd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311941 CCDS:CCDS27647.1 GeneID:74158 MGI:1921408
definition	codon_start : 1 product : Josephin domain containing 1 protein_id : NP_083068.1

name	Gtpbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778897 CCDS:CCDS27648.1 GeneID:14904 MGI:109443
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : GTP binding protein 1 protein_id : NP_038846.2

name	Unc84b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996501 CCDS:CCDS27649.1 GeneID:223697 MGI:2443011
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : unc-84-like protein 2 product : unc-84 homolog B protein_id : NP_919323.1

name	Dnalc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567346 CCDS:CCDS27650.1 GeneID:54152 MGI:1859217
definition	GO_component : GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 exception : mismatches in translation note : outer arm dynein light chain 4; dynein, axon, light chain 4 product : dynein, axonemal, light chain 4 protein_id : NP_059498.1

name	Npcd (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:113374168 CCDS:CCDS27651.1 GeneID:504193
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : neuronal pentraxin with chromo domain isoform 1 protein_id : NP_001013378.2

name	Npcd (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:113374171 CCDS:CCDS27652.1 GeneID:504193
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : neuronal pentraxin with chromo domain isoform 2 protein_id : NP_001013380.2

name	Nptxr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:36054013 CCDS:CCDS27653.1 GeneID:73340 MGI:1920590
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : alternative start codon note : non-AUG (CUG) translation initiation codon product : neuronal pentraxin receptor protein_id : NP_109614.2 transl_except : (pos:complement(79635011..79635013),aa:Met)

name	Cbx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657984 GeneID:494448 MGI:3512628
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : chromobox homolog 6 protein_id : NP_083039.2

name	LOC100042748 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266751 GeneID:100042748
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479612.1

name	Apobec3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861172 CCDS:CCDS27654.1 GeneID:80287 MGI:1933111
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016814 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : apolipoprotein B editing complex 3 protein_id : NP_084531.2

name	Cbx7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450179 GeneID:52609 MGI:1196439
definition	GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : chromobox 7 protein_id : NP_659060.1

name	Pdgfb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538817 CCDS:CCDS27656.1 GeneID:18591 MGI:97528
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0030031 - cell projection biogenesis [Evidence IDA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0050730 - regulation of peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006929 - substrate-bound cell migration [Evidence IDA] codon_start : 1 product : platelet derived growth factor, B polypeptide protein_id : NP_035187.2

name	Rpl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305441 GeneID:27367 MGI:1351605
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : snoRNA MBII-10; snoRNA MBII-47; ribosomal protein L3 homolog product : ribosomal protein L3 protein_id : NP_038790.1

name	Syngr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877048 CCDS:CCDS27657.1 GeneID:20972 MGI:1328323
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence ISS] GO_process : GO:0006605 - protein targeting [Evidence ISS] codon_start : 1 note : isoform 1a is encoded by transcript variant 1a product : synaptogyrin 1 isoform 1a protein_id : NP_997591.1

name	Syngr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678193 CCDS:CCDS27658.1 GeneID:20972 MGI:1328323
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence ISS] GO_process : GO:0006605 - protein targeting [Evidence ISS] codon_start : 1 note : isoform 1b is encoded by transcript variant 1b product : synaptogyrin 1 isoform 1b protein_id : NP_033329.1

name	Map3k7ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328268 CCDS:CCDS27659.1 GeneID:66513 MGI:1913763
definition	codon_start : 1 note : Tak1-binding protein 1; beta activated kinase-1 binding protein-1 product : mitogen-activated protein kinase kinase kinase 7 interacting protein 1 protein_id : NP_079885.2

name	Mgat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33695150 CCDS:CCDS27660.1 GeneID:17309 MGI:104532
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003830 - beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006487 - protein amino acid N-linked glycosylation [Evidence IEA] codon_start : 1 note : mannoside acetyl glucosaminyl transferase 3; mannoside acetyl glucosaminyltransferase 3 product : mannoside acetylglucosaminyltransferase 3 protein_id : NP_034925.2

name	Smcr7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982319 CCDS:CCDS27661.1 GeneID:239555 MGI:2146020
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC239555 protein_id : NP_848834.2

name	Atf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949821 GeneID:11911 MGI:88096
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003704 - specific RNA polymerase II transcription factor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006094 - gluconeogenesis [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : activating transcription factor 4 protein_id : NP_033846.2

name	Rps19bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424711 CCDS:CCDS27662.1 GeneID:66538 MGI:1913788
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : S19 binding protein protein_id : NP_780318.1

name	Cacna1i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195696 GeneID:239556 MGI:2178051
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008332 - low voltage-gated calcium channel activity [Evidence ISS] GO_process : GO:0006816 - calcium ion transport [Evidence ISS]; GO:0042391 - regulation of membrane potential [Evidence ISS] codon_start : 1 exception : mismatches in translation note : low voltage-activated T-type calcium channel alpha-1 subunit (CACNA1I); low-voltage-activated calcium channel alpha13.3 product : calcium channel, voltage-dependent, alpha 1I subunit protein_id : NP_001037773.1

name	Enthd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398793 GeneID:383075 MGI:2686088
definition	codon_start : 1 product : similar to ENTH domain containing 1 protein_id : XP_356844.5

name	Grap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754722 CCDS:CCDS27663.1 GeneID:17444 MGI:1333842
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : Grb2-related adaptor downstream of Sch; monocytic adapter; monocytic adaptor product : GRB2-related adaptor protein 2 protein_id : NP_034945.1

name	AW544981 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122435 GeneID:213956 MGI:2146227
definition	codon_start : 1 product : hypothetical protein LOC213956 protein_id : NP_666098.1

name	LOC675798 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675798
definition	number : 1 pseudo : _no_value

name	LOC675798 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675798
definition	number : 2 pseudo : _no_value

name	LOC675798 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675798
definition	number : 3 pseudo : _no_value

name	LOC675798 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675798
definition	number : 4 pseudo : _no_value

name	LOC100041676 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041676
definition	number : 2 pseudo : _no_value

name	LOC100041676 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041676
definition	number : 1 pseudo : _no_value

name	LOC641104 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266736 GeneID:641104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 6 Proteins product : similar to transmembrane protein pseudo : _no_value transcript_id : XR_034105.1

name	EG666948 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149266705 GeneID:666948 MGI:3644819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG666948 pseudo : _no_value transcript_id : XR_001947.2

clone name	MSMg01-293A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119D17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-210N03.b	B6Ng01-210N03.g
ACC	GA029055	GA029056
length	1,060	814
definition	B6Ng01-210N03.b	B6Ng01-210N03.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcatccccagtcatggttagcattatcagtgcatagaatggtcata ggaagcttgtttgcttttttctcaagtgtctagcctgtatgctctgctta aagctatcgtgttataggactgaagacctggctcagttaagagcactggc tgctcttccatgtaatccaggttcaattcctggcattcacatggggcaac ttgtaattgtctgtcactctggttctaagggatccaaagccctcttctgg cctcttaggacaccagtacacagatgacacacagacatatataccagcaa aatacacatacacacaaaataaagttaaacaaaatgaattaaaatgaact gacctatattcctagctccagaatctgcctctaagaggactaggacatct gacacccatgtgccctccctgaggccctagctctctgcacattgatcatc ttgaacacccttcgcagtcacttccttgtcacaacccttccttaataaaa ctcacttcggcggagcccctgatcagaaagctctggatgctgccatctgt gtcactgacaggagagggtcatctccaccctataccctgaagtaaggcag ggtaggaagataggcccatccctgattcctctgccgggtagtgcaaatac tggatcctagaagatgtctactgttgactgggagtgtgaggcaccatccc acaagcacacagccctgtacctggaaatagaaggtctggatgggctcccc atcctggtcgtaggcaaacgtgccaagaagtgtcccttcctgctgcaggt cttcatcgaagccctacagaaaagcagacagggaggagtcagggaggacc acctccctcgtacatcatggtctctccctggctctcttttaaacctctca ctgccagagccaccttcagtgtgactctcagcaaagacccctacataggc ccactgaagatcatgtactcacaaaagatggcgaagttctttgggagcac tgggagattagtgctgtttgggtgacaggcctttgggcacgtgctcttag gtaaccggct	gaattcagttcccagcatccacagcaattagctcacagcaattaagccca ccaggcagaagtaaaagaccaccaactcggctagcccatggtggtgcagg cctttaatcccagtgagaggcagaggctggcagatctctgtgagttcaag gccaacttgatctacagagttgatttccagttcagccaaagcgacacaga gaaacactgtctcaaactaacaaaacaaaagaccagccattcaaatggcc aaattggagcaaaaaaaagaaaataaagaaaaagaaaaaaaaatttaaat tgtgaacagcagcacagagctggtccagcaaccgtctgccctagtgcaag ttttagaggtcgtccctagatggggaagatgagggttttatagcttagga gaccgggctttccgaacaggggctttggcagacaaagaagcagggttaca gaagcagaacaagttggtcatgaggagctcctgaaagaaaggcatggctg ccatttcttgaacaggaagtacagaaatgtgtagctgaggttctacacgg ggcatagcttaatccttgaaagaggttcatcataaacaggaatgaaccta gttcaaccttgctataagatggcactcaagcttaagatggaggcaggtta gttcatcaacaaccacctataaccaactccagttccaagggaactggtgc ccttttctgactctggacaccctatacacatgtgcaaataccatccccct cacatatacacataattgttgttgggttttttgtttttgtttgctttggt ttttactttttttt
quality values	Open. Hide. 58 26 34 25 58 23 14 54 58 62 62 41 38 62 54 47 43 47 62 62 62 49 54 62 62 62 54 62 62 54 47 15 14 16 22 22 18 28 23 18 28 28 21 34 36 44 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 50 51 59 50 48 46 46 28 32 43 34 42 28 48 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 56 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 47 62 62 54 54 47 62 62 43 58 58 58 58 54 58 58 52 58 58 58 58 54 54 58 58 58 58 58 54 58 58 54 58 58 58 38 49 52 54 52 58 58 54 58 53 58 58 58 46 58 52 54 54 54 46 58 52 52 58 54 58 58 58 58 46 48 58 52 58 54 54 58 58 54 58 58 58 58 50 53 52 51 58 46 51 58 58 51 53 54 51 58 58 47 53 49 58 47 58 40 58 58 32 51 27 58 40 54 58 42 51 50 58 33 49 54 36 35 51 58 43 44 46 37 53 53 52 51 51 34 58 32 52 49 44 37 53 49 30 29 28 38 50 51 50 51 39 51 50 50 50 42 50 51 50 50 51 32 40 30 58 52 54 43 43 54 40 42 39 31 46 49 19 38 27 51 52 54 58 41 39 53 58 58 40 49 39 51 44 36 29 53 32 52 34 49 54 32 43 39 24 42 32 47 31 31 54 47 35 40 53 49 32 53 30 42 42 39 30 32 47 47 38 40 44 15 16 54 23 38 17 41 32 52 40 32 37 25 35 29 45 37 42 34 32 45 40 40 51 54 29 42 42 30 21 30 40 34 26 54 47 52 53 18 34 42 18 47 24 32 22 46 28 16 11 32 27 13 12 17 12 13 47 40 33 17 46 21 13 27 33 28 52 33 31 49 36 33 29 30 21 34 36 32 31 26 27 35 51 34 16 30 18 25 13 12 16 19 25 18 27 24 31 31 31 45 31 51 51 35 27 45 33 28 42 42 33 12 32 32 29 31 38 33 33 28 21 32 8 31 30 24 25 31 11 15 11 21 17 23 31 21 23 19 11 31 31 32 22 25 11 14 31 42 33 22 36 25 46 46 39 11 18 16 18 29 13 6 6 15 20 23 19 17 26 23 10 17 16 21 23 24 20 7 33 23 20 35 33 31 6 7 7 37 31 21 18 15 8 24 21 24 10 14 26 14 15 9 28 6 31 33 31 36 18 23 8 29 16 33 26 18 27 11 18 11 10 6 9 25 7 11 20 29 37 37 21 41 11 31 39 17 8 14 11 6 28 4 18 10 18 19 36 11 29 31 15 10 22 23 10 10 26 19 31 9 6 20 30 8 19 17 19 20 8 7 8 30 15 19	Open. Hide. 62 38 56 44 62 47 38 62 62 62 62 24 30 15 18 22 18 29 28 19 24 28 23 28 18 50 51 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 62 54 54 62 62 62 59 59 62 62 59 56 51 62 56 48 46 50 48 56 48 45 54 36 43 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 56 46 32 48 59 51 62 59 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 50 56 46 43 48 59 59 59 59 62 59 59 59 62 59 59 62 59 59 62 62 59 59 59 56 62 62 59 62 62 62 59 59 62 62 56 59 59 56 62 62 59 59 59 62 59 62 62 62 59 62 62 59 62 59 59 56 62 59 59 59 56 62 62 62 62 56 62 56 62 56 56 62 62 56 56 51 62 56 51 62 56 56 56 44 56 51 62 62 62 62 62 62 62 56 56 47 62 62 62 56 56 47 53 56 56 62 62 56 62 62 62 62 47 41 38 56 62 54 62 43 62 62 62 43 47 50 56 42 56 56 62 56 62 62 62 56 62 43 56 62 56 56 39 52 52 52 52 52 62 62 62 62 52 62 32 41 31 62 52 62 62 38 43 52 52 52 48 49 52 54 62 62 52 52 62 58 53 52 58 54 52 54 54 58 52 41 33 44 54 54 52 58 54 41 42 54 54 58 54 58 34 58 45 39 46 39 37 33 21 19 33 47 53 50 42 42 16 42 31 58 52 54 54 54 32 50 27 44 34 41 42 30 25 31 46 39 45 54 54 41 54 47 37 58 50 50 42 48 53 39 50 27 42 30 24 15 40 38 42 46 41 35 46 46 47 29 25 15 44 34 51 50 46 52 30 27 42 38 32 39 21 42 38 39 54 50 26 39 40 37 50 19 40 37 33 26 30 48 32 31 28 53 23 34 39 53 23 25 14 18 18 28 58 41 38 39 37 43 27 50 32 49 50 40 39 11 50 50 50 29 29 32 25 39 38 35 19 49 31 41 32 50 30 27 7 50 32 32 41 16 15 49 10 47 41 40 25 9 35 50 49 40 7 12 28 20 19 14 31 51 24 21 10 15 15 11 31 26 24 11 9 13 19 15 26 40 21 18 32 31 24 17 10 10 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_79556252_79557302
seq2: B6Ng01-210N03.b_47_1106

seq1  GAATTCATCCCCAGTCATGGTTAGCATTATCAGTGCATAGAATGGTCATA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCCCCAGTCATGGTTAGCATTATCAGTGCATAGAATGGTCATA  50

seq1  GGAAGCTTGTTTGCTTTTTTCTCAAGTGTCTAGCCTGTATGCTCTGCTTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGCTTGTTTGCTTTTTTCTCAAGTGTCTAGCCTGTATGCTCTGCTTA  100

seq1  AAGCTATCGTGTTATAGGACTGAAGACCTGGCTCAGTTAAGAGCACTGGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTATCGTGTTATAGGACTGAAGACCTGGCTCAGTTAAGAGCACTGGC  150

seq1  TGCTCTTCCATGTAATCCAGGTTCAATTCCTGGCATTCACATGGGGCAAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCTTCCATGTAATCCAGGTTCAATTCCTGGCATTCACATGGGGCAAC  200

seq1  TTGTAATTGTCTGTCACTCTGGTTCTAAGGGATCCAAAGCCCTCTTCTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTAATTGTCTGTCACTCTGGTTCTAAGGGATCCAAAGCCCTCTTCTGG  250

seq1  CCTCTTAGGACACCAGTACACAGATGACACACAGACATATATACCAGCAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTTAGGACACCAGTACACAGATGACACACAGACATATATACCAGCAA  300

seq1  AATACACATACACACAAAATAAAGTTAAACAAAATGAATTAAAATGAACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATACACATACACACAAAATAAAGTTAAACAAAATGAATTAAAATGAACT  350

seq1  GACCTATATTCCTAGCTCCAGAATCTGCCTCTAAGAGGACTAGGACATCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTATATTCCTAGCTCCAGAATCTGCCTCTAAGAGGACTAGGACATCT  400

seq1  GACACCCATGTGCCCTCCCTGAGGCCCTAGCTCTCTGCACATTGATCATC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACCCATGTGCCCTCCCTGAGGCCCTAGCTCTCTGCACATTGATCATC  450

seq1  TTGAACACCCTTCGCAGTCACTTCCTTGTCACAACCCTTCCTTAATAAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAACACCCTTCGCAGTCACTTCCTTGTCACAACCCTTCCTTAATAAAA  500

seq1  CTCACTTCGGCGGAGCCCCTGATCAGAAAGCTCTGGATGCTGCCATCTGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACTTCGGCGGAGCCCCTGATCAGAAAGCTCTGGATGCTGCCATCTGT  550

seq1  GTCACTGACAGGAGAGGGTCATCTCCACCCTATACCCTGAAGTAAGGCAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCACTGACAGGAGAGGGTCATCTCCACCCTATACCCTGAAGTAAGGCAG  600

seq1  GGTAGGAAGATAGGCCCATCCCTGATTCCTCTGCCGGGTAGTGCAAATAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAGGAAGATAGGCCCATCCCTGATTCCTCTGCCGGGTAGTGCAAATAC  650

seq1  TGGATCCTAGAAGATGTCTACTGTTGACTGGGAGTGTGAGGCACCATCCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATCCTAGAAGATGTCTACTGTTGACTGGGAGTGTGAGGCACCATCCC  700

seq1  ACAAGCACACAGCCCTGTACCTGGAAATAGAAGGTCTGGATGGGCTCCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGCACACAGCCCTGTACCTGGAAATAGAAGGTCTGGATGGGCTCCCC  750

seq1  ATCCTGGTCGTAGGCAAACGTGCCAAGAAGTGTCCCTTCCTGCTGCAGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTGGTCGTAGGCAAACGTGCCAAGAAGTGTCCCTTCCTGCTGCAGGT  800

seq1  CTTCATCGAAGCCCTACAGAAAAGCAGACAGGGAGGAGTCAGGGAGGACC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCATCGAAGCCCTACAGAAAAGCAGACAGGGAGGAGTCAGGGAGGACC  850

seq1  ACCTCCCTCGTACATCATGGTCTCTCCCTGGCTCTCTTTTAAACCTCTCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCCCTCGTACATCATGGTCTCTCCCTGGCTCTCTTTTAAACCTCTCA  900

seq1  CTGCCAGAGCCACC-TCAGTGTGACTCTCAGCAAAGACCCC-ACATA-GC  947
      |||||||||||||| |||||||||||||||||||||||||| ||||| ||
seq2  CTGCCAGAGCCACCTTCAGTGTGACTCTCAGCAAAGACCCCTACATAGGC  950

seq1  CCACTGAAGATCAGGTACTCAC-AAAGATGGCGAAG-TCCTTGGGAGCAC  995
      ||||||||||||| |||||||| ||||||||||||| || ||||||||||
seq2  CCACTGAAGATCATGTACTCACAAAAGATGGCGAAGTTCTTTGGGAGCAC  1000

seq1  T-GGAGA-TAGTGCTG-TTGGGTGACAAGGCCTTGGGCACGTGCTCTAAG  1042
      | ||||| |||||||| |||||||||| | | ||||||||||||||| ||
seq2  TGGGAGATTAGTGCTGTTTGGGTGACAGGCCTTTGGGCACGTGCTCTTAG  1050

seq1  GTAA-CGGCT  1051
      |||| |||||
seq2  GTAACCGGCT  1060

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information