MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-224D02
Chromosome	15 (Build37)
Map Location	58,944,519 - 59,059,396
singlet/doublet	doublet
Overlap gene	EG268809
Upstream gene	Atad2, LOC665244, 2410187C16Rik, Fbxo32, 8230402K04Rik, Anxa13, LOC100040231, D15Ertd621e, EG631797, Tmem65, EG546638, Trmt12, Rnf139, Tatdn1, Ndufb9, Mtss1, LOC100040330
Downstream gene	LOC665565, Sqle, E430025E21Rik, Nsmce2, Trib1, LOC665602, EG632248, LOC665613, 4933412E24Rik, LOC100040266
Link	Open Mouse BAC browser

Click to get alignment info.

name	Atad2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70472 MGI:1917722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	2410187C16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76773 MGI:1924023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67731 MGI:1914981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	8230402K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268807 MGI:3045310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anxa13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69787 MGI:1917037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040231 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	D15Ertd621e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210998 MGI:1277178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG631797 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631797 MGI:3645398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins

name	Tmem65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74868 MGI:1922118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546638 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546638 MGI:3644823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Trmt12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68260 MGI:1915510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75841 MGI:1923091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tatdn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69694 MGI:1916944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66218 MGI:1913468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211401 MGI:2384818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040330 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG268809 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268809 MGI:3647181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 1535 ESTs, 14 Proteins

name	LOC665565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 2 Proteins

name	Sqle (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20775 MGI:109296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E430025E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223593 MGI:2146110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsmce2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68501 MGI:1915751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trib1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211770 MGI:2443397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665602 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG632248 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632248 MGI:3647452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 119 ESTs, 2 Proteins

name	LOC665613 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	4933412E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71088 MGI:1918338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100040266 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Atad2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91199556 GeneID:70472 MGI:1917722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase family, AAA domain containing 2 transcript_id : NM_027435.2

name	2410187C16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037458 GeneID:76773 MGI:1924023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410187C16 gene transcript_id : NM_029734.1

name	Fbxo32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385847 GeneID:67731 MGI:1914981
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 32 transcript_id : NM_026346.1

name	8230402K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364546 GeneID:268807 MGI:3045310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8230402K04 gene transcript_id : NM_177755.3

name	Anxa13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956195 GeneID:69787 MGI:1917037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A13 transcript_id : NM_027211.1

name	LOC100040231 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266605 GeneID:100040231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040231 transcript_id : XM_001474785.1

name	D15Ertd621e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112817621 GeneID:210998 MGI:1277178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 15, ERATO Doi 621, expressed transcript_id : NM_145959.2

name	EG631797 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398665 GeneID:631797 MGI:3645398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins product : predicted gene, EG631797 transcript_id : XM_977315.1

name	Tmem65 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360291 GeneID:74868 MGI:1922118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 65 transcript_id : NM_175212.4

name	EG546638 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266602 GeneID:546638 MGI:3644823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG546638 transcript_id : XM_621400.4

name	Trmt12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118150644 GeneID:68260 MGI:1915510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA methyltranferase 12 homolog (S. cerevisiae) transcript_id : NM_026642.2

name	Rnf139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377504 GeneID:75841 MGI:1923091
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 139 transcript_id : NM_175226.3

name	Tatdn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801775 GeneID:69694 MGI:1916944
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TatD DNase domain containing 1 transcript_id : NM_175151.3

name	Ndufb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349573 GeneID:66218 MGI:1913468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 transcript_id : NM_023172.3

name	Mtss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450158 GeneID:211401 MGI:2384818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metastasis suppressor 1 transcript_id : NM_144800.1

name	LOC100040330 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266611 GeneID:100040330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to Ubtf protein transcript_id : XM_001475007.1

name	EG268809 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398661 GeneID:268809 MGI:3647181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 608 ESTs, 9 Proteins product : predicted gene, EG268809, transcript variant 2 transcript_id : XM_897218.2

name	LOC665565 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266613 GeneID:665565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 2 Proteins product : similar to Ribosomal protein L17 transcript_id : XM_001475049.1

name	Sqle (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130480 GeneID:20775 MGI:109296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : squalene epoxidase transcript_id : NM_009270.3

name	E430025E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048299 GeneID:223593 MGI:2146110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E430025E21 gene transcript_id : NM_153548.2

name	Nsmce2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354824 GeneID:68501 MGI:1915751
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-SMC element 2 homolog (MMS21, S. cerevisiae) transcript_id : NM_026746.2

name	Trib1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374770 GeneID:211770 MGI:2443397
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tribbles homolog 1 (Drosophila) transcript_id : NM_144549.3

name	EG632248 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266617 GeneID:632248 MGI:3647452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 119 ESTs, 2 Proteins product : predicted gene, EG632248 transcript_id : XM_001475231.1

name	4933412E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398690 GeneID:71088 MGI:1918338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4933412E24 gene transcript_id : XM_978194.1

name	LOC100040266 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266607 GeneID:100040266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040266 transcript_id : XM_001474378.1

name	Atad2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91199557 GeneID:70472 MGI:1917722
definition	GO_function : GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ATPase family, AAA domain containing 2 protein_id : NP_081711.2

name	2410187C16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037459 CCDS:CCDS27490.1 GeneID:76773 MGI:1924023
definition	codon_start : 1 product : hypothetical protein LOC76773 protein_id : NP_084010.1

name	Fbxo32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385848 CCDS:CCDS27491.1 GeneID:67731 MGI:1914981
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : muscle atrophy F-box protein; atrogin 1 product : F-box only protein 32 protein_id : NP_080622.1

name	8230402K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244256 CCDS:CCDS27492.1 GeneID:268807 MGI:3045310
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC268807 protein_id : NP_808423.1

name	Anxa13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956196 GeneID:69787 MGI:1917037
definition	codon_start : 1 exception : unclassified translation discrepancy function : calcium-dependent, phospholipid-binding protein product : annexin A13 protein_id : NP_081487.1

name	LOC100040231 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266606 GeneID:100040231
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474835.1

name	D15Ertd621e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112817622 GeneID:210998 MGI:1277178
definition	codon_start : 1 note : skeletal muscle cells re-entry induced product : hypothetical protein LOC210998 protein_id : NP_666071.2

name	EG631797 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266601 GeneID:631797 MGI:3645398
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982409.2

name	Tmem65 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778812 CCDS:CCDS27493.1 GeneID:74868 MGI:1922118
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74868 protein_id : NP_780421.2

name	EG546638 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266603 GeneID:546638 MGI:3644823
definition	codon_start : 1 product : similar to ubiquitin-conjugating enzyme E2D 4 (putative) protein_id : XP_621400.4

name	Trmt12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118150645 GeneID:68260 MGI:1915510
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : tRNA methyltransferase 12 homolog protein_id : NP_080918.2

name	Rnf139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424858 CCDS:CCDS27494.1 GeneID:75841 MGI:1923091
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0031396 - regulation of protein ubiquitination [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ring finger protein 139 protein_id : NP_780435.1

name	Tatdn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424744 GeneID:69694 MGI:1916944
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : TatD DNase domain containing 1 protein_id : NP_780360.1

name	Ndufb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789148 CCDS:CCDS27495.1 GeneID:66218 MGI:1913468
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 protein_id : NP_075661.1

name	Mtss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450159 CCDS:CCDS27496.1 GeneID:211401 MGI:2384818
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030139 - endocytic vesicle [Evidence ISS]; GO:0001726 - ruffle [Evidence ISS] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0003785 - actin monomer binding [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0007015 - actin filament organization [Evidence IDA]; GO:0030041 - actin filament polymerization [Evidence IDA]; GO:0007155 - cell adhesion [Evidence ISS]; GO:0006928 - cell motility [Evidence ISS]; GO:0030035 - microspike biogenesis [Evidence ISS]; GO:0007517 - muscle development [Evidence NAS]; GO:0007399 - nervous system development [Evidence NAS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence ISS] codon_start : 1 exception : mismatches in translation product : actin monomer-binding protein protein_id : NP_659049.1

name	LOC100040330 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266612 GeneID:100040330
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475057.1

name	EG268809 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957238 GeneID:268809 MGI:3647181
definition	codon_start : 1 product : similar to 60S ribosomal protein L7 isoform 2 protein_id : XP_902311.1

name	LOC665565 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266614 GeneID:665565
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475099.1

name	Sqle (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678127 CCDS:CCDS27497.1 GeneID:20775 MGI:109296
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004506 - squalene monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : squalene monooxygenase product : squalene epoxidase protein_id : NP_033296.1

name	E430025E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048300 GeneID:223593 MGI:2146110
definition	codon_start : 1 product : hypothetical protein LOC223593 protein_id : NP_705776.2

name	Nsmce2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312038 CCDS:CCDS27498.1 GeneID:68501 MGI:1915751
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016567 - protein ubiquitination [Evidence IEA] codon_start : 1 exception : mismatches in translation product : non-SMC element 2 homolog (MMS21, S. cerevisiae) protein_id : NP_081022.1

name	Trib1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362355 CCDS:CCDS27499.1 GeneID:211770 MGI:2443397
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0043405 - regulation of MAPK activity [Evidence ISS] codon_start : 1 product : tribbles homolog 1 protein_id : NP_653132.1

name	EG632248 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266618 GeneID:632248 MGI:3647452
definition	codon_start : 1 product : similar to splicing factor, arginine/serine-rich 3 protein_id : XP_001475281.1

name	4933412E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398691 GeneID:71088 MGI:1918338
definition	codon_start : 1 product : hypothetical protein LOC71088 protein_id : XP_983288.1

name	LOC100040266 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266608 GeneID:100040266
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474428.1

name	LOC665602 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665602
definition	number : 2 pseudo : _no_value

name	LOC665602 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665602
definition	number : 1 pseudo : _no_value

name	LOC665613 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665613
definition	number : 1 pseudo : _no_value

name	LOC665244 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266604 GeneID:665244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to small nuclear ribonucleoprotein-like protein pseudo : _no_value transcript_id : XR_031842.1

clone name	MSMg01-211O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298J11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-298K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-467D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-192D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-064E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467O06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-172G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119D20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-224D02.b	B6Ng01-224D02.g
ACC	GA038723	GA038724
length	1,166	1,123
definition	B6Ng01-224D02.b	B6Ng01-224D02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(58,944,519 - 58,945,682)	(59,058,280 - 59,059,396)
sequence	gaattctccaaaatagatcacctaagtgtctcactctaaaaacttcgatc gtgtcttttcagtccggaagtccaaatcaaggttaaataatccttggggg ccacccccagctggtgctcgaagtttcccccagcaaggcacagctgatcc tgtcggcgtttcctcagttcagtgctatggggtatacatacaccagagaa gactgcttggacaagtggttaagctgtttagttaaggttttactgttgac caaggcaactcttaaaaaggacaactttagctggggcaggcttacagttt cagaggtttagtccattatcatcatgggggaaagcatggcagcatccagg caggcatggtgctgaaggagctgagagttctacatcttcacccaaaggaa gccaggagcagactgtttccaggcagctaagagaaaggtcccaaagccca cctccacagtgacatacttcctccaacaaggccacacccactccaacaag gccacacctcttaatagtgccactcccttgcactagcatattcaaacctc cagcagcctctgtaagcctgttggcaactacaccgggtgttcaggacccc aatgcagcactgaacctttctcagggtaagctcctaaacacaaaaccgta tcctggcttgacacacttcagttaacaagaacagttagccagaagctgag gttcaaaagctaaaacgcaaaatcagtaaatttagagactttcccagacc tctatggactttgatggattagtcccttattttagttttggcaagtgcat gctgaatgacacttttatcatggagtcaattgtgctaaggtctggggccc tgttgcattcaggagccacttgctgactaactgttgtttccatccacact cttgttggtttctccttccttgtcagccatgtttcttttctggatcatga gtgggaaacccagaacagagccattcccttgctcttcagccaccttcact gagtcaccagtcctctcatctgctaggcacatgtgtcatcaggagctctg gtgggggacagaagaacatggaaaatgagttagatatgggtcttcttcct tggaaagcatgaacatacctctccacggctgcctttggccagtatttcca gagcctgtgtcttagt	gaattcacctgctgaaatctccaatcctcaaggaagagaccacaggagat tgtgccgagagctggttccgtcacagaggcactgagagagacaccatcct aactgacacagtgagaagatattaattatgaaccacgaagcaggtcctcc ttagatactggactactggcatctggatcttcaacttcctggactccaga tggtgaacagaagtttctgccatgtctgactaagcttcttgatttccagc atggtgtcagagcagcactgctatactaagagggtgactctgagtccctg agagaagcctcacgctctaagcacttccacttaaccaccttctgataggg aactctgcttatctgctacatactctgtcctgcgactttggcttctcata gagtgctacaaggacactgtggaaccaaagagagaggtcaacccttgatt ctgcctgcttgtgctggtgtgtggtttttgtcctccgtggatccccttat tctgctctttttccaagtctaccccattctgcacctggacagatcaatga accccagagctccttctcgtgcttcctgttccattatttaagtctaggag ggaagttctgcagctactgggccaggatttgcaggtcacagctcatccag cgtccactcttctgaccatgaaaattcagaaagtgcagacacctttctca gggcagagattagggctgctccgagccccacactttcgtcagccctttgt ccttcatggtgattatcctgagctatacaatgtctaagactttcaggaga cagggaaacgcaagtcagacagctgaatacctctcagaaggagctaatca tgtccaagtccagctttaacaccacagggttaaactgaggcaggcagccc atagcccctctcagatgacatggggcaagccatttacagggttcagcact actgatgaaacaaaactttattatctggggctggcagatatccagtgaag aatctctggaactttgtttactcttaagtgtgcagcagaaaggaaaggac gagagaaggctaccaatcatgacatactacacaccacactgggtcagtcc tctacatctgtttcaccagtttc
quality values	Open. Hide. 58 26 34 35 58 58 58 58 31 15 54 62 62 52 47 62 39 39 41 56 62 62 62 62 62 62 62 54 62 62 62 32 32 32 31 32 21 24 27 28 32 34 31 34 32 50 41 59 62 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 49 56 54 48 51 59 59 59 56 59 59 59 62 62 62 62 62 62 49 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 50 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 54 62 62 62 62 62 62 62 62 62 47 54 62 62 54 62 62 62 52 62 62 62 62 62 62 62 52 62 62 62 62 48 62 62 62 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 52 58 58 58 58 54 54 58 58 52 52 58 58 54 58 58 58 58 58 58 58 54 47 58 58 58 58 58 58 43 54 58 58 58 52 58 41 54 54 54 58 54 54 54 54 58 58 58 58 49 58 58 49 58 54 58 58 58 51 58 53 58 58 58 58 58 43 58 50 54 51 51 51 58 45 39 58 58 58 32 58 58 58 51 58 50 58 51 49 49 50 58 58 50 51 54 58 58 53 58 52 52 40 58 58 37 39 58 54 58 58 51 58 39 52 58 54 54 52 58 39 58 58 58 51 58 54 53 52 51 47 58 51 58 48 50 58 40 51 50 51 50 49 50 50 58 58 53 42 53 58 53 46 49 50 41 58 53 58 52 50 50 50 44 49 50 50 54 49 32 42 58 36 39 53 50 50 36 13 54 38 53 40 32 54 54 51 38 51 53 32 54 54 52 49 35 50 41 54 54 49 45 53 52 42 45 35 54 37 32 54 47 41 52 51 42 49 35 39 54 49 45 46 32 27 33 53 31 35 53 52 42 52 37 35 47 41 31 52 54 51 53 41 32 54 44 33 19 45 42 34 53 42 36 33 41 47 31 18 54 46 19 33 32 51 47 51 31 46 52 26 39 41 40 32 53 36 32 30 52 53 45 34 33 31 32 45 35 27 42 40 48 53 53 40 37 40 35 31 32 44 32 37 19 30 31 25 33 31 42 43 31 31 29 36 32 21 9 20 20 31 30 23 46 41 24 12 40 46 37 33 46 26 28 31 32 33 31 30 22 30 31 46 19 46 31 34 25 33 38 32 31 31 29 33 28 26 22 37 31 29 36 22 21 46 28 48 35 22 29 26 31 38 31 21 31 22 22 30 32 21 15 39 29 35 32 29 12 33 22 27 26 33 16 17 17 23 29 23 29 20 21 35 35 27 35 33 25 18 33 33 41 28 26 31 47 48 31 38 21 31 32 32 32 24 31 33 37 38 21 11 13 41 11 36 48 25 22 48 34 25 22 48 21 21 31 18 31 8 21 24 27 37 38 10 47 9 27 12 30 25 20 18 6 19 20 32 12 26 16 21 11 24 7 10 32 24 19 15 19 29 10 22 25 10 6 26 15 10 15 28 10 23 34 31 19 21 32 32 23 29 32 31 28 11 23 20 12 7 13 24 11 10 14 11 11 13 3 8 6 15 9 32 19 24 27 20 7 14 7 15 18 28 40 38 19 20 27 6 9 17 28 5 15 6 6 10 20 12 18 6 47 47 28 21 18 28 12 27 20 24 7 22 19 6 6 9 27 4 3 3 12 9 18 9 10 9 13 8 6 16 15 6 21 17 5 14 11 12 8 17 7 18 9 8 6 17 5 15 10 8 11 20 6 7 8 4 11 7 6 7 5 22 17 7 6 9 2 2 7 5 1 6 4 8 10 3 6 7 7 11 4 3 4 16 2 2 1 5 8 4 4 8 4 2	Open. Hide. 62 47 35 47 62 47 33 54 62 62 62 27 27 21 18 20 23 26 26 32 32 20 22 32 56 62 62 62 62 62 62 62 62 59 62 62 62 62 59 44 59 62 62 62 62 62 59 59 59 43 62 62 62 62 62 62 56 59 49 35 34 56 56 56 54 48 54 49 37 54 62 62 62 62 59 62 59 59 62 62 62 59 62 59 59 59 59 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 54 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 47 54 62 62 62 62 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 54 48 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 32 62 62 62 62 62 52 62 62 54 47 54 58 58 58 58 58 58 54 58 58 58 58 52 58 54 54 54 58 54 58 52 58 58 58 58 45 54 58 58 58 52 49 58 54 58 58 58 58 54 58 58 20 23 10 9 19 24 58 54 50 58 42 58 58 49 54 52 52 54 54 52 58 58 52 54 58 54 58 54 54 42 52 52 58 35 58 58 58 54 52 41 47 40 51 51 50 50 50 58 46 39 45 45 45 58 49 51 49 35 47 58 37 18 58 58 45 53 50 50 58 50 46 50 49 54 27 51 58 53 52 51 33 49 52 42 46 58 50 43 46 52 49 50 53 58 58 53 53 53 53 41 33 42 51 54 58 51 58 39 33 54 42 39 31 50 58 31 34 53 52 39 39 34 46 32 39 53 52 58 51 51 53 42 35 37 25 41 33 38 50 21 58 14 32 58 24 39 39 58 58 36 50 37 40 50 39 46 23 51 15 50 51 51 41 40 42 38 40 51 54 52 47 33 28 42 35 19 25 54 22 11 54 11 32 40 44 51 29 29 40 32 29 51 44 25 47 16 7 28 33 35 20 35 33 37 42 24 53 40 31 33 32 45 41 30 23 51 37 39 31 53 37 9 53 21 10 51 18 20 40 19 31 30 18 33 20 29 33 54 10 6 46 41 34 31 45 26 45 34 42 31 29 14 38 26 29 26 32 52 31 24 12 42 15 9 36 33 33 34 26 11 9 28 25 23 7 26 21 31 20 21 51 30 31 15 25 43 34 32 27 29 31 28 43 32 34 18 29 31 33 45 33 25 13 18 25 31 45 31 31 22 15 46 41 8 11 43 48 23 26 31 36 37 17 37 25 25 22 42 21 37 24 22 36 12 18 6 14 18 22 30 24 16 16 16 8 18 34 11 42 31 24 31 23 18 31 33 37 31 13 18 9 10 20 7 11 27 12 48 11 7 16 7 8 37 39 10 11 21 18 14 21 14 22 34 24 27 24 30 31 11 15 38 44 8 10 33 47 44 11 13 18 37 10 21 5 18 10 19 17 9 26 48 48 35 22 30 23 17 18 30 14 17 6 12 34 11 32 32 32 7 9 13 19 8 30 30 26 7 7 7 11 8 7 28 32 22 7 36 6 6 13 31 8 33 23 32 27 21 32 17 22 15 10 6 6 9 4 5 6 11 26 15 12 13 12 7 5 14 3 3 3 4 5 3 3 4 10 10 16 15 20 7 12 12 7 5 5 3 3 3 5 4 6 5 5 9 21 5 5 14 9 7 17 8 5 5 5 3 6 5 3 6 14 9 20 33 16 11 15 13 6 7 9 5 12 6 6 6 19 9 16 21 5 10 8 26 23 7 5 11 12 3 2 3 15 15 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_58944519_58945682
seq2: B6Ng01-224D02.b_46_1211

seq1  GAATTCTCCAAAATAGATCACCTAAGTGTCTCACTCTAAAAACTTCGATC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCCAAAATAGATCACCTAAGTGTCTCACTCTAAAAACTTCGATC  50

seq1  GTGTCTTTTCAGTCCGGAAGTCCAAATCAAGGTTAAATAATCCTTGGGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCTTTTCAGTCCGGAAGTCCAAATCAAGGTTAAATAATCCTTGGGGG  100

seq1  CCACCCCCAGCTGGTGCTCGAAGTTTCCCCCAGCAAGGCACAGCTGATCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCCCCAGCTGGTGCTCGAAGTTTCCCCCAGCAAGGCACAGCTGATCC  150

seq1  TGTCGGCGTTTCCTCAGTTCAGTGCTATGGGGTATACATACACCAGAGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCGGCGTTTCCTCAGTTCAGTGCTATGGGGTATACATACACCAGAGAA  200

seq1  GACTGCTTGGACAAGTGGTTAAGCTGTTTAGTTAAGGTTTTACTGTTGAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGCTTGGACAAGTGGTTAAGCTGTTTAGTTAAGGTTTTACTGTTGAC  250

seq1  CAAGGCAACTCTTAAAAAGGACAACTTTAGCTGGGGCAGGCTTACAGTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGCAACTCTTAAAAAGGACAACTTTAGCTGGGGCAGGCTTACAGTTT  300

seq1  CAGAGGTTTAGTCCATTATCATCATGGGGGAAAGCATGGCAGCATCCAGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGGTTTAGTCCATTATCATCATGGGGGAAAGCATGGCAGCATCCAGG  350

seq1  CAGGCATGGTGCTGAAGGAGCTGAGAGTTCTACATCTTCACCCAAAGGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCATGGTGCTGAAGGAGCTGAGAGTTCTACATCTTCACCCAAAGGAA  400

seq1  GCCAGGAGCAGACTGTTTCCAGGCAGCTAAGAGAAAGGTCCCAAAGCCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGGAGCAGACTGTTTCCAGGCAGCTAAGAGAAAGGTCCCAAAGCCCA  450

seq1  CCTCCACAGTGACATACTTCCTCCAACAAGGCCACACCCACTCCAACAAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCACAGTGACATACTTCCTCCAACAAGGCCACACCCACTCCAACAAG  500

seq1  GCCACACCTCTTAATAGTGCCACTCCCTTGCACTAGCATATTCAAACCTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACACCTCTTAATAGTGCCACTCCCTTGCACTAGCATATTCAAACCTC  550

seq1  CAGCAGCCTCTGTAAGCCTGTTGGCAACTACACCGGGTGTTCAGGACCCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAGCCTCTGTAAGCCTGTTGGCAACTACACCGGGTGTTCAGGACCCC  600

seq1  AATGCAGCACTGAACCTTTCTCAGGGTAAGCTCCTAAACACAAAACCGTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCAGCACTGAACCTTTCTCAGGGTAAGCTCCTAAACACAAAACCGTA  650

seq1  TCCTGGCTTGACACACTTCAGTTAACAAGAACAGTTAGCCAGAAGCTGAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGCTTGACACACTTCAGTTAACAAGAACAGTTAGCCAGAAGCTGAG  700

seq1  GTTCAAAAGCTAAAACGCAAAATCAGTAAATTTAGAGACTTTCCCAGACC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCAAAAGCTAAAACGCAAAATCAGTAAATTTAGAGACTTTCCCAGACC  750

seq1  TCTATGGACTTTGATGGATTAGTCCCTTATTTTAGTTTTGGCAAGTGCAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATGGACTTTGATGGATTAGTCCCTTATTTTAGTTTTGGCAAGTGCAT  800

seq1  GCTGAATGACACTTTTATCATGGAGTCAATTGTGCTAAGGTCTGGGGCCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGAATGACACTTTTATCATGGAGTCAATTGTGCTAAGGTCTGGGGCCC  850

seq1  TGTTGCATTCAGGAGCCACTTGCTGACTAACTGTTGTTTCCATCCACACT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGCATTCAGGAGCCACTTGCTGACTAACTGTTGTTTCCATCCACACT  900

seq1  CTTGTTGGTTTCTCCTTCCTTGTCAGCCATGTTTCTTTTCTGGATCATGA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTTGGTTTCTCCTTCCTTGTCAGCCATGTTTCTTTTCTGGATCATGA  950

seq1  GT-GGAAACCCAGAACAGAGCCATT-CCTTGCTCTTCAGCCACCTTCACT  998
      || |||||||||||||||||||||| ||||||||||||||||||||||||
seq2  GTGGGAAACCCAGAACAGAGCCATTCCCTTGCTCTTCAGCCACCTTCACT  1000

seq1  GAGTCACCAGTCCTCTCATCTGCTAGGCACATGTGTCAATCAGGAGCTCT  1048
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  GAGTCACCAGTCCTCTCATCTGCTAGGCACATGTGTC-ATCAGGAGCTCT  1049

seq1  -GTGGGGACCAG-AGAACATGGAAAATGAGTTAGAATTATGGGCCTTC-T  1095
       ||||||  ||| ||||||||||||||||||||||  |||||| |||| |
seq2  GGTGGGGGACAGAAGAACATGGAAAATGAGTTAGA--TATGGGTCTTCTT  1097

seq1  CCTTGGGAAGCATGAACATACCTCTCCAC-GCTGCTTTTGGCCAGTATTT  1144
      |||||| |||||||||||||||||||||| ||||| ||||||||||||||
seq2  CCTTGGAAAGCATGAACATACCTCTCCACGGCTGCCTTTGGCCAGTATTT  1147

seq1  CCAGAGCTTGTTGTCTTAGT  1164
      ||||||| || |||||||||
seq2  CCAGAGCCTG-TGTCTTAGT  1166

seq1: chr15_59058280_59059396
seq2: B6Ng01-224D02.g_70_1192 (reverse)

seq1  GAAATTGGTGAAACAGATGGTAGA-GACTGA-CCAGTGTGTGTGTGT-GT  47
      |||| ||||||||||||| ||||| |||||| |||||||| |||||| ||
seq2  GAAACTGGTGAAACAGAT-GTAGAGGACTGACCCAGTGTG-GTGTGTAGT  48

seq1  GTGT-GTGTGTGTGTGGCCTTCTCTCTGTCCTTTTCTTTCTTGCTGGCCA  96
       |||  ||  || || |||||||||| ||||||| ||||| |||||  ||
seq2  ATGTCATGATTG-GTAGCCTTCTCTC-GTCCTTTCCTTTC-TGCTGCACA  95

seq1  CTTAAGAGTTAAACAAGTT-CAGAGATTC-TCACTGGATATTCTTGCCAG  144
      ||||||||| ||  ||||| ||||||||| |||||||||||   ||||||
seq2  CTTAAGAGTAAACAAAGTTCCAGAGATTCTTCACTGGATAT--CTGCCAG  143

seq1  CCCCAGATAATTAAGTTTTGTTTCATCAGTAGTGCTG-ACCCTGTAAATT  193
      ||||||||||| ||||||||||||||||||||||||| ||||||||||| 
seq2  CCCCAGATAATAAAGTTTTGTTTCATCAGTAGTGCTGAACCCTGTAAATG  193

seq1  GCCTG-CCCATGTCATCTGAGAGGGGCTATTGGCTGCCTGCCTCAGTTT-  241
      || || |||||||||||||||||||||||| |||||||||||||||||| 
seq2  GCTTGCCCCATGTCATCTGAGAGGGGCTATGGGCTGCCTGCCTCAGTTTA  243

seq1  ACCCTGTGGTGTTAAAGCTGGACTTGGACATGATTAGCTCCTTCTGAGAG  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTGTGGTGTTAAAGCTGGACTTGGACATGATTAGCTCCTTCTGAGAG  293

seq1  GTATTCAGCTGTCTGACTTGCG-TTCCCTGTCTCCTG-AAGTCTTAGACA  339
      |||||||||||||||||||||| |||||||||||||| ||||||||||||
seq2  GTATTCAGCTGTCTGACTTGCGTTTCCCTGTCTCCTGAAAGTCTTAGACA  343

seq1  TTGTATAGCTCAGGATAATCACCATGAAGGAC-AAGGGCTGACGAAAGTG  388
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  TTGTATAGCTCAGGATAATCACCATGAAGGACAAAGGGCTGACGAAAGTG  393

seq1  TGGGGCTCGGAGCAGCCCTAATCTCTGCCCTGAGAAAGGTGTCTGCAC-T  437
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  TGGGGCTCGGAGCAGCCCTAATCTCTGCCCTGAGAAAGGTGTCTGCACTT  443

seq1  TCTGAATTTTCATGGTCAGAAGAGTGGACGCTGGATGAGCTGTGACCTGC  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGAATTTTCATGGTCAGAAGAGTGGACGCTGGATGAGCTGTGACCTGC  493

seq1  AAATCCTGGCCCAGTAGCTGCAGAACTTCCCTCCTAGACTTAAATAATGG  537
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCCTGGCCCAGTAGCTGCAGAACTTCCCTCCTAGACTTAAATAATGG  543

seq1  AACAGGAAGCACGAGAAGGAGCTCTGGGGTTCATTGATCTGTCCAGGTGC  587
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGGAAGCACGAGAAGGAGCTCTGGGGTTCATTGATCTGTCCAGGTGC  593

seq1  AGAATGGGGTAGACTTGGAAAAAGAGCAGAATAAGGGGATCCACGGAGGA  637
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATGGGGTAGACTTGGAAAAAGAGCAGAATAAGGGGATCCACGGAGGA  643

seq1  CAAAAACCACACACCAGCACAAGCAGGCAGAATCAAGGGTTGACCTCTCT  687
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAACCACACACCAGCACAAGCAGGCAGAATCAAGGGTTGACCTCTCT  693

seq1  CTTTGGTTCCACAGTGTCCTTGTAGCACTCTATGAGAAGCCAAAGTCGCA  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGGTTCCACAGTGTCCTTGTAGCACTCTATGAGAAGCCAAAGTCGCA  743

seq1  GGACAGAGTATGTAGCAGATAAGCAGAGTTCCCTATCAGAAGGTGGTTAA  787
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAGAGTATGTAGCAGATAAGCAGAGTTCCCTATCAGAAGGTGGTTAA  793

seq1  GTGGAAGTGCTTAGAGCGTGAGGCTTCTCTCAGGGACTCAGAGTCACCCT  837
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAAGTGCTTAGAGCGTGAGGCTTCTCTCAGGGACTCAGAGTCACCCT  843

seq1  CTTAGTATAGCAGTGCTGCTCTGACACCATGCTGGAAATCAAGAAGCTTA  887
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGTATAGCAGTGCTGCTCTGACACCATGCTGGAAATCAAGAAGCTTA  893

seq1  GTCAGACATGGCAGAAACTTCTGTTCACCATCTGGAGTCCAGGAAGTTGA  937
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGACATGGCAGAAACTTCTGTTCACCATCTGGAGTCCAGGAAGTTGA  943

seq1  AGATCCAGATGCCAGTAGTCCAGTATCTAAGGAGGACCTGCTTCGTGGTT  987
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCCAGATGCCAGTAGTCCAGTATCTAAGGAGGACCTGCTTCGTGGTT  993

seq1  CATAATTAATATCTTCTCACTGTGTCAGTTAGGATGGTGTCTCTCTCAGT  1037
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAATTAATATCTTCTCACTGTGTCAGTTAGGATGGTGTCTCTCTCAGT  1043

seq1  GCCTCTGTGACGGAACCAGCTCTCGGCACAATCTCCTGTGGTCTCTTCCT  1087
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCTGTGACGGAACCAGCTCTCGGCACAATCTCCTGTGGTCTCTTCCT  1093

seq1  TGAGGATTGGAGATTTCAGCAGGTGAATTC  1117
      ||||||||||||||||||||||||||||||
seq2  TGAGGATTGGAGATTTCAGCAGGTGAATTC  1123

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information