MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-224M03
Chromosome	15 (Build37)	18 (Build37)
Map Location	98,584,554 - 98,585,697	57,986,674 - 57,986,715
singlet/doublet	singlet	singlet
Overlap gene	Arf3
Upstream gene	Rapgef3, 4930570C03Rik, Hdac7a, Vdr, Tmem106c, Col2a1, Senp1, Pfkm, Asb8, AI836003, Olfr288, LOC634104, EG629524, H1fnt, Zfp641, Olfr285, Olfr284, Olfr283, 1700031M16Rik, LOC100042818, Olfr282, LOC629549, Olfr281, Olfr240-ps1, GA_x5J8B7W76D0-7895713-7896429, Lalba, Olfr234, Olfr278-ps1, 2310037I24Rik, LOC100043418, Ccnt1, 4930415O20Rik, Adcy6, Cacnb3, Ddx23, Rnd1, Ccdc65, Fkbp11
Downstream gene	5830427D03Rik, Wnt10b, Wnt1, Ddn, Prkag1, Mll2, Rhebl1, Dhh, Lmbr1l, Tuba1b, Tuba1a, EG668092, Tuba1c, Prph1, Troap, C1ql4, 2810451A06Rik, Spats2, Kcnh3, Mcrs1, EG545136, Prpf40b, Fmnl3, Tegt, C230021P08Rik, 4930556P03Rik, Faim2, LOC545137, Aqp2, Aqp5, Aqp6, Racgap1, LOC100043473, Accn2, Smarcd1, Gpd1, 2310016M24Rik, Lass5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rapgef3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223864 MGI:2441741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930570C03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67739 MGI:1914989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56233 MGI:1891835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vdr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22337 MGI:103076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem106c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380967 MGI:1196384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12824 MGI:88452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Senp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223870 MGI:2445054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfkm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18642 MGI:97548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78541 MGI:1925791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI836003 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239650 MGI:2146066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr288 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545140 MGI:3030122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC634104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2329 Proteins

name	EG629524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629524 MGI:3643095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1690 Proteins

name	H1fnt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70069 MGI:1917319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp641 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239652 MGI:2442788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr285 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257943 MGI:3030119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr284 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258278 MGI:3030118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr283 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259038 MGI:3030117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700031M16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73302 MGI:1920552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100042818 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042818
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr282 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258449 MGI:3030116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629549 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr281 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258277 MGI:3030115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr240-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404356 MGI:3030074
definition	gene_synonym : MOR160-6_p note : olfactory receptor 240, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W76D0-7895713-7896429 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257751
definition	note : olfactory receptor GA_x5J8B7W76D0-7895713-7896429 pseudo : _no_value

name	Lalba (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16770 MGI:96742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr234 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258502 MGI:3030068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr278-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404371 MGI:3030112
definition	note : olfactory receptor 278, pseudogene 1 pseudo : _no_value

name	2310037I24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69612 MGI:1916862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043418 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Ccnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12455 MGI:1328363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930415O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73863 MGI:1921113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 1 Protein

name	Adcy6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11512 MGI:87917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12297 MGI:103307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ddx23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74351 MGI:1921601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223881 MGI:2444878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105833 MGI:2146001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66120 MGI:1913370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11842 MGI:99432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830427D03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76061 MGI:1923311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt10b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22410 MGI:108061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22408 MGI:98953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13199 MGI:108101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 38 ESTs, 3 Proteins

name	Prkag1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19082 MGI:108411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mll2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381022 MGI:2682319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 31 ESTs, 9 Proteins

name	Rhebl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69159 MGI:1916409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13363 MGI:94891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lmbr1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74775 MGI:1289247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tuba1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22143 MGI:107804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tuba1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22142 MGI:98869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668092 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668092 MGI:3648534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins

name	Tuba1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22146 MGI:1095409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prph1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19132 MGI:97774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Troap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78733 MGI:1925983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 67 ESTs, 1 Protein

name	C1ql4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239659 MGI:3579909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810451A06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72778 MGI:1920028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spats2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72572 MGI:1919822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16512 MGI:1341723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcrs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51812 MGI:1858420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545136 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545136 MGI:3647604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prpf40b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54614 MGI:1925583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmnl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22379 MGI:109569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tegt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110213 MGI:99682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230021P08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380969 MGI:3609653
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930556P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75284 MGI:1922534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Faim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72393 MGI:1919643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC545137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 ESTs, 5 Proteins pseudo : _no_value

name	Aqp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11827 MGI:1096865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aqp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11830 MGI:106215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aqp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11831 MGI:1341204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Racgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26934 MGI:1349423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Accn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11419 MGI:1194915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83797 MGI:1933623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14555 MGI:95679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310016M24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66379 MGI:1913629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lass5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71949 MGI:1919199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rapgef3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450060 GeneID:223864 MGI:2441741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF) 3 transcript_id : NM_144850.1

name	4930570C03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368946 GeneID:67739 MGI:1914989
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930570C03 gene transcript_id : NM_026353.3

name	Hdac7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254547 GeneID:56233 MGI:1891835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 7A transcript_id : NM_019572.2

name	Vdr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227202 GeneID:22337 MGI:103076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitamin D receptor transcript_id : NM_009504.3

name	Tmem106c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235746 GeneID:380967 MGI:1196384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 106C transcript_id : NM_201359.1

name	Col2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70980519 GeneID:12824 MGI:88452
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type II, alpha 1 transcript_id : NM_031163.2

name	Senp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353113 GeneID:223870 MGI:2445054
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SUMO1/sentrin specific peptidase 1 transcript_id : NM_144851.3

name	Pfkm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367127 GeneID:18642 MGI:97548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphofructokinase, muscle transcript_id : NM_021514.3

name	Asb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801748 GeneID:78541 MGI:1925791
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 8 transcript_id : NM_030121.3

name	AI836003 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386196 GeneID:239650 MGI:2146066
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI836003 transcript_id : NM_177716.2

name	Olfr288 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185919 GeneID:545140 MGI:3030122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 288 transcript_id : NM_001011733.2

name	LOC634104 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266752 GeneID:634104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2329 Proteins product : similar to Olfactory receptor 10AD1 transcript_id : XM_993741.2

name	EG629524 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266754 GeneID:629524 MGI:3643095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1690 Proteins product : predicted gene, EG629524 transcript_id : XM_894414.3

name	H1fnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24111223 GeneID:70069 MGI:1917319
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H1 histone family, member N, testis-specific transcript_id : NM_027304.1

name	Zfp641 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350744 GeneID:239652 MGI:2442788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 641 transcript_id : NM_173769.3

name	Olfr285 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801331 GeneID:257943 MGI:3030119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 285 transcript_id : NM_001011778.1

name	Olfr284 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129720 GeneID:258278 MGI:3030118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 284 transcript_id : NM_146281.1

name	Olfr283 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128872 GeneID:259038 MGI:3030117
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 283 transcript_id : NM_147036.1

name	1700031M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398875 GeneID:73302 MGI:1920552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 1700031M16 gene, transcript variant 3 transcript_id : XM_902386.2

name	1700031M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398874 GeneID:73302 MGI:1920552
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700031M16 gene, transcript variant 2 transcript_id : XM_902383.2

name	Olfr282 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125719160 GeneID:258449 MGI:3030116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 282 transcript_id : NM_146457.2

name	Olfr281 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129726 GeneID:258277 MGI:3030115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 281 transcript_id : NM_146280.1

name	Lalba (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754499 GeneID:16770 MGI:96742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactalbumin, alpha transcript_id : NM_010679.1

name	Olfr234 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49227366 GeneID:258502 MGI:3030068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 234 transcript_id : NM_001001807.1

name	2310037I24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364524 GeneID:69612 MGI:1916862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310037I24 gene transcript_id : NM_133714.3

name	LOC100043418 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266807 GeneID:100043418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100043418 transcript_id : XM_001480722.1

name	Ccnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753315 GeneID:12455 MGI:1328363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin T1 transcript_id : NM_009833.1

name	4930415O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398893 GeneID:73863 MGI:1921113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 1 Protein product : RIKEN cDNA 4930415O20 gene transcript_id : XM_128114.5

name	Adcy6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86604720 GeneID:11512 MGI:87917
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate cyclase 6 transcript_id : NM_007405.2

name	Cacnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680290 GeneID:12297 MGI:103307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, beta 3 subunit transcript_id : NM_001044741.1

name	Cacnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680270 GeneID:12297 MGI:103307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, beta 3 subunit transcript_id : NM_007581.2

name	Ddx23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430513 GeneID:74351 MGI:1921601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 transcript_id : NM_001080981.1

name	Rnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361493 GeneID:223881 MGI:2444878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho family GTPase 1 transcript_id : NM_172612.2

name	Ccdc65 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943817 GeneID:105833 MGI:2146001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 65 transcript_id : NM_153518.1

name	Fkbp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861215 GeneID:66120 MGI:1913370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 11 transcript_id : NM_024169.3

name	Arf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131061 GeneID:11842 MGI:99432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor 3 transcript_id : NM_007478.3

name	5830427D03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361597 GeneID:76061 MGI:1923311
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830427D03 gene transcript_id : NM_175232.3

name	Wnt10b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6756002 GeneID:22410 MGI:108061
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless related MMTV integration site 10b transcript_id : NM_011718.1

name	Wnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271537 GeneID:22408 MGI:98953
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 1 transcript_id : NM_021279.3

name	Ddn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266809 GeneID:13199 MGI:108101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 33 ESTs, 3 Proteins product : dendrin, transcript variant 1 transcript_id : XM_001480765.1

name	Ddn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398894 GeneID:13199 MGI:108101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 33 ESTs, 3 Proteins product : dendrin, transcript variant 2 transcript_id : XM_619356.3

name	Prkag1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107595 GeneID:19082 MGI:108411
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, AMP-activated, gamma 1 non-catalytic subunit transcript_id : NM_016781.2

name	Mll2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266756 GeneID:381022 MGI:2682319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 31 ESTs, 9 Proteins product : myeloid/lymphoid or mixed-lineage leukemia 2 transcript_id : XM_619357.4

name	Rhebl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328496 GeneID:69159 MGI:1916409
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras homolog enriched in brain like 1 transcript_id : NM_026967.3

name	Dhh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353160 GeneID:13363 MGI:94891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : desert hedgehog transcript_id : NM_007857.3

name	Lmbr1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344065 GeneID:74775 MGI:1289247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : limb region 1 like transcript_id : NM_029098.3

name	Tuba1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186463 GeneID:22143 MGI:107804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, alpha 1B transcript_id : NM_011654.2

name	Tuba1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892260 GeneID:22142 MGI:98869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, alpha 1A transcript_id : NM_011653.2

name	EG668092 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398899 GeneID:668092 MGI:3648534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : predicted gene, EG668092 transcript_id : XM_994269.1

name	Tuba1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130393 GeneID:22146 MGI:1095409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, alpha 1C transcript_id : NM_009448.4

name	Prph1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305412 GeneID:19132 MGI:97774
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peripherin 1 transcript_id : NM_013639.1

name	Troap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398901 GeneID:78733 MGI:1925983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 67 ESTs, 1 Protein product : trophinin associated protein transcript_id : XM_283286.4

name	C1ql4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725390 GeneID:239659 MGI:3579909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 1, q subcomponent-like 4 transcript_id : NM_001024702.1

name	2810451A06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341187 GeneID:72778 MGI:1920028
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810451A06 gene transcript_id : NM_176835.2

name	Spats2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20982832 GeneID:72572 MGI:1919822
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated, serine-rich 2 transcript_id : NM_139140.1

name	Kcnh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46560566 GeneID:16512 MGI:1341723
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily H (eag-related), member 3 transcript_id : NM_010601.2

name	Mcrs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980614 GeneID:51812 MGI:1858420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microspherule protein 1 transcript_id : NM_016766.2

name	EG545136 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486942 GeneID:545136 MGI:3647604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545136 transcript_id : NM_001081254.1

name	Prpf40b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379827 GeneID:54614 MGI:1925583
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRP40 pre-mRNA processing factor 40 homolog B (yeast) transcript_id : NM_018786.2

name	Fmnl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38708162 GeneID:22379 MGI:109569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin-like 3 transcript_id : NM_011711.1

name	Tegt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383851 GeneID:110213 MGI:99682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis enhanced gene transcript transcript_id : NM_026669.3

name	C230021P08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49457862 GeneID:380969 MGI:3609653
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Riken cDNA C230021P08 gene transcript_id : NM_001001884.1

name	4930556P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312917 GeneID:75284 MGI:1922534
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930556P03 gene transcript_id : NM_029236.1

name	Faim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781819 GeneID:72393 MGI:1919643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas apoptotic inhibitory molecule 2 transcript_id : NM_001038658.1

name	Faim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781818 GeneID:72393 MGI:1919643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas apoptotic inhibitory molecule 2 transcript_id : NM_028224.3

name	Aqp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560619 GeneID:11827 MGI:1096865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 2 transcript_id : NM_009699.2

name	Aqp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117940061 GeneID:11830 MGI:106215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 5 transcript_id : NM_009701.4

name	Aqp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802655 GeneID:11831 MGI:1341204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 6 transcript_id : NM_175087.3

name	Racgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384974 GeneID:26934 MGI:1349423
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rac GTPase-activating protein 1 transcript_id : NM_012025.4

name	LOC100043473 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266812 GeneID:100043473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043473 transcript_id : XM_001480820.1

name	Accn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45433492 GeneID:11419 MGI:1194915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amiloride-sensitive cation channel 2, neuronal transcript_id : NM_009597.1

name	Smarcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347395 GeneID:83797 MGI:1933623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 transcript_id : NM_031842.2

name	Gpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542905 GeneID:14555 MGI:95679
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerol-3-phosphate dehydrogenase 1 (soluble) transcript_id : NM_010271.2

name	2310016M24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345368 GeneID:66379 MGI:1913629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310016M24 gene transcript_id : NM_183256.2

name	Lass5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980682 GeneID:71949 MGI:1919199
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : longevity assurance homolog 5 (S. cerevisiae) transcript_id : NM_028015.2

name	Rapgef3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450061 GeneID:223864 MGI:2441741
definition	GO_component : GO:0005952 - cAMP-dependent protein kinase complex [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : exchange protein directly activated by cAMP product : Rap1 guanine-nucleotide-exchange factor directly activated by cAMP protein_id : NP_659099.1

name	4930570C03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385856 GeneID:67739 MGI:1914989
definition	codon_start : 1 product : hypothetical protein LOC67739 protein_id : NP_080629.1

name	Hdac7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254548 GeneID:56233 MGI:1891835
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] [Evidence IDA]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016566 - specific transcriptional repressor activity [Evidence TAS]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0030183 - B cell differentiation [Evidence TAS]; GO:0016568 - chromatin modification [Evidence TAS] [Evidence IEA]; GO:0006954 - inflammatory response [Evidence TAS]; GO:0045843 - negative regulation of striated muscle development [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007399 - nervous system development [Evidence TAS]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : mFLJ00062 protein; histone deacetylase 7A, promoter 1; histone deacetylase 7A, promoter 2; histone deacetylase 7A, promoter 3 product : histone deacetylase 7A protein_id : NP_062518.2

name	Vdr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543944 CCDS:CCDS27784.1 GeneID:22337 MGI:103076
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IMP]; GO:0007275 - development [Evidence IMP]; GO:0050892 - intestinal absorption [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : vitamin D receptor protein_id : NP_033530.2

name	Tmem106c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235747 CCDS:CCDS27785.1 GeneID:380967 MGI:1196384
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC380967 protein_id : NP_958747.1

name	Col2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624305 GeneID:12824 MGI:88452
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0001502 - cartilage condensation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0030199 - collagen fibril organization [Evidence IMP]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0006029 - proteoglycan metabolism [Evidence IMP] codon_start : 1 exception : mismatches in translation note : disproportionate micromelia product : procollagen, type II, alpha 1 protein_id : NP_112440.1

name	Senp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450063 GeneID:223870 MGI:2445054
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0016926 - protein desumoylation [Evidence IMP] [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : SUMO1/sentrin specific protease 1 protein_id : NP_659100.1

name	Pfkm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981185 CCDS:CCDS27786.1 GeneID:18642 MGI:97548
definition	GO_component : GO:0005945 - 6-phosphofructokinase complex [Evidence IEA] [Evidence ISS]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003872 - 6-phosphofructokinase activity [Evidence ISS] [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008443 - phosphofructokinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0006110 - regulation of glycolysis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : phosphofructokinase-1 A isozyme; phosphofructokinase-M (connecting peptide) product : phosphofructokinase, muscle protein_id : NP_067489.2

name	Asb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560038 CCDS:CCDS27787.1 GeneID:78541 MGI:1925791
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 exception : mismatches in translation product : ankyrin repeat and SOCS box-containing protein 8 protein_id : NP_084397.2

name	AI836003 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244182 GeneID:239650 MGI:2146066
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC239650 protein_id : NP_808384.1

name	Olfr288 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185920 GeneID:545140 MGI:3030122
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5568919-5569857; olfactory receptor MOR286-3P; olfactory receptor GA_x5J8B7W76D0-7609197-7608973 product : olfactory receptor 288 protein_id : NP_001011733.2

name	LOC634104 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266753 GeneID:634104
definition	codon_start : 1 product : similar to olfactory receptor Olfr287 protein_id : XP_998835.2

name	EG629524 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266755 GeneID:629524 MGI:3643095
definition	codon_start : 1 product : similar to olfactory receptor Olfr286 protein_id : XP_899507.3

name	H1fnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24111224 GeneID:70069 MGI:1917319
definition	GO_component : GO:0000790 - nuclear chromatin [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence TAS] GO_process : GO:0035092 - sperm chromatin condensation [Evidence IMP]; GO:0007290 - spermatid nuclear elongation [Evidence IMP] codon_start : 1 exception : mismatches in translation note : expressed in haploid spermatids during spermiogenesis, specifically at the apical pole of round and elongating spermatids product : histone H1 variant protein_id : NP_081580.1

name	Zfp641 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424631 CCDS:CCDS27789.1 GeneID:239652 MGI:2442788
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 641 protein_id : NP_776130.1

name	Olfr285 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801332 CCDS:CCDS27790.1 GeneID:257943 MGI:3030119
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5440777-5441736; olfactory receptor MOR160-3 product : olfactory receptor 285 protein_id : NP_001011778.1

name	Olfr284 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129721 CCDS:CCDS27791.1 GeneID:258278 MGI:3030118
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5395976-5396893; olfactory receptor MOR160-4 product : olfactory receptor 284 protein_id : NP_666393.1

name	Olfr283 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128873 CCDS:CCDS27792.1 GeneID:259038 MGI:3030117
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5351896-5352825; olfactory receptor MOR160-1 product : olfactory receptor 283 protein_id : NP_667247.1

name	1700031M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957729 GeneID:73302 MGI:1920552
definition	codon_start : 1 product : hypothetical protein LOC73302 isoform 3 protein_id : XP_907479.1

name	1700031M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957727 GeneID:73302 MGI:1920552
definition	codon_start : 1 product : hypothetical protein LOC73302 isoform 2 protein_id : XP_907476.1

name	Olfr282 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125719161 CCDS:CCDS27793.1 GeneID:258449 MGI:3030116
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5293798-5292872; olfactory receptor MOR160-2 product : olfactory receptor 282 protein_id : NP_666668.2

name	Olfr281 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129727 CCDS:CCDS27794.1 GeneID:258277 MGI:3030115
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NBG7-5275017-5274082; olfactory receptor MOR160-5 product : olfactory receptor 281 protein_id : NP_666392.1

name	Lalba (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754500 CCDS:CCDS27795.1 GeneID:16770 MGI:96742
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004461 - lactose synthase activity [Evidence IEA] GO_process : GO:0005989 - lactose biosynthesis [Evidence IEA] codon_start : 1 product : lactalbumin, alpha protein_id : NP_034809.1

name	Olfr234 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49227367 CCDS:CCDS27796.1 GeneID:258502 MGI:3030068
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T04SN1-554-3; olfactory receptor MOR122-1; olfactory receptor 234, pseudogene 1 product : olfactory receptor 234 protein_id : NP_001001807.1

name	2310037I24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981558 GeneID:69612 MGI:1916862
definition	codon_start : 1 product : hypothetical protein LOC69612 protein_id : NP_598475.2

name	LOC100043418 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266808 GeneID:100043418
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480772.1

name	Ccnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753316 CCDS:CCDS27797.1 GeneID:12455 MGI:1328363
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0019901 - protein kinase binding [Evidence IEA]; GO:0017069 - snRNA binding [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0000079 - regulation of cyclin-dependent protein kinase activity [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : cyclin T1 protein_id : NP_033963.1

name	4930415O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20903411 GeneID:73863 MGI:1921113
definition	codon_start : 1 product : hypothetical protein LOC73863 protein_id : XP_128114.1

name	Adcy6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86604721 CCDS:CCDS27799.1 GeneID:11512 MGI:87917
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004016 - adenylate cyclase activity [Evidence TAS]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA] GO_process : GO:0007190 - adenylate cyclase activation [Evidence TAS]; GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : adenylate cyclase 6 protein_id : NP_031431.2

name	Cacnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680291 GeneID:12297 MGI:103307
definition	GO_component : GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008331 - high voltage-gated calcium channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; calcium channel beta 3 subunit product : calcium channel, voltage-dependent, beta 3 subunit isoform 2 protein_id : NP_001038206.1

name	Cacnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680271 CCDS:CCDS27800.1 GeneID:12297 MGI:103307
definition	GO_component : GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008331 - high voltage-gated calcium channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; calcium channel beta 3 subunit product : calcium channel, voltage-dependent, beta 3 subunit isoform 1 protein_id : NP_031607.2

name	Ddx23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430514 GeneID:74351 MGI:1921601
definition	GO_component : GO:0046540 - U4/U6 x U5 tri-snRNP complex [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 protein_id : NP_001074450.1

name	Rnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369880 CCDS:CCDS27801.1 GeneID:223881 MGI:2444878
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : Rho family GTPase 1 protein_id : NP_766200.1

name	Ccdc65 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943818 CCDS:CCDS27802.1 GeneID:105833 MGI:2146001
definition	codon_start : 1 product : coiled-coil domain containing 65 protein_id : NP_705738.1

name	Fkbp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15277331 CCDS:CCDS27803.1 GeneID:66120 MGI:1913370
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : FK506 binding protein 11 protein_id : NP_077131.2

name	Arf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680718 CCDS:CCDS27804.1 GeneID:11842 MGI:99432
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence TAS]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ADP-ribosylation factor 3 protein_id : NP_031504.1

name	5830427D03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424868 GeneID:76061 MGI:1923311
definition	codon_start : 1 product : hypothetical protein LOC76061 protein_id : NP_780441.1

name	Wnt10b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756003 CCDS:CCDS27806.1 GeneID:22410 MGI:108061
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : wingless related MMTV integration site 10b protein_id : NP_035848.1

name	Wnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469103 CCDS:CCDS27807.1 GeneID:22408 MGI:98953
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0042472 - inner ear morphogenesis [Evidence IGI]; GO:0048663 - neuron fate commitment [Evidence IMP]; GO:0048664 - neuron fate determination [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IDA] codon_start : 1 product : wingless-related MMTV integration site 1 protein_id : NP_067254.1

name	Ddn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957869 GeneID:13199 MGI:108101
definition	codon_start : 1 product : dendrin isoform 2 protein_id : XP_619356.2

name	Ddn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266810 GeneID:13199 MGI:108101
definition	codon_start : 1 product : dendrin isoform 1 protein_id : XP_001480815.1

name	Prkag1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107596 GeneID:19082 MGI:108411
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004679 - AMP-activated protein kinase activity [Evidence TAS]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0006633 - fatty acid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006950 - response to stress [Evidence TAS] codon_start : 1 product : AMP-activated protein kinase, noncatalytic gamma-1 subunit protein_id : NP_058061.2

name	Mll2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266757 GeneID:381022 MGI:2682319
definition	codon_start : 1 product : myeloid/lymphoid or mixed-lineage leukemia 2 protein_id : XP_619357.4

name	Rhebl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312218 CCDS:CCDS27809.1 GeneID:69159 MGI:1916409
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : Ras homolog enriched in brain-like 1 protein_id : NP_081243.1

name	Dhh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681181 CCDS:CCDS27810.1 GeneID:13363 MGI:94891
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0016539 - intein-mediated protein splicing [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : desert hedgehog protein_id : NP_031883.1

name	Lmbr1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312884 CCDS:CCDS27811.1 GeneID:74775 MGI:1289247
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : lipocalin-interacting membrane receptor protein_id : NP_083374.1

name	Tuba1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34740335 GeneID:22143 MGI:107804
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, alpha 2 protein_id : NP_035784.1

name	Tuba1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755901 GeneID:22142 MGI:98869
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 note : Talpha1 alpha-tubulin product : tubulin, alpha 1 protein_id : NP_035783.1

name	EG668092 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398900 GeneID:668092 MGI:3648534
definition	codon_start : 1 product : similar to 60S ribosomal protein L36 protein_id : XP_999363.1

name	Tuba1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678469 GeneID:22146 MGI:1095409
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, alpha 6 protein_id : NP_033474.1

name	Prph1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305413 CCDS:CCDS27813.1 GeneID:19132 MGI:97774
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : peripherin 1 protein_id : NP_038667.1

name	Troap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38077144 GeneID:78733 MGI:1925983
definition	codon_start : 1 product : trophinin associated protein protein_id : XP_283286.2

name	C1ql4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71725391 CCDS:CCDS27814.1 GeneID:239659 MGI:3579909
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : C1qTNF11 product : complement component 1, q subcomponent-like 4 protein_id : NP_001019873.1

name	2810451A06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849883 CCDS:CCDS27815.1 GeneID:72778 MGI:1920028
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : RIKEN cDNA 2810451A06 protein_id : NP_789805.1

name	Spats2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20982833 CCDS:CCDS27816.1 GeneID:72572 MGI:1919822
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : serine-rich spermatocytes and round spermatid protein, 59kDa product : spermatogenesis associated, serine-rich 2 protein_id : NP_631879.1

name	Kcnh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560567 CCDS:CCDS27817.1 GeneID:16512 MGI:1341723
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0000155 - two-component sensor activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ether a go-go like product : potassium voltage-gated channel, subfamily H (eag-related), member 3 protein_id : NP_034731.2

name	Mcrs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980615 GeneID:51812 MGI:1858420
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : nucleolar protein product : microspherule protein 1 protein_id : NP_058046.2

name	EG545136 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486943 GeneID:545136 MGI:3647604
definition	codon_start : 1 product : predicted gene, EG545136 protein_id : NP_001074723.1

name	Prpf40b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055244 CCDS:CCDS27818.1 GeneID:54614 MGI:1925583
definition	codon_start : 1 note : PRP40 pre-mRNA processing factor 40 homolog A product : huntington yeast partner C protein_id : NP_061256.1

name	Fmnl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38708163 CCDS:CCDS27819.1 GeneID:22379 MGI:109569
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0016043 - cell organization and biogenesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : WW domain binding protein 3 product : formin-like 3 protein protein_id : NP_035841.1

name	Tegt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311961 GeneID:110213 MGI:99682
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0043066 - negative regulation of apoptosis [Evidence IEA] codon_start : 1 note : Bax inhibitor-1 product : testis enhanced gene transcript protein_id : NP_080945.1

name	C230021P08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49457863 CCDS:CCDS27820.1 GeneID:380969 MGI:3609653
definition	codon_start : 1 product : hypothetical protein LOC380969 protein_id : NP_001001884.1

name	4930556P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312918 GeneID:75284 MGI:1922534
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC75284 protein_id : NP_083512.1

name	Faim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781820 GeneID:72393 MGI:1919643
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; neural membrane protein 35 product : lifeguard isoform 2 protein_id : NP_001033747.1

name	Faim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328312 GeneID:72393 MGI:1919643
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; neural membrane protein 35 product : lifeguard isoform 1 protein_id : NP_082500.2

name	Aqp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560620 CCDS:CCDS27822.1 GeneID:11827 MGI:1096865
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence TAS] GO_process : GO:0006810 - transport [Evidence IEA]; GO:0006833 - water transport [Evidence TAS] codon_start : 1 exception : mismatches in translation product : aquaporin 2 protein_id : NP_033829.2

name	Aqp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857757 CCDS:CCDS27823.1 GeneID:11830 MGI:106215
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0009925 - basal plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005902 - microvillus [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence TAS] GO_process : GO:0006810 - transport [Evidence IEA]; GO:0006833 - water transport [Evidence TAS] codon_start : 1 product : aquaporin 5 protein_id : NP_033831.1

name	Aqp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201966 CCDS:CCDS27824.1 GeneID:11831 MGI:1341204
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence TAS] GO_process : GO:0006833 - water transport [Evidence TAS] codon_start : 1 product : aquaporin 6 protein_id : NP_780296.1

name	Racgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755266 CCDS:CCDS27825.1 GeneID:26934 MGI:1349423
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0043014 - alpha-tubulin binding [Evidence ISS]; GO:0048487 - beta-tubulin binding [Evidence ISS]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005096 - GTPase activator activity [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0000915 - cytokinesis, contractile ring formation [Evidence ISS]; GO:0007108 - cytokinesis, initiation of separation [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0007405 - neuroblast proliferation [Evidence IEP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence ISS] codon_start : 1 product : Rac GTPase-activating protein 1 protein_id : NP_036155.1

name	LOC100043473 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266813 GeneID:100043473
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480870.1

name	Accn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45433493 CCDS:CCDS27826.1 GeneID:11419 MGI:1194915
definition	GO_component : GO:0043198 - dendritic shaft [Evidence ISS]; GO:0043197 - dendritic spine [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence ISS]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0015280 - amiloride-sensitive sodium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence IDA] [Evidence IMP]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0015077 - monovalent inorganic cation transporter activity [Evidence ISS]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0008306 - associative learning [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence IDA] [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007613 - memory [Evidence IMP]; GO:0015672 - monovalent inorganic cation transport [Evidence ISS]; GO:0001101 - response to acid [Evidence IMP] [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acid sensing ion channel; degenerin 2 product : amiloride-sensitive cation channel 2, neuronal protein_id : NP_033727.1

name	Smarcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347396 GeneID:83797 MGI:1933623
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 protein_id : NP_114030.2

name	Gpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753966 CCDS:CCDS27828.1 GeneID:14555 MGI:95679
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0009331 - glycerol-3-phosphate dehydrogenase complex [Evidence TAS] GO_function : GO:0004367 - glycerol-3-phosphate dehydrogenase (NAD+) activity [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016614 - oxidoreductase activity, acting on CH-OH group of donors [Evidence IEA]; GO:0016616 - oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006094 - gluconeogenesis [Evidence IMP]; GO:0046168 - glycerol-3-phosphate catabolism [Evidence IEA]; GO:0006072 - glycerol-3-phosphate metabolism [Evidence IMP] codon_start : 1 note : glycerolphosphate dehydrogenase 1, cytoplasmic adult; glycerol phosphate dehydrogenase 1, cytoplasmic adult product : glycerol-3-phosphate dehydrogenase 1 (soluble) protein_id : NP_034401.1

name	2310016M24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304032 GeneID:66379 MGI:1913629
definition	codon_start : 1 product : hypothetical protein LOC66379 protein_id : NP_899079.1

name	Lass5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312638 CCDS:CCDS27830.1 GeneID:71949 MGI:1919199
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0046513 - ceramide biosynthesis [Evidence IDA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : longevity assurance homolog 5 protein_id : NP_082291.1

name	LOC100042818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042818
definition	number : 1 pseudo : _no_value

name	LOC100042818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042818
definition	number : 2 pseudo : _no_value

name	LOC100042818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042818
definition	number : 3 pseudo : _no_value

name	LOC100042818 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042818
definition	number : 4 pseudo : _no_value

name	LOC629549 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629549
definition	number : 1 pseudo : _no_value

name	LOC545137 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266811 GeneID:545137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 ESTs, 5 Proteins product : similar to ubiquitously expressed transcript pseudo : _no_value transcript_id : XR_034848.1

clone name	MSMg01-174P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363E18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-403O03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-527A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191A21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-456M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274O07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-224M03.b	B6Ng01-224M03.g
ACC	GA039127	GA039128
length	1,139	42
definition	B6Ng01-224M03.b	B6Ng01-224M03.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(98,584,554 - 98,585,697)	(57,986,674 - 57,986,715)
sequence	gaattcaacttgggtcctcttgagagctgccagtgctctcaaccagtgaa ccttctgtccagccccgcttagtttctgcggtagtggttgaccttgccca gattctggctttctgttcgacctgttcactgtgagctccatcttgatcgg taccagaggtcagattgggtttaaggctttcctcgctctacccaaggtca ctgatacatttttagtgttttttttcttttcttttcttttttctttttta attctcttattatatcccagccacaatttccctccctccactccttccag tccttctccctctcccctcccctcccctgatccattcctccatttccctt tagaaaagagcaggcctcccagggatatcagctgaacacggctgacaagt cacactaagactaggtacaaaccctcatatcagggctggacaatgccgta ggaggaaaggatccccagagcaggtgaacgagtcagagacagccccgact cccactgttaggagtcccacaaaaatactaagctaacaaccataacatag agaacctggctcagacccatgcaggcgctctaattgttgcttcagtccct gtaagcccccatgagccctgcttagtttattctctgggccttgttctcat ggtgtccggacctccctggctcctacaatcctccttcctggaactctgcc taatgtttggctgagggtttcagcatctgctcctatcagtggctgggcac tgatctatgaggatagctgaatgtcactaggaatcagctcactaactttt tttccagttgtgtttggttctgatccatcctctggttcttagccatccag gcagtgtcagcttgggctcaccctgtggtgtaggcctcaagctggaccag ttgtttagtgagggaagcatatcgtagctcctcctaggcagctggagata acagcacacagaacagctgggtttggagcagtggaagcggcctcagattt tagaaatagaaaacaagagcaagggtttggtggagatggcttagctccag ttcaagggttctacgtctcttctgtcttgcaggtaacagacacccttatg gtgccaagtcctacatataccatagcatcatacaataaa	caggacatccagggctacacaaagaaactctttctggaaaaa
quality values	Open. Hide. 58 33 26 32 58 26 15 45 58 62 62 62 62 47 62 62 62 62 62 62 62 62 62 56 62 62 62 62 54 62 44 44 50 46 49 56 59 62 62 59 51 62 62 59 44 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 49 42 62 62 62 59 49 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 38 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 62 49 38 34 62 62 62 54 62 47 54 62 62 62 62 62 52 62 62 62 62 45 62 62 62 62 62 54 62 62 62 62 62 62 52 62 42 49 62 62 62 58 58 58 58 54 54 58 58 54 58 54 52 58 54 58 58 58 58 41 58 58 52 58 54 58 58 52 58 58 58 58 58 48 54 58 58 58 54 58 58 58 58 52 58 58 52 58 58 58 53 58 54 58 54 54 58 58 58 58 52 58 58 49 58 58 58 58 54 58 47 39 42 54 39 58 58 42 52 58 54 52 42 58 54 51 58 58 51 51 51 52 53 58 58 53 58 58 51 58 58 53 39 49 51 51 58 58 50 58 46 41 58 50 58 41 41 58 51 52 58 48 58 37 58 58 58 51 58 51 58 48 49 37 58 58 31 35 21 58 53 50 41 49 58 58 42 35 50 50 40 52 50 50 46 53 46 46 50 52 58 39 54 50 52 50 49 54 53 40 49 50 50 49 46 49 47 51 50 50 39 54 34 38 41 34 46 43 50 51 52 51 51 50 50 36 50 41 58 42 53 46 40 53 53 50 47 40 43 27 42 39 41 51 29 51 44 50 44 27 50 50 33 10 54 29 28 54 38 39 36 39 53 34 45 42 52 51 40 41 37 54 45 38 45 42 39 35 52 40 49 31 42 53 49 40 42 32 41 42 39 33 41 37 32 32 45 39 46 14 53 30 23 40 37 41 40 32 46 37 37 47 29 43 32 39 32 31 24 53 53 45 31 34 29 29 52 53 40 43 34 31 28 32 32 34 53 49 49 49 51 39 30 34 31 32 34 53 45 26 41 32 51 30 37 42 22 42 31 31 27 31 33 28 33 26 31 27 45 32 42 31 31 51 32 20 34 32 31 34 24 43 32 29 35 16 31 31 31 41 32 31 23 23 31 29 31 6 7 11 32 32 22 40 31 28 31 34 25 31 40 31 31 32 32 32 32 35 32 30 17 22 27 11 25 20 27 26 36 31 26 21 25 27 31 25 25 31 25 25 25 37 32 48 27 32 28 31 24 22 16 44 20 32 38 19 29 24 38 35 31 31 24 15 12 7 10 11 6 18 30 22 30 14 16 10 28 32 31 24 34 36 25 16 34 10 34 16 17 31 32 32 26 32 18 29 9 14 22 14 33 26 22 25 18 32 27 18 43 25 24 43 17 21 16 26 21 30 5 10 6 21 18 14 22 15 32 16 21 10 7 7 6 8 9 13 5 29 47 16 9 5 13 32 7 14 10 16 27 34 31 16 6 4 12 10 25 10 22 11 10 32 47 27 5 28 6 23 15 5 5 7 9 5 12 13 17 19 15 17 14 19 8 24 20 18 25 13 10 16 8 13 5 5 17 28 9 5 4 17 7 7 3 1 3 3 2 3 8 6 7 4 4 6 22 7 16 12 13 15 16 9 7 4 7 13 6 4 14 4 6 5 17 13 2 4 3 3 4 10 3 3 5 10 13 5 20 16 10 9 6 6 8 5 4 4 5 4 8 6 4 6 4 18 8 4 12 8 5 6 6 4 3 3 6 13 25 8	Open. Hide. 37 19 49 58 24 34 32 42 34 20 12 13 18 27 13 47 52 54 37 52 52 40 52 54 54 58 44 58 54 58 49 46 58 58 42 58 58 58 54 52 47 41

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_98584554_98585697
seq2: B6Ng01-224M03.b_50_1188 (reverse)

seq1  TTTATGTGTATGATGCTATGTGTATATGTATGACTGTGCACCATAAGGGT  50
      ||||| |||||||||||||| ||||||||| ||||  |||||||||||||
seq2  TTTAT-TGTATGATGCTATG-GTATATGTAGGACTTGGCACCATAAGGGT  48

seq1  GTCTGGTACCTGCAAAGGACAGAAGAGGAAGGTGGACCCTGGAACTGGAG  100
      ||||| |||||||||  ||||||||| || |  | ||||| |||||||||
seq2  GTCTGTTACCTGCAA--GACAGAAGA-GACGTAGAACCCTTGAACTGGAG  95

seq1  CTAAGCCATCT-CACC-AACCCCTGCTC-TGTTTTCTATTTCTTAAAATC  147
      ||||||||||| |||| ||||| ||||| ||||||||||||| |||||||
seq2  CTAAGCCATCTCCACCAAACCCTTGCTCTTGTTTTCTATTTC-TAAAATC  144

seq1  TGA-GCCGCTTCCACCTGCTCCAAACCCAGCTGTTCTGTGGTGCTGTTAT  196
      ||| |||||||||| |||||||||||||||||||||||| ||||||||||
seq2  TGAGGCCGCTTCCA-CTGCTCCAAACCCAGCTGTTCTGT-GTGCTGTTAT  192

seq1  CTCCAGCTGCCTAGGAGAGCCTACGATATGCTTCCCTCACTAAACAACTG  246
      |||||||||||||||||   ||||||||||||||||||||||||||||||
seq2  CTCCAGCTGCCTAGGAGGAGCTACGATATGCTTCCCTCACTAAACAACTG  242

seq1  GTCCAGCTTGAGGCCTACACCACAGGGTGAGCCCAAGCCTGACACTGCCT  296
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  GTCCAGCTTGAGGCCTACACCACAGGGTGAGCCCAAG-CTGACACTGCCT  291

seq1  GGATGGCTAAGAACCAGAGGATGGATCAGAACCAAACACAACTGGAAAAA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGGCTAAGAACCAGAGGATGGATCAGAACCAAACACAACTGGAAAAA  341

seq1  AAGTTAGTGAGCTGATTCCTAGTGACATTCAGCTATCCTCATAGATCAGT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTAGTGAGCTGATTCCTAGTGACATTCAGCTATCCTCATAGATCAGT  391

seq1  GCCCAGCCACTGATAGGAGCAGATGCTGAAACCCTCAGCCAAACATTAGG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCAGCCACTGATAGGAGCAGATGCTGAAACCCTCAGCCAAACATTAGG  441

seq1  CAGAGTTCCAGGAAGGAGGATTGTAGGAGCCAGGGAGGTCCGGACACCAT  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGTTCCAGGAAGGAGGATTGTAGGAGCCAGGGAGGTCCGGACACCAT  491

seq1  GAGAACAAGGCCCAGAGAATAAACTAAGCAGGGCTCATGGGGGCTTACAG  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAACAAGGCCCAGAGAATAAACTAAGCAGGGCTCATGGGGGCTTACAG  541

seq1  GGACTGAAGCAACAATTAGAGCGCCTGCATGGGTCTGAGCCAGGTTCTCT  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTGAAGCAACAATTAGAGCGCCTGCATGGGTCTGAGCCAGGTTCTCT  591

seq1  ATGTTATGGTTGTTAGCTTAGTATTTTTGTGGGACTCCTAACAGTGGGAG  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTATGGTTGTTAGCTTAGTATTTTTGTGGGACTCCTAACAGTGGGAG  641

seq1  TCGGGGCTGTCTCTGACTCGTTCACCTGCTCTGGGGATCCTTTCCTCCTA  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGGGCTGTCTCTGACTCGTTCACCTGCTCTGGGGATCCTTTCCTCCTA  691

seq1  CGGCATTGTCCAGCCCTGATATGAGGGTTTGTACCTAGTCTTAGTGTGAC  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCATTGTCCAGCCCTGATATGAGGGTTTGTACCTAGTCTTAGTGTGAC  741

seq1  TTGTCAGCCGTGTTCAGCTGATATCCCTGGGAGGCCTGCTCTTTTCTAAA  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCAGCCGTGTTCAGCTGATATCCCTGGGAGGCCTGCTCTTTTCTAAA  791

seq1  GGGAAATGGAGGAATGGATCAGGGGAGGGGAGGGGAGAGGGAGAAGGACT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAATGGAGGAATGGATCAGGGGAGGGGAGGGGAGAGGGAGAAGGACT  841

seq1  GGAAGGAGTGGAGGGAGGGAAATTGTGGCTGGGATATAATAAGAGAATTA  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGAGTGGAGGGAGGGAAATTGTGGCTGGGATATAATAAGAGAATTA  891

seq1  AAAAAGAAAAAAGAAAAGAAAAGAAAAAAAACACTAAAAATGTATCAGTG  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGAAAAAAGAAAAGAAAAGAAAAAAAACACTAAAAATGTATCAGTG  941

seq1  ACCTTGGGTAGAGCGAGGAAAGCCTTAAACCCAATCTGACCTCTGGTACC  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTGGGTAGAGCGAGGAAAGCCTTAAACCCAATCTGACCTCTGGTACC  991

seq1  GATCAAGATGGAGCTCACAGTGAACAGGTCGAACAGAAAGCCAGAATCTG  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCAAGATGGAGCTCACAGTGAACAGGTCGAACAGAAAGCCAGAATCTG  1041

seq1  GGCAAGGTCAACCACTACCGCAGAAACTAAGCGGGGCTGGACAGAAGGTT  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAGGTCAACCACTACCGCAGAAACTAAGCGGGGCTGGACAGAAGGTT  1091

seq1  CACTGGTTGAGAGCACTGGCAGCTCTCAAGAGGACCCAAGTTGAATTC  1144
      ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGGTTGAGAGCACTGGCAGCTCTCAAGAGGACCCAAGTTGAATTC  1139

seq1: chr18_57986674_57986715
seq2: B6Ng01-224M03.g_76_117 (reverse)

seq1  TTTTTCCAGACAGGGTTTCTCTGTGTAGCCCTGGATGTCCTG  42
      |||||||||| || |||||| |||||||||||||||||||||
seq2  TTTTTCCAGAAAGAGTTTCTTTGTGTAGCCCTGGATGTCCTG  42

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information