MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-227E06
Chromosome	15 (Build37)
Map Location	80,634,982 - 80,785,504
singlet/doublet	doublet
Overlap gene	Tnrc6b, Adsl, LOC625672
Upstream gene	Npcd, Nptxr, Cbx6, LOC100042748, Apobec3, Cbx7, Pdgfb, Rpl3, Syngr1, Map3k7ip1, Mgat3, EG666948, Smcr7l, Atf4, Rps19bp1, Cacna1i, Enthd1, Grap2, AW544981
Downstream gene	Rutbc3, Mkl1, LOC675966, Mchr1, Slc25a17, St13, Xpnpep3, Dnajb7, Rbx1, EG383080, Ep300, L3mbtl2, Rangap1, Zc3h7b, Tef, LOC667073, Tob2, Phf5a, Aco2, Polr3h, Csdc2, Pmm1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Npcd (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:504193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nptxr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73340 MGI:1920590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:494448 MGI:3512628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042748 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Apobec3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80287 MGI:1933111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52609 MGI:1196439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdgfb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18591 MGI:97528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27367 MGI:1351605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syngr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20972 MGI:1328323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Map3k7ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66513 MGI:1913763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgat3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17309 MGI:104532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666948 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666948 MGI:3644819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Smcr7l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239555 MGI:2146020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11911 MGI:88096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps19bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66538 MGI:1913788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna1i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239556 MGI:2178051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Enthd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383075 MGI:2686088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	Grap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17444 MGI:1333842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW544981 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213956 MGI:2146227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213988 MGI:2443730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Adsl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11564 MGI:103202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625672 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Rutbc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105835 MGI:1916329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mkl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223701 MGI:2384495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC675966 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Mchr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207911 MGI:2180756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20524 MGI:1342248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	St13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70356 MGI:1917606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpnpep3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321003 MGI:2445217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57755 MGI:1914012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56438 MGI:1891829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG383080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383080 MGI:3646583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 206 ESTs, 4 Proteins

name	Ep300 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328572 MGI:1276116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	L3mbtl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214669 MGI:2443584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rangap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19387 MGI:103071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20286 MGI:1328310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tef (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21685 MGI:98663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC667073 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 254 ESTs, 5 Proteins pseudo : _no_value

name	Tob2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57259 MGI:1888525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68479 MGI:2156864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aco2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11429 MGI:87880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr3h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78929 MGI:1926179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csdc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105859 MGI:2146027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pmm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29858 MGI:1353418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npcd (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:113374167 GeneID:504193
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal pentraxin with chromo domain transcript_id : NM_001013360.2

name	Npcd (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:113374170 GeneID:504193
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal pentraxin with chromo domain transcript_id : NM_001013362.2

name	Nptxr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133930790 GeneID:73340 MGI:1920590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuronal pentraxin receptor transcript_id : NM_030689.4

name	Cbx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61657983 GeneID:494448 MGI:3512628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 6 transcript_id : NM_028763.3

name	LOC100042748 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266750 GeneID:100042748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical protein LOC100042748 transcript_id : XM_001479562.1

name	Apobec3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861171 GeneID:80287 MGI:1933111
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein B editing complex 3 transcript_id : NM_030255.2

name	Cbx7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270984 GeneID:52609 MGI:1196439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 7 transcript_id : NM_144811.3

name	Pdgfb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118300 GeneID:18591 MGI:97528
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet derived growth factor, B polypeptide transcript_id : NM_011057.3

name	Rpl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305440 GeneID:27367 MGI:1351605
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L3 transcript_id : NM_013762.1

name	Syngr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877047 GeneID:20972 MGI:1328323
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 1 transcript_id : NM_207708.1

name	Syngr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877044 GeneID:20972 MGI:1328323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 1 transcript_id : NM_009303.2

name	Map3k7ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328267 GeneID:66513 MGI:1913763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase kinase kinase 7 interacting protein 1 transcript_id : NM_025609.2

name	Mgat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108796646 GeneID:17309 MGI:104532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannoside acetylglucosaminyltransferase 3 transcript_id : NM_010795.3

name	Smcr7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347394 GeneID:239555 MGI:2146020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Smith-Magenis syndrome chromosome region, candidate 7-like (human) transcript_id : NM_178719.4

name	Atf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949820 GeneID:11911 MGI:88096
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 4 transcript_id : NM_009716.2

name	Rps19bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909364 GeneID:66538 MGI:1913788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S19 binding protein 1 transcript_id : NM_175109.3

name	Cacna1i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195695 GeneID:239556 MGI:2178051
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, alpha 1I subunit transcript_id : NM_001044308.1

name	Enthd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398792 GeneID:383075 MGI:2686088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : ENTH domain containing 1 transcript_id : XM_356844.5

name	Grap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130168 GeneID:17444 MGI:1333842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRB2-related adaptor protein 2 transcript_id : NM_010815.2

name	AW544981 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122434 GeneID:213956 MGI:2146227
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW544981 transcript_id : NM_145986.1

name	Tnrc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67782331 GeneID:213988 MGI:2443730
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 6b transcript_id : NM_144812.2

name	Tnrc6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67782333 GeneID:213988 MGI:2443730
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 6b transcript_id : NM_177124.3

name	Adsl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365399 GeneID:11564 MGI:103202
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylosuccinate lyase 1 transcript_id : NM_009634.4

name	Rutbc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527317 GeneID:105835 MGI:1916329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and TBC1 domain containing 3 transcript_id : NM_134091.1

name	Mkl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139378 GeneID:223701 MGI:2384495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MKL (megakaryoblastic leukemia)/myocardin-like 1 transcript_id : NM_001082536.1

name	Mkl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127138893 GeneID:223701 MGI:2384495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MKL (megakaryoblastic leukemia)/myocardin-like 1 transcript_id : NM_153049.2

name	Mchr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553072 GeneID:207911 MGI:2180756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanin-concentrating hormone receptor 1 transcript_id : NM_145132.1

name	Slc25a17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374344 GeneID:20524 MGI:1342248
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17 transcript_id : NM_011399.2

name	St13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130905 GeneID:70356 MGI:1917606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppression of tumorigenicity 13 transcript_id : NM_133726.2

name	Xpnpep3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343310 GeneID:321003 MGI:2445217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-prolyl aminopeptidase (aminopeptidase P) 3, putative transcript_id : NM_177310.2

name	Dnajb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392095 GeneID:57755 MGI:1914012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 7 transcript_id : NM_021317.2

name	Rbx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181183 GeneID:56438 MGI:1891829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring-box 1 transcript_id : NM_019712.3

name	EG383080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266707 GeneID:383080 MGI:3646583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 206 ESTs, 4 Proteins product : predicted gene, EG383080 transcript_id : XM_356848.5

name	Ep300 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123173876 GeneID:328572 MGI:1276116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E1A binding protein p300 transcript_id : NM_177821.6

name	L3mbtl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803265 GeneID:214669 MGI:2443584
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : l(3)mbt-like 2 (Drosophila) transcript_id : NM_145993.3

name	Rangap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982567 GeneID:19387 MGI:103071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAN GTPase activating protein 1 transcript_id : NM_011241.3

name	Zc3h7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486615 GeneID:20286 MGI:1328310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 7B transcript_id : NM_001081016.1

name	Tef (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130107 GeneID:21685 MGI:98663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyrotroph embryonic factor transcript_id : NM_153484.2

name	Tef (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23821034 GeneID:21685 MGI:98663
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyrotroph embryonic factor transcript_id : NM_017376.2

name	Tob2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108796647 GeneID:57259 MGI:1888525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducer of ERBB2, 2 transcript_id : NM_020507.3

name	Phf5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802545 GeneID:68479 MGI:2156864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 5A transcript_id : NM_026737.3

name	Aco2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74024910 GeneID:11429 MGI:87880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aconitase 2, mitochondrial transcript_id : NM_080633.2

name	Polr3h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802407 GeneID:78929 MGI:1926179
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) III (DNA directed) polypeptide H transcript_id : NM_030229.3

name	Csdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802879 GeneID:105859 MGI:2146027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cold shock domain containing C2, RNA binding transcript_id : NM_145473.2

name	Pmm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368246 GeneID:29858 MGI:1353418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphomannomutase 1 transcript_id : NM_013872.2

name	Npcd (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:113374168 CCDS:CCDS27651.1 GeneID:504193
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : neuronal pentraxin with chromo domain isoform 1 protein_id : NP_001013378.2

name	Npcd (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:113374171 CCDS:CCDS27652.1 GeneID:504193
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : neuronal pentraxin with chromo domain isoform 2 protein_id : NP_001013380.2

name	Nptxr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:36054013 CCDS:CCDS27653.1 GeneID:73340 MGI:1920590
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : alternative start codon note : non-AUG (CUG) translation initiation codon product : neuronal pentraxin receptor protein_id : NP_109614.2 transl_except : (pos:complement(79635011..79635013),aa:Met)

name	Cbx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657984 GeneID:494448 MGI:3512628
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : chromobox homolog 6 protein_id : NP_083039.2

name	LOC100042748 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266751 GeneID:100042748
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479612.1

name	Apobec3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861172 CCDS:CCDS27654.1 GeneID:80287 MGI:1933111
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016814 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : apolipoprotein B editing complex 3 protein_id : NP_084531.2

name	Cbx7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450179 GeneID:52609 MGI:1196439
definition	GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : chromobox 7 protein_id : NP_659060.1

name	Pdgfb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538817 CCDS:CCDS27656.1 GeneID:18591 MGI:97528
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0030031 - cell projection biogenesis [Evidence IDA]; GO:0008283 - cell proliferation [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0050730 - regulation of peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006929 - substrate-bound cell migration [Evidence IDA] codon_start : 1 product : platelet derived growth factor, B polypeptide protein_id : NP_035187.2

name	Rpl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305441 GeneID:27367 MGI:1351605
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : snoRNA MBII-10; snoRNA MBII-47; ribosomal protein L3 homolog product : ribosomal protein L3 protein_id : NP_038790.1

name	Syngr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877048 CCDS:CCDS27657.1 GeneID:20972 MGI:1328323
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence ISS] GO_process : GO:0006605 - protein targeting [Evidence ISS] codon_start : 1 note : isoform 1a is encoded by transcript variant 1a product : synaptogyrin 1 isoform 1a protein_id : NP_997591.1

name	Syngr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678193 CCDS:CCDS27658.1 GeneID:20972 MGI:1328323
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence ISS] GO_process : GO:0006605 - protein targeting [Evidence ISS] codon_start : 1 note : isoform 1b is encoded by transcript variant 1b product : synaptogyrin 1 isoform 1b protein_id : NP_033329.1

name	Map3k7ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328268 CCDS:CCDS27659.1 GeneID:66513 MGI:1913763
definition	codon_start : 1 note : Tak1-binding protein 1; beta activated kinase-1 binding protein-1 product : mitogen-activated protein kinase kinase kinase 7 interacting protein 1 protein_id : NP_079885.2

name	Mgat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33695150 CCDS:CCDS27660.1 GeneID:17309 MGI:104532
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003830 - beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006487 - protein amino acid N-linked glycosylation [Evidence IEA] codon_start : 1 note : mannoside acetyl glucosaminyl transferase 3; mannoside acetyl glucosaminyltransferase 3 product : mannoside acetylglucosaminyltransferase 3 protein_id : NP_034925.2

name	Smcr7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982319 CCDS:CCDS27661.1 GeneID:239555 MGI:2146020
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC239555 protein_id : NP_848834.2

name	Atf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949821 GeneID:11911 MGI:88096
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003704 - specific RNA polymerase II transcription factor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006094 - gluconeogenesis [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : activating transcription factor 4 protein_id : NP_033846.2

name	Rps19bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424711 CCDS:CCDS27662.1 GeneID:66538 MGI:1913788
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : S19 binding protein protein_id : NP_780318.1

name	Cacna1i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195696 GeneID:239556 MGI:2178051
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008332 - low voltage-gated calcium channel activity [Evidence ISS] GO_process : GO:0006816 - calcium ion transport [Evidence ISS]; GO:0042391 - regulation of membrane potential [Evidence ISS] codon_start : 1 exception : mismatches in translation note : low voltage-activated T-type calcium channel alpha-1 subunit (CACNA1I); low-voltage-activated calcium channel alpha13.3 product : calcium channel, voltage-dependent, alpha 1I subunit protein_id : NP_001037773.1

name	Enthd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398793 GeneID:383075 MGI:2686088
definition	codon_start : 1 product : similar to ENTH domain containing 1 protein_id : XP_356844.5

name	Grap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754722 CCDS:CCDS27663.1 GeneID:17444 MGI:1333842
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : Grb2-related adaptor downstream of Sch; monocytic adapter; monocytic adaptor product : GRB2-related adaptor protein 2 protein_id : NP_034945.1

name	AW544981 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122435 GeneID:213956 MGI:2146227
definition	codon_start : 1 product : hypothetical protein LOC213956 protein_id : NP_666098.1

name	Tnrc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67782332 GeneID:213988 MGI:2443730
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : trinucleotide repeat containing 6b isoform 1 protein_id : NP_659061.2

name	Tnrc6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67782334 GeneID:213988 MGI:2443730
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : trinucleotide repeat containing 6b isoform 2 protein_id : NP_796098.2

name	Adsl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29788764 CCDS:CCDS27664.1 GeneID:11564 MGI:103202
definition	GO_function : GO:0004018 - adenylosuccinate lyase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0006164 - purine nucleotide biosynthesis [Evidence IEA]; GO:0009152 - purine ribonucleotide biosynthesis [Evidence IEA] codon_start : 1 product : adenylosuccinate lyase protein_id : NP_033764.2

name	Rutbc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527318 GeneID:105835 MGI:1916329
definition	GO_component : GO:0005921 - gap junction [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005083 - small GTPase regulator activity [Evidence NAS] GO_process : GO:0045732 - positive regulation of protein catabolism [Evidence IDA] codon_start : 1 note : Cx43-interacting protein of 85-kDa product : RUN and TBC1 domain containing 3 protein_id : NP_598852.1

name	Mkl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127138894 GeneID:223701 MGI:2384495
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; myocardin-related transcription factor A; basic SAP and coiled-coil domains; megakaryoblastic leukemia (translocation) 1 homolog product : megakaryoblastic leukemia (translocation) 1 isoform 1 protein_id : NP_694629.2

name	Mkl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139379 GeneID:223701 MGI:2384495
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; myocardin-related transcription factor A; basic SAP and coiled-coil domains; megakaryoblastic leukemia (translocation) 1 homolog product : megakaryoblastic leukemia (translocation) 1 isoform 2 protein_id : NP_001076005.1

name	Mchr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553073 GeneID:207911 MGI:2180756
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0030273 - melanin-concentrating hormone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Gpr24-9 protein coupled receptor product : G protein coupled receptor 24 protein_id : NP_660114.1

name	Slc25a17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789024 CCDS:CCDS27666.1 GeneID:20524 MGI:1342248
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005778 - peroxisomal membrane [Evidence IDA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : peroxisomal integral membrane protein 47; solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34 kDa), member 17 product : solute carrier family 25 (mitochondrial carrier, peroxisomal membrane protein), member 17 protein_id : NP_035529.1

name	St13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526912 CCDS:CCDS27667.1 GeneID:70356 MGI:1917606
definition	GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : Hsp70 interacting protein product : suppression of tumorigenicity 13 protein_id : NP_598487.1

name	Xpnpep3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893421 CCDS:CCDS27668.1 GeneID:321003 MGI:2445217
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008235 - metalloexopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : X-prolyl aminopeptidase (aminopeptidase P) 3, putative protein_id : NP_796284.1

name	Dnajb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392096 GeneID:57755 MGI:1914012
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : dnaJ-like 5 product : DnaJ (Hsp40) homolog, subfamily B, member 7 protein_id : NP_067292.2

name	Rbx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790191 GeneID:56438 MGI:1891829
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA]; GO:0019005 - SCF ubiquitin ligase complex [Evidence ISS]; GO:0008023 - transcription elongation factor complex [Evidence NR]; GO:0000151 - ubiquitin ligase complex [Evidence TAS] GO_function : GO:0008190 - eukaryotic initiation factor 4E binding [Evidence TAS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IMP]; GO:0016567 - protein ubiquitination [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence TAS] codon_start : 1 note : ring-box protein 1 product : ring-box 1 protein_id : NP_062686.1

name	EG383080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266708 GeneID:383080 MGI:3646583
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_356848.5

name	Ep300 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94421034 GeneID:328572 MGI:1276116
definition	GO_component : GO:0000123 - histone acetyltransferase complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004402 - histone acetyltransferase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0001756 - somitogenesis [Evidence IGI]; GO:0007519 - striated muscle development [Evidence IMP] codon_start : 1 product : E1A binding protein p300 protein_id : NP_808489.4

name	L3mbtl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981870 CCDS:CCDS27669.1 GeneID:214669 MGI:2443584
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : l(3)mbt-like 2 protein_id : NP_666105.2

name	Rangap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982568 CCDS:CCDS27670.1 GeneID:19387 MGI:103071
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAN GTPase activating protein 1 protein_id : NP_035371.3

name	Zc3h7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486616 GeneID:20286 MGI:1328310
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : scrapie responsive gene 3; zinc finger CCCH-type containing 7B product : ubiquitous tetratricopeptide containing protein RoXaN protein_id : NP_001074485.1

name	Tef (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23821038 CCDS:CCDS27671.1 GeneID:21685 MGI:98663
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003690 - double-stranded DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : thyrotroph embryonic factor isoform 2 protein_id : NP_705617.1

name	Tef (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394435 CCDS:CCDS27672.1 GeneID:21685 MGI:98663
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003690 - double-stranded DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : thyrotroph embryonic factor isoform 1 protein_id : NP_059072.1

name	Tob2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048440 CCDS:CCDS27673.1 GeneID:57259 MGI:1888525
definition	codon_start : 1 product : transducer of ERBB2, 2 protein_id : NP_065253.1

name	Phf5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24415990 CCDS:CCDS27674.1 GeneID:68479 MGI:2156864
definition	GO_component : GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005686 - snRNP U2 [Evidence ISS]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] [Evidence ISS]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : PHD-finger 5A protein_id : NP_081013.1

name	Aco2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079339 CCDS:CCDS27675.1 GeneID:11429 MGI:87880
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0003994 - aconitate hydratase activity [Evidence IDA]; GO:0005506 - iron ion binding [Evidence IEA] [Evidence ISS]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006101 - citrate metabolism [Evidence ISS]; GO:0006099 - tricarboxylic acid cycle [Evidence ISS] [Evidence IEA] codon_start : 1 product : aconitase 2, mitochondrial protein_id : NP_542364.1

name	Polr3h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229271 CCDS:CCDS27676.1 GeneID:78929 MGI:1926179
definition	GO_component : GO:0005666 - DNA-directed RNA polymerase III complex [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA] [Evidence ISS]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA]; GO:0006383 - transcription from RNA polymerase III promoter [Evidence ISS] codon_start : 1 product : polymerase (RNA) III (DNA directed) polypeptide H protein_id : NP_084505.2

name	Csdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703934 CCDS:CCDS27677.1 GeneID:105859 MGI:2146027
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RNA-binding protein pippin protein_id : NP_663448.1

name	Pmm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468959 CCDS:CCDS27678.1 GeneID:29858 MGI:1353418
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0004615 - phosphomannomutase activity [Evidence IEA] GO_process : GO:0019307 - mannose biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : phosphomannomutase Sec53p homolog mRNA; Secp53 (yeast) homolog product : phosphomannomutase 1 protein_id : NP_038900.1

name	LOC625672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625672
definition	number : 1 pseudo : _no_value

name	LOC675966 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675966
definition	number : 1 pseudo : _no_value

name	EG666948 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149266705 GeneID:666948 MGI:3644819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG666948 pseudo : _no_value transcript_id : XR_001947.2

name	LOC667073 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266758 GeneID:667073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 254 ESTs, 5 Proteins product : similar to ribosomal protein L35 pseudo : _no_value transcript_id : XR_034374.1

clone name	MSMg01-280L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501P01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-525D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274J01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-364H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-466N20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-045H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-548C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426L01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119D07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135G18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-227E06.b	B6Ng01-227E06.g
ACC	GA040980	GA040981
length	1,190	893
definition	B6Ng01-227E06.b	B6Ng01-227E06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(80,784,317 - 80,785,504)	(80,634,982 - 80,635,869)
sequence	gaattccacccccagtgccacattaacttggaatggtagctaacacctcc aacaccagcactttagaagcagaggcaggaggatcaagaattcaaggtca ttcttgcccacagagcatgctcaagctaaggactagaatcagctacagga gaggctgttagggagcggggacaacttacagagcaggaggacaggacact ggattactgggatccataaggaacaatacctttattgttcacagtgtggt ggctacactgactgagaacttgtgtaagtccatgggcttttacatttctt acatggcacattccatcagtagtctctacttttcctcatccaacatccat ccatccatccatccatccatccatccatccattgtattttctccctgaac atttatataagcaatttatctctggctgttatggaacttagtatgtagac caggctggctttgtcctcacagagatctgagcccctgcctcccaacttcc aggacccttgccccatcatctatccttgatagcacaggaaggcatgatct agaacatcagagtttaagaaacgtaaaacttcgatttcttttacccccag tcctgaggataaaatctagagcctcatgcatacaaagatctaccactgag ttggatcctcaagccttcaagctgctccgtggaaggcaaggggaagtatt tgggctaactccaaaacatgtccctgtgccacaaaatcatggagacacgg catcactgggaacttttagagaaagattctgagccagcgagatggcttat ctggtaaaggtgtttgctgccacgcctgccaacctgagctgcagctctaa gacttacatggtgggagagaactaactgcctcaccttgtcctctgatctc cacactcataccatggtgcacacgttctaccccctactaagtaaatgtca tttaaagaattttgcaagtaaggagattattcctcccacgtctaaccaat cacacacaggaaacggaccgcagtgccacacacccgtactcatcactcag tggctgagcaggagggcagcctggagctctcagctaagacccgtctaggc aacacaaacagtgttctgggaccctgtcgaaaaaggaaaagcagagctgg gccggtggggggcgccaggccctttactcagcactcagga	gaattcatatctggtcctgtaaacttggtcaaaggaatgtggttgggaac gtcatagtcactgctgttgcttgctaaatggacgtggtgtgcctgtcaac ctgccttccagtggctgtgctcatgcttatagatagacgagtgctgccat cagctgtgggcagagaacctgctttcttacagtggtctgtagtgattgca gagactggccaaagtactgagaataagtgactattgaatgcagagacatg aatgggaatctgcatctccccctgccccccctaaagtttaggaagcctct tggaaaagggggcataagaacataagagctggaggaagcaaaagggggtg tggatgtaaggcttctgggaatgctatggctgtctacctgttgaactcac cgaggctatgggcatctgcttccccatacaggctttgatctgagctcttc ttggcataggactgggagaggcttttcagggcaccacccttccctgaaga cttatgtacatatcctctctctctccctccctctctctctctctctctct ctctctgtgtgtgtgtgtgtgagagagagagccccactggtaagctcctg taaatctctatacacatgttcctgtgagaaatccaagtaaaattcattgg ttctcagagcagaacagctcatgaaaatagatagagagatagttgggaag aggaagggaattatatctggagcaagatgagagggtggtgaatatggtta gaatacatcgtgaacatgtatgaaacccattagtaaacatataacagtat ggggtttttttggtttttttttatatatatatatattttattacgtattt tcctcaaattacattttccaatggctatcccaaaaattccccc
quality values	Open. Hide. 62 31 23 33 62 62 37 10 62 62 62 62 47 31 62 62 62 62 44 32 62 47 62 59 62 62 62 62 62 62 62 59 56 46 49 29 51 46 28 33 43 56 62 62 62 62 62 62 62 59 49 62 59 62 62 59 59 62 59 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 54 59 62 59 62 62 62 62 59 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 46 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 54 58 58 58 58 58 58 58 52 58 58 58 54 54 58 54 58 58 54 54 58 58 58 58 58 54 49 58 52 58 58 58 54 58 58 58 54 54 47 58 58 58 58 58 58 47 42 48 58 58 58 58 54 58 54 58 58 58 58 42 22 58 41 35 58 58 58 58 48 58 58 58 51 58 53 58 51 54 53 49 54 58 49 50 58 52 58 50 58 51 51 42 41 58 58 50 51 45 49 46 51 46 42 31 58 58 58 44 49 40 53 58 54 53 52 51 53 58 58 48 51 52 53 58 50 58 58 51 52 54 53 51 52 50 58 52 51 44 13 38 16 49 42 42 58 58 51 58 54 38 53 39 50 58 53 51 58 50 39 39 54 40 39 53 50 41 38 58 58 50 50 39 51 58 51 40 54 50 50 51 53 52 32 41 32 52 39 58 58 33 39 53 37 49 54 50 51 30 37 37 32 32 47 49 30 32 49 37 32 45 45 33 54 44 39 44 29 33 49 54 49 35 26 39 27 47 54 32 35 28 14 42 45 42 40 51 13 51 44 28 26 38 36 34 37 39 32 52 46 30 45 39 38 38 34 42 38 47 13 32 54 46 17 51 27 51 26 53 34 36 35 45 45 28 47 26 34 29 53 41 25 32 33 32 31 33 31 40 32 35 33 13 41 32 45 31 32 23 32 31 28 42 31 44 19 30 15 45 43 32 31 23 30 31 48 20 31 46 8 38 11 46 33 42 43 32 34 25 32 28 31 42 30 30 37 39 31 28 19 33 24 37 31 30 30 31 32 30 31 30 26 31 31 27 32 31 32 36 31 32 30 24 34 32 31 18 26 29 35 34 21 31 29 32 31 24 30 31 33 31 31 27 31 29 46 46 46 44 21 32 32 27 30 31 27 15 25 47 27 31 36 27 32 21 13 37 20 31 47 31 25 31 25 21 46 46 37 34 32 34 31 32 33 25 10 17 5 9 21 38 25 20 29 27 24 7 5 16 6 48 31 17 31 32 31 30 35 33 20 18 31 6 30 30 20 20 27 26 23 19 27 13 21 11 30 43 23 13 17 14 34 32 19 18 25 25 10 16 30 7 5 5 4 4 4 8 13 31 26 11 19 31 32 32 19 30 8 22 21 28 34 27 10 34 9 8 26 4 18 22 14 5 12 15 18 7 25 6 33 16 7 26 17 13 14 13 16 9 15 5 15 13 5 20 30 18 24 24 7 4 5 4 6 7 28 18 19 7 8 15 27 13 25 15 17 7 7 5 6 9 27 11 24 10 4 4 17 12 10 28 14 28 15 11 22 10 22 11 6 6 5 5 5 24 30 28 28 17 4 7 23 26 30 19 6 9 6 5 14 4 5 9 18 26 7 6 5 14 18 5 22 28 28 29 29 14 5 3 3 6 7 14 16 6 13 6 9 18 9 5 1 5 15 5 8 7 5 4 2 2 4 4 5 6	Open. Hide. 62 38 56 42 62 47 39 62 62 62 56 42 50 24 21 36 38 30 38 29 45 56 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 39 51 59 50 59 59 62 56 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 54 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 42 62 56 62 62 62 62 56 62 62 62 62 33 46 62 62 62 62 62 62 54 62 49 52 62 62 52 62 62 52 42 43 62 52 62 54 62 54 62 62 62 54 62 62 62 58 54 58 58 39 58 58 48 46 58 41 52 58 52 54 47 58 58 54 52 58 42 52 46 58 58 31 41 58 52 58 58 54 23 58 33 58 58 35 58 38 52 42 46 54 58 52 52 52 49 36 42 58 52 52 41 39 52 52 42 52 58 52 52 42 45 46 54 52 52 58 35 58 31 41 49 37 54 19 47 51 50 29 58 33 45 13 24 46 46 39 50 53 53 41 58 48 50 29 47 32 51 40 38 21 50 51 50 58 37 31 18 35 54 58 42 53 58 50 30 53 40 51 47 32 42 50 17 16 49 39 32 46 28 53 53 40 31 58 46 39 39 16 50 53 52 32 34 33 58 50 49 24 58 51 35 32 26 39 33 40 32 52 41 50 32 31 32 39 51 41 35 27 17 24 39 42 47 58 58 38 28 51 54 51 54 51 17 54 36 28 54 52 53 52 53 38 40 9 7 10 34 16 36 25 28 31 39 17 19 26 44 36 30 21 25 14 17 23 29 16 6 13 23 28 30 30 30 35 16 28 14 7 30 6 27 21 16 20 13 29 29 21 26 21 46 26 21 16 33 29 28 17 37 31 32 32 32 29 26 24 11 15 9 10 13 9 17 11 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_80784317_80785504
seq2: B6Ng01-227E06.b_46_1235 (reverse)

seq1  TCCTGAGTGCTGGAGTTAAAGGCCT-GCG-CCCCCACC-GCCCAGCTCTG  47
      ||||||||||| |||| || ||||| ||| |||||||| |||||||||| 
seq2  TCCTGAGTGCT-GAGTAAAGGGCCTGGCGCCCCCCACCGGCCCAGCTCT-  48

seq1  GCTTTTCTTTTTTCGACAGGGTCCCAGGACACTG-TTGTGTTGCCTAGAC  96
      ||||||| ||||||||||||||||||| |||||| |||||||||||||||
seq2  GCTTTTCCTTTTTCGACAGGGTCCCAGAACACTGTTTGTGTTGCCTAGAC  98

seq1  GGGTCTGTAGCTGGAGAGCT-CAGGCTGCCTTCCTGCTCAGCCACCTGAG  145
      |||||| ||||| ||||||| ||||||||| ||||||||||||| |||||
seq2  GGGTCT-TAGCT-GAGAGCTCCAGGCTGCCCTCCTGCTCAGCCA-CTGAG  145

seq1  TGATTGAGTACGGGTGTGTGCCACTGCGGTCCGTTTCCTGTGTGTGATTG  195
      ||| |||||||||||||||| |||||||||||||||||||||||||||||
seq2  TGA-TGAGTACGGGTGTGTGGCACTGCGGTCCGTTTCCTGTGTGTGATTG  194

seq1  GTTAGACGTGGGA-GAATAATCTCCTTACTTGCAAAATTCTTT-AATGAC  243
      ||||||||||||| ||||||||||||||||||||||||||||| ||||||
seq2  GTTAGACGTGGGAGGAATAATCTCCTTACTTGCAAAATTCTTTAAATGAC  244

seq1  ATTTACTTAGTAGGGGGTAGAACGTGTGCACCATGGTATGAGTGTGGAGA  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTACTTAGTAGGGGGTAGAACGTGTGCACCATGGTATGAGTGTGGAGA  294

seq1  TCAGAGGACAAGGTGAGGCAGTTAGTTCTCT-CCACCATGTAAGTCTTAG  342
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  TCAGAGGACAAGGTGAGGCAGTTAGTTCTCTCCCACCATGTAAGTCTTAG  344

seq1  AGCTGCAGCTCAGGTTGGCAGGCGTGGCAGCAAACACCTTTACCAGATAA  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGCAGCTCAGGTTGGCAGGCGTGGCAGCAAACACCTTTACCAGATAA  394

seq1  GCCATCTCGCTGGCTCAGAATCTTTCTCTAAAAGTTCCCAGTGATGCCGT  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATCTCGCTGGCTCAGAATCTTTCTCTAAAAGTTCCCAGTGATGCCGT  444

seq1  GTCTCCATGATTTTGTGGCACAGGGACATGTTTTGGAGTTAGCCCAAATA  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCCATGATTTTGTGGCACAGGGACATGTTTTGGAGTTAGCCCAAATA  494

seq1  CTTCCCCTTGCCTTCCACGGAGCAGCTTGAAGGCTTGAGGATCCAACTCA  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCCCTTGCCTTCCACGGAGCAGCTTGAAGGCTTGAGGATCCAACTCA  544

seq1  GTGGTAGATCTTTGTATGCATGAGGCTCTAGATTTTATCCTCAGGACTGG  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTAGATCTTTGTATGCATGAGGCTCTAGATTTTATCCTCAGGACTGG  594

seq1  GGGTAAAAGAAATCGAAGTTTTACGTTTCTTAAACTCTGATGTTCTAGAT  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTAAAAGAAATCGAAGTTTTACGTTTCTTAAACTCTGATGTTCTAGAT  644

seq1  CATGCCTTCCTGTGCTATCAAGGATAGATGATGGGGCAAGGGTCCTGGAA  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCCTTCCTGTGCTATCAAGGATAGATGATGGGGCAAGGGTCCTGGAA  694

seq1  GTTGGGAGGCAGGGGCTCAGATCTCTGTGAGGACAAAGCCAGCCTGGTCT  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGGAGGCAGGGGCTCAGATCTCTGTGAGGACAAAGCCAGCCTGGTCT  744

seq1  ACATACTAAGTTCCATAACAGCCAGAGATAAATTGCTTATATAAATGTTC  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATACTAAGTTCCATAACAGCCAGAGATAAATTGCTTATATAAATGTTC  794

seq1  AGGGAGAAAATACAATGGATGGATGGATGGATGGATGGATGGATGGATGG  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAGAAAATACAATGGATGGATGGATGGATGGATGGATGGATGGATGG  844

seq1  ATGTTGGATGAGGAAAAGTAGAGACTACTGATGGAATGTGCCATGTAAGA  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTGGATGAGGAAAAGTAGAGACTACTGATGGAATGTGCCATGTAAGA  894

seq1  AATGTAAAAGCCCATGGACTTACACAAGTTCTCAGTCAGTGTAGCCACCA  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTAAAAGCCCATGGACTTACACAAGTTCTCAGTCAGTGTAGCCACCA  944

seq1  CACTGTGAACAATAAAGGTATTGTTCCTTATGGATCCCAGTAATCCAGTG  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGTGAACAATAAAGGTATTGTTCCTTATGGATCCCAGTAATCCAGTG  994

seq1  TCCTGTCCTCCTGCTCTGTAAGTTGTCCCCGCTCCCTAACAGCCTCTCCT  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGTCCTCCTGCTCTGTAAGTTGTCCCCGCTCCCTAACAGCCTCTCCT  1044

seq1  GTAGCTGATTCTAGTCCTTAGCTTGAGCATGCTCTGTGGGCAAGAATGAC  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGCTGATTCTAGTCCTTAGCTTGAGCATGCTCTGTGGGCAAGAATGAC  1094

seq1  CTTGAATTCTTGATCCTCCTGCCTCTGCTTCTAAAGTGCTGGTGTTGGAG  1142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAATTCTTGATCCTCCTGCCTCTGCTTCTAAAGTGCTGGTGTTGGAG  1144

seq1  GTGTTAGCTACCATTCCAAGTTAATGTGGCACTGGGGGTGGAATTC  1188
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTAGCTACCATTCCAAGTTAATGTGGCACTGGGGGTGGAATTC  1190

seq1: chr15_80634982_80635869
seq2: B6Ng01-227E06.g_69_960

seq1  GAATTCATATCTGGTCCTGTAAACTTGGTCAAAGGAATGTGGTTGGGAAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATATCTGGTCCTGTAAACTTGGTCAAAGGAATGTGGTTGGGAAC  50

seq1  GTCATAGTCACTGCTGTTGCTTGCTAAATGGACGTGGTGTGCCTGTCAAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATAGTCACTGCTGTTGCTTGCTAAATGGACGTGGTGTGCCTGTCAAC  100

seq1  CTGCCTTCCAGTGGCTGTGCTCATGCTTATAGATAGACGAGTGCTGCCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCTTCCAGTGGCTGTGCTCATGCTTATAGATAGACGAGTGCTGCCAT  150

seq1  CAGCTGTGGGCAGAGAACCTGCTTTCTTACAGTGGTCTGTAGTGATTGCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTGTGGGCAGAGAACCTGCTTTCTTACAGTGGTCTGTAGTGATTGCA  200

seq1  GAGACTGGCCAAAGTACTGAGAATAAGTGACTATTGAATGCAGAGACATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACTGGCCAAAGTACTGAGAATAAGTGACTATTGAATGCAGAGACATG  250

seq1  AATGGGAATCTGCATCTCCCCCTGCCCCCCCTAAAGTTTAGGAAGCCTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGGAATCTGCATCTCCCCCTGCCCCCCCTAAAGTTTAGGAAGCCTCT  300

seq1  TGGAAAAGGGGGCATAAGAACATAAGAGCTGGAGGAAGCAAAAGGGGGTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAAAGGGGGCATAAGAACATAAGAGCTGGAGGAAGCAAAAGGGGGTG  350

seq1  TGGATGTAAGGCTTCTGGGAATGCTATGGCTGTCTACCTGTTGAACTCAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATGTAAGGCTTCTGGGAATGCTATGGCTGTCTACCTGTTGAACTCAC  400

seq1  CGAGGCTATGGGCATCTGCTTCCCCATACAGGCTTTGATCTGAGCTCTTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGGCTATGGGCATCTGCTTCCCCATACAGGCTTTGATCTGAGCTCTTC  450

seq1  TTGGCATAGGACTGGGAGAGGCTTTTCAGGGCACCACCCTTCCCTGAAGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCATAGGACTGGGAGAGGCTTTTCAGGGCACCACCCTTCCCTGAAGA  500

seq1  CTTATGTACATATCCTCTCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTATGTACATATCCTCTCTCTCTCCCTCCCTCTCTCTCTCTCTCTCTCT  550

seq1  CTCTCTGTGTGTGTGTGTGTGAGAGAGAGAGCCCCACTGGTAAGCTCCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCTGTGTGTGTGTGTGTGAGAGAGAGAGCCCCACTGGTAAGCTCCTG  600

seq1  TAAATCTCTATACACATGTTCCTGTGAGAAATCCAAGTAAAATTCATTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATCTCTATACACATGTTCCTGTGAGAAATCCAAGTAAAATTCATTGG  650

seq1  TTCTCAGAGCAGAACAGCTCATGAAAATAGATAGAGAGATAGTTGGGAAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCAGAGCAGAACAGCTCATGAAAATAGATAGAGAGATAGTTGGGAAG  700

seq1  AGGAAGGGAATTATATCTGGAGCAAGATGAGAGGGTGGTGAATATGGTTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGGGAATTATATCTGGAGCAAGATGAGAGGGTGGTGAATATGGTTA  750

seq1  GAATACATCGTGAACATGTATGAAACCCATTAGTAAACATATAACAGTAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATACATCGTGAACATGTATGAAACCCATTAGTAAACATATAACAGTAT  800

seq1  GGGG-TTTTTTGGTTTTTTTTTATATATATATATATTTTTATTACGTATT  849
      |||| |||||||||||||||||||||||||||||| ||||||||||||||
seq2  GGGGTTTTTTTGGTTTTTTTTTATATATATATATA-TTTTATTACGTATT  849

seq1  TTCCTC-AATTACA-TTTCCAAT-GCTATCCCAAAAGTCCCC-  888
      |||||| ||||||| |||||||| |||||||||||| | ||| 
seq2  TTCCTCAAATTACATTTTCCAATGGCTATCCCAAAAATTCCCC  892

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information