MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-238A13
Chromosome	15 (Build37)
Map Location	57,947,679 - 58,097,129
singlet/doublet	doublet
Overlap gene	Atad2, LOC665244, 2410187C16Rik, Fbxo32
Upstream gene	BC026439, Zhx2, Derl1, Wdr67, BC030396, 9130401M01Rik, Zhx1
Downstream gene	8230402K04Rik, Anxa13, LOC100040231, D15Ertd621e, EG631797, Tmem65, EG546638, Trmt12, Rnf139, Tatdn1, Ndufb9, Mtss1, LOC100040330, EG268809, LOC665565
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC026439 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210463 MGI:2446114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zhx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387609 MGI:2683087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Derl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67819 MGI:1915069
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr67 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210544 MGI:2684931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC030396 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239463 MGI:2447773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130401M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75758 MGI:1923008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zhx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22770 MGI:109271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Atad2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70472 MGI:1917722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	2410187C16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76773 MGI:1924023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67731 MGI:1914981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	8230402K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268807 MGI:3045310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anxa13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69787 MGI:1917037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040231 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	D15Ertd621e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210998 MGI:1277178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG631797 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631797 MGI:3645398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins

name	Tmem65 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74868 MGI:1922118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546638 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546638 MGI:3644823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Trmt12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68260 MGI:1915510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75841 MGI:1923091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tatdn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69694 MGI:1916944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66218 MGI:1913468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211401 MGI:2384818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040330 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG268809 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268809 MGI:3647181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 1535 ESTs, 14 Proteins

name	LOC665565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 2 Proteins

name	BC026439 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385177 GeneID:210463 MGI:2446114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC026439 transcript_id : NM_172378.2

name	Zhx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326467 GeneID:387609 MGI:2683087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc fingers and homeoboxes protein 2 transcript_id : NM_199449.2

name	Derl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802828 GeneID:67819 MGI:1915069
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Der1-like domain family, member 1 transcript_id : NM_024207.3

name	Wdr67 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487108 GeneID:210544 MGI:2684931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 67 transcript_id : NM_001081396.1

name	BC030396 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239367 GeneID:239463 MGI:2447773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC030396 transcript_id : NM_173862.1

name	9130401M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803145 GeneID:75758 MGI:1923008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130401M01 gene transcript_id : NM_029418.3

name	Zhx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109627661 GeneID:22770 MGI:109271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc fingers and homeoboxes protein 1 transcript_id : NM_009572.3

name	Zhx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109627662 GeneID:22770 MGI:109271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc fingers and homeoboxes protein 1 transcript_id : NM_001042438.1

name	Atad2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91199556 GeneID:70472 MGI:1917722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase family, AAA domain containing 2 transcript_id : NM_027435.2

name	2410187C16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037458 GeneID:76773 MGI:1924023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410187C16 gene transcript_id : NM_029734.1

name	Fbxo32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385847 GeneID:67731 MGI:1914981
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 32 transcript_id : NM_026346.1

name	8230402K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364546 GeneID:268807 MGI:3045310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8230402K04 gene transcript_id : NM_177755.3

name	Anxa13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956195 GeneID:69787 MGI:1917037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A13 transcript_id : NM_027211.1

name	LOC100040231 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266605 GeneID:100040231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040231 transcript_id : XM_001474785.1

name	D15Ertd621e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112817621 GeneID:210998 MGI:1277178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 15, ERATO Doi 621, expressed transcript_id : NM_145959.2

name	EG631797 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398665 GeneID:631797 MGI:3645398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins product : predicted gene, EG631797 transcript_id : XM_977315.1

name	Tmem65 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360291 GeneID:74868 MGI:1922118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 65 transcript_id : NM_175212.4

name	EG546638 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266602 GeneID:546638 MGI:3644823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG546638 transcript_id : XM_621400.4

name	Trmt12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118150644 GeneID:68260 MGI:1915510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tRNA methyltranferase 12 homolog (S. cerevisiae) transcript_id : NM_026642.2

name	Rnf139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377504 GeneID:75841 MGI:1923091
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 139 transcript_id : NM_175226.3

name	Tatdn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801775 GeneID:69694 MGI:1916944
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TatD DNase domain containing 1 transcript_id : NM_175151.3

name	Ndufb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349573 GeneID:66218 MGI:1913468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 transcript_id : NM_023172.3

name	Mtss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450158 GeneID:211401 MGI:2384818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metastasis suppressor 1 transcript_id : NM_144800.1

name	LOC100040330 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266611 GeneID:100040330
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to Ubtf protein transcript_id : XM_001475007.1

name	EG268809 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398661 GeneID:268809 MGI:3647181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 608 ESTs, 9 Proteins product : predicted gene, EG268809, transcript variant 2 transcript_id : XM_897218.2

name	LOC665565 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266613 GeneID:665565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 2 Proteins product : similar to Ribosomal protein L17 transcript_id : XM_001475049.1

name	BC026439 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369501 CCDS:CCDS27481.1 GeneID:210463 MGI:2446114
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC210463 protein_id : NP_759010.1

name	Zhx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789094 CCDS:CCDS27483.1 GeneID:387609 MGI:2683087
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006402 - mRNA catabolism [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : alpha fetoprotein regulation 1, adult product : zinc fingers and homeoboxes protein 2 protein_id : NP_955520.1

name	Derl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195638 CCDS:CCDS27484.1 GeneID:67819 MGI:1915069
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence ISS]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0042288 - MHC class I protein binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence ISS] GO_process : GO:0030433 - ER-associated protein catabolism [Evidence ISS]; GO:0019060 - intracellular transport of viral proteins in host cell [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0030970 - retrograde protein transport, ER to cytosol [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0030968 - unfolded protein response [Evidence ISS] codon_start : 1 product : Der1-like domain family, member 1 protein_id : NP_077169.1

name	Wdr67 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487109 GeneID:210544 MGI:2684931
definition	codon_start : 1 product : WD repeat domain 67 protein_id : NP_001074865.1

name	BC030396 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239368 CCDS:CCDS27486.1 GeneID:239463 MGI:2447773
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC239463 protein_id : NP_776287.1

name	9130401M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313070 GeneID:75758 MGI:1923008
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC75758 protein_id : NP_083694.1

name	Zhx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109627663 GeneID:22770 MGI:109271
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger and homeodomain protein 1 protein_id : NP_001035903.1

name	Zhx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328156 CCDS:CCDS27488.1 GeneID:22770 MGI:109271
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger and homeodomain protein 1 protein_id : NP_033598.2

name	Atad2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91199557 GeneID:70472 MGI:1917722
definition	GO_function : GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : ATPase family, AAA domain containing 2 protein_id : NP_081711.2

name	2410187C16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037459 CCDS:CCDS27490.1 GeneID:76773 MGI:1924023
definition	codon_start : 1 product : hypothetical protein LOC76773 protein_id : NP_084010.1

name	Fbxo32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385848 CCDS:CCDS27491.1 GeneID:67731 MGI:1914981
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : muscle atrophy F-box protein; atrogin 1 product : F-box only protein 32 protein_id : NP_080622.1

name	8230402K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244256 CCDS:CCDS27492.1 GeneID:268807 MGI:3045310
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC268807 protein_id : NP_808423.1

name	Anxa13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956196 GeneID:69787 MGI:1917037
definition	codon_start : 1 exception : unclassified translation discrepancy function : calcium-dependent, phospholipid-binding protein product : annexin A13 protein_id : NP_081487.1

name	LOC100040231 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266606 GeneID:100040231
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474835.1

name	D15Ertd621e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112817622 GeneID:210998 MGI:1277178
definition	codon_start : 1 note : skeletal muscle cells re-entry induced product : hypothetical protein LOC210998 protein_id : NP_666071.2

name	EG631797 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266601 GeneID:631797 MGI:3645398
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982409.2

name	Tmem65 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778812 CCDS:CCDS27493.1 GeneID:74868 MGI:1922118
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74868 protein_id : NP_780421.2

name	EG546638 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266603 GeneID:546638 MGI:3644823
definition	codon_start : 1 product : similar to ubiquitin-conjugating enzyme E2D 4 (putative) protein_id : XP_621400.4

name	Trmt12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118150645 GeneID:68260 MGI:1915510
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : tRNA methyltransferase 12 homolog protein_id : NP_080918.2

name	Rnf139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424858 CCDS:CCDS27494.1 GeneID:75841 MGI:1923091
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0031396 - regulation of protein ubiquitination [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ring finger protein 139 protein_id : NP_780435.1

name	Tatdn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424744 GeneID:69694 MGI:1916944
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : TatD DNase domain containing 1 protein_id : NP_780360.1

name	Ndufb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789148 CCDS:CCDS27495.1 GeneID:66218 MGI:1913468
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 protein_id : NP_075661.1

name	Mtss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450159 CCDS:CCDS27496.1 GeneID:211401 MGI:2384818
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030139 - endocytic vesicle [Evidence ISS]; GO:0001726 - ruffle [Evidence ISS] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0003785 - actin monomer binding [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0007015 - actin filament organization [Evidence IDA]; GO:0030041 - actin filament polymerization [Evidence IDA]; GO:0007155 - cell adhesion [Evidence ISS]; GO:0006928 - cell motility [Evidence ISS]; GO:0030035 - microspike biogenesis [Evidence ISS]; GO:0007517 - muscle development [Evidence NAS]; GO:0007399 - nervous system development [Evidence NAS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence ISS] codon_start : 1 exception : mismatches in translation product : actin monomer-binding protein protein_id : NP_659049.1

name	LOC100040330 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266612 GeneID:100040330
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475057.1

name	EG268809 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957238 GeneID:268809 MGI:3647181
definition	codon_start : 1 product : similar to 60S ribosomal protein L7 isoform 2 protein_id : XP_902311.1

name	LOC665565 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266614 GeneID:665565
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475099.1

name	LOC665244 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266604 GeneID:665244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to small nuclear ribonucleoprotein-like protein pseudo : _no_value transcript_id : XR_031842.1

clone name	MSMg01-115C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362J07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-201P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298J11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-298K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-467D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048H06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-238A13.b	B6Ng01-238A13.g
ACC	GA048836	GA048837
length	1,134	1,102
definition	B6Ng01-238A13.b	B6Ng01-238A13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(58,096,004 - 58,097,129)	(57,947,679 - 57,948,797)
sequence	gaattccaggctgtggttcccagcagaattctagcaaagtgaaccaagat attgttaccaacatgggggtgacaatctgtgcccccaagtcaggggtggc cacctgtcctcaataacctaatcaaaggagcccagttaaaagggaaagca ggttgcctgtcagtgggacatgttcttctagatgggctgtcttgtctggc cccagtaggagaggatgtgcctagcctcagagagactggaagcatcagag ttggggaatacccaagggggcccccacctgctcagaggagaaagggaggc aagaaggggacggtttgtcggagggggtgactgggaggggacagtgagta ggacgtaaagtgaataaagtttaaaacattaataaataaaaaattaaatt aaaaaagtagaaagtagaaaagggagatttgttgaatgtgggcatcttgg ggagaaggtcagagagatccagtgaacccctcaagtcatggtcttagcta gagtattattgctgtgaagaggcaccatgaccaaggcaacttttataagg acaacatttaattggggctggcttacaggttcagaggttctgtccattaa aatcaaggcaggagcatggcagcatccaggcaggcttggtgtaggtagag ctgagagttctacatccagatatataaaaaggaagccaggaagaaactgt cttctaagcagctaggagaagggtctcaaagctcaccctcacggtgacac acttcctccaacaaggccacacctactccaacaaagccacaccttctaac agtgccacttcctggaccaagcatatttaaaccaccacagagctaaaggg agatcaaagttttaaaaaggaggccaaggatatgcatatctaagtggttc tgtcaagatgtgctttggacaaccattgggcccatcattgtctgggcttc agtgtcatcctgtagaccgtttccacaagttgttagagctgtatgggaat ttctttactgaacaacaactttcctattcttggctggtgcctttctcttc tcccacatgagatttatatggagaattccaattccttgggggttctttgt ttccaatagctggataagtcagaactgagagacc	gaattctctttttttttctttaatgtggatgggtttaaaacccatcagtg atcctgtgtgcagactagagaacaactggagctgggtcttcccttccctg ttactatagctctaggcacactcaggttgccaggctatgattaaaggcat ctgatgctcttccagaaggccagggcttggctcccagcattcaagtctga tggctcacaactgtgattccagcttgatggcttgaatgacctcttctggc ctccacaggcaatcctagacaggtggcacacactcatacatgcacactca tacttaagaagactggggaaatggctaggccagtaaaagcactggctgta caggcatgcacacctgagttcaaatcccaaagcacatgaaaaagctgact acagtcatgtgtacatctgtaaccccagtgttggtgagaggatgggggct caggcttgttggataccagcctaactccagtgtcagtgagagaccgtctc aaggtaagtatcagagcacactcctgacatctgcttatgtgaacctgcac ccacatctctaacgcacacaagatttaaggaagtcaagagaagcagcact gcacacacacactgtgactataagtaaaagcgtctttctattaccttggg ggttgaattttaaacttttcgaagacttctggataaagtaagggaaacac caccatctcttttagagctgcaatgtgactggacaggccgccaacactgt caaagcgcacctgcagtgaattaggacacagatctgcattaaaattaaaa cactgcctatgtcttcataatcaacccacatcaactgattaacaatagta gttcaagatattttttaaatgttgtttattttacatgtagggcaccatgt ggatgctggatttaaactgagatcttctctagagctacaaatgctctaag tgctgagccatctctcaattccccaaagattttgctttaaaaatatatat aaaagttagtttctgataaggaaaaaaaggttgttactatagacaaacat acgtgaatggattacacttccaggtcagttacaagttaaatactcactga ag
quality values	Open. Hide. 49 26 14 30 58 58 30 16 54 58 62 62 62 62 62 47 62 62 62 62 47 32 62 54 62 62 62 39 41 62 62 56 44 38 44 20 21 32 21 27 50 59 62 59 59 62 62 62 59 51 59 59 62 62 62 59 62 62 59 46 62 59 59 62 62 62 62 62 62 62 62 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 54 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 49 54 62 62 62 62 47 47 62 62 62 47 62 62 62 62 62 62 62 62 62 54 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 42 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 53 58 58 42 54 49 58 58 54 58 49 58 52 58 46 58 54 41 54 58 54 54 58 51 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 54 58 58 54 53 54 53 58 54 58 58 54 58 58 58 58 58 58 54 58 46 54 46 49 54 54 47 58 58 45 54 58 50 51 42 58 51 51 58 54 58 58 58 58 51 53 54 54 38 58 40 46 41 58 50 46 51 58 54 54 58 41 58 58 58 58 58 53 53 58 58 50 58 50 50 50 50 37 58 58 51 53 53 52 49 26 41 35 51 51 54 58 50 52 51 37 58 54 52 58 58 48 50 50 50 50 33 58 40 50 47 58 51 32 54 46 49 58 58 50 51 37 54 50 53 42 51 50 50 58 52 42 49 58 39 58 39 51 39 42 51 41 50 26 49 42 53 50 54 39 50 58 47 44 23 51 31 49 47 50 50 42 53 34 53 58 50 30 45 53 45 37 49 41 53 45 54 54 49 35 29 49 47 46 32 49 50 35 41 49 54 54 39 54 54 42 40 53 54 42 42 52 52 51 30 32 54 37 49 34 39 45 42 37 31 45 35 12 54 52 32 54 47 37 53 53 39 39 54 54 29 52 53 39 45 37 54 54 51 37 37 45 46 54 29 33 28 27 24 42 37 39 32 47 32 39 43 29 53 34 35 34 25 25 19 31 34 40 24 45 30 35 34 37 40 45 52 37 53 34 40 32 41 52 39 31 52 52 31 45 31 33 31 35 42 45 30 32 30 35 26 31 31 41 35 33 23 31 37 30 32 46 31 51 24 37 33 43 28 33 30 31 31 31 31 31 51 18 18 46 32 32 32 21 25 37 29 27 23 32 32 14 31 37 29 46 32 31 47 39 43 26 32 31 38 31 41 26 27 32 48 46 37 30 46 46 46 22 24 16 22 27 23 18 31 22 25 31 33 19 17 21 26 31 31 35 36 31 33 34 36 26 35 35 38 37 33 19 26 31 31 38 28 31 23 26 25 19 20 38 32 31 25 37 48 32 24 21 26 17 10 33 22 30 24 24 29 8 41 10 33 44 26 30 38 34 34 32 26 30 21 34 28 26 48 21 32 28 37 32 21 13 24 32 25 32 18 15 15 17 20 28 14 25 10 21 21 16 30 24 48 20 27 32 9 7 5 22 23 19 15 33 15 23 27 13 20 16 32 12 7 4 8 19 13 34 9 25 14 23 47 7 18 10 38 21 6 9 20 28 27 21 10 8 6 7 8 25 28 17 34 21 19 8 13 16 9 5 9 5 9 15 29 9 20 19 38 6 10 8 7 10 29 28 10 7 10 12 19 19 13 19 27 7 6 5 15 24 19 28 9 20 12 19 8 7 8 21 12 15 19 10 7 16 4 14 14 20 18 6 6 24 20 6 9 6 7 13 10 23 14 7 2 7 18 16 30 18 6 4 4 12 4 5 19 8 5 22 7 13 4 12 6 9 7 7 14 6 8 6 4 4 9 13 8 13 8 7 4 5 4 22 9 14	Open. Hide. 62 47 51 47 62 62 62 62 62 62 51 42 38 27 32 32 32 36 34 50 43 50 46 37 62 59 62 62 59 46 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 59 59 62 59 62 59 59 62 62 62 62 59 59 56 62 62 48 56 59 59 54 59 56 54 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 32 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 54 54 58 54 58 37 37 58 58 58 49 58 58 58 54 54 41 58 58 58 58 58 58 58 58 58 54 52 54 54 45 48 58 58 58 58 58 54 58 58 58 58 48 58 54 58 58 58 52 54 54 58 58 52 58 52 42 35 58 58 54 58 58 54 52 54 54 58 48 52 58 52 54 52 50 51 50 46 58 50 49 46 42 51 58 53 58 58 51 58 45 46 40 58 53 58 58 58 58 50 52 47 58 50 58 58 50 47 58 58 58 58 42 54 58 51 52 51 50 58 53 58 58 54 41 58 52 50 48 48 49 50 54 16 58 49 36 36 58 41 49 58 38 58 58 58 50 58 53 52 58 37 49 41 58 51 39 58 52 40 53 53 51 53 58 51 50 53 53 51 49 51 52 54 41 51 52 53 42 47 47 50 50 50 53 51 54 42 53 30 58 58 54 31 39 47 50 49 54 54 53 49 37 41 50 42 39 42 54 42 34 37 54 54 54 53 26 32 37 34 38 28 54 54 50 35 54 49 40 53 54 54 49 47 19 41 54 27 39 24 33 46 42 42 51 39 37 32 42 54 46 37 33 23 37 20 49 33 35 54 39 38 32 36 44 31 42 37 34 53 53 34 52 31 52 53 34 40 30 47 27 45 40 40 34 32 31 37 53 32 42 32 31 32 40 33 28 31 26 16 28 16 47 32 40 53 29 28 29 26 33 36 43 31 31 31 51 42 30 41 31 31 29 26 33 18 28 31 29 31 35 42 33 33 26 32 20 22 13 31 26 23 30 31 31 34 30 31 31 38 36 32 29 21 22 48 48 33 29 38 32 46 48 33 29 24 31 31 41 14 27 27 30 31 31 31 30 24 33 36 24 38 31 28 31 37 19 27 32 48 42 33 32 26 34 32 32 33 29 31 36 36 31 29 14 26 39 26 27 29 27 33 34 31 18 30 22 35 11 8 13 22 31 21 21 48 44 44 41 32 23 38 30 31 31 12 10 12 17 48 22 31 27 48 44 31 11 31 23 31 31 20 7 13 37 21 31 32 24 22 19 23 30 22 21 13 19 18 32 32 21 43 6 4 5 48 6 30 39 22 32 31 31 21 13 25 32 32 33 32 27 17 26 10 29 11 24 9 32 26 20 15 8 30 24 19 29 20 28 28 27 16 25 13 21 23 27 23 21 29 13 21 24 16 18 24 20 24 6 4 3 7 15 8 20 47 47 14 13 47 14 20 29 18 47 40 23 9 11 26 47 12 3 31 40 27 7 8 8 5 13 4 3 3 3 20 25 18 13 24 13 6 5 13 29 6 14 11 13 23 7 4 10 8 8 19 28 28 23 28 22 9 3 2 11 8 9 13 17 11 18 5 4 7 17 9 7 5 9 30 15 17 8 13 5 1 1 6 9 5 7 19 5 6 5 3 3 7 6 3 13 6 8 5 8 22 5 8 17 15 22 18 5 6 6 10 8 14 1 3 5 3 2 15 4 4 21 7 21 9 22 5 6 7 4 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_58096004_58097129
seq2: B6Ng01-238A13.b_47_1180 (reverse)

seq1  GGTCTCTCAG-TCTGAC-TATCAGGCTATT-GAAACAAAGAACCCCCAAG  47
      |||||||||| |||||| ||||  |||||| |||||||||||||||||||
seq2  GGTCTCTCAGTTCTGACTTATCCAGCTATTGGAAACAAAGAACCCCCAAG  50

seq1  GAAATGGGAATTTCCATATAAATCTCATGTGGGAGAAGAGAAAGGCACCA  97
      ||| ||| | | ||||||||||||||||||||||||||||||||||||||
seq2  GAATTGGAATTCTCCATATAAATCTCATGTGGGAGAAGAGAAAGGCACCA  100

seq1  GCCA--GATAGGAAAGTTG-TGTTCAGTAAAGAAATT-CCATACAGCTCT  143
      ||||   |||||||||||| ||||||||||||||||| ||||||||||||
seq2  GCCAAGAATAGGAAAGTTGTTGTTCAGTAAAGAAATTCCCATACAGCTCT  150

seq1  AACAACTTGTGGAAACGGTCTACAGGATGACACTGAAGCCCAGACAATGA  193
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAACTTGTGGAAACGGTCTACAGGATGACACTGAAGCCCAGACAATGA  200

seq1  TGGG-CCAATGGTTGTCCAAAGCACATCTTGACAGAACCACTTAGATATG  242
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCCCAATGGTTGTCCAAAGCACATCTTGACAGAACCACTTAGATATG  250

seq1  CATATCCTTGGCCTCCTTTTTAAAACTTTGATCTCCCTTTAGCTCTGTGG  292
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATCCTTGGCCTCCTTTTTAAAACTTTGATCTCCCTTTAGCTCTGTGG  300

seq1  TGGTTTAAATATGCTTGGTCCAGGAAGTGGCACTGTTAGAAGGTGTGGCT  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTTAAATATGCTTGGTCCAGGAAGTGGCACTGTTAGAAGGTGTGGCT  350

seq1  TTGTTGGAGTAGGTGTGGCCTTGTTGGAGGAAGTGTGTCACCGTGAGGGT  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTGGAGTAGGTGTGGCCTTGTTGGAGGAAGTGTGTCACCGTGAGGGT  400

seq1  GAGCTTTGAGACCCTTCTCCTAGCTGCTTAGAAGACAGTTTCTTCCTGGC  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTTTGAGACCCTTCTCCTAGCTGCTTAGAAGACAGTTTCTTCCTGGC  450

seq1  TTCCTTTTTATATATCTGGATGTAGAACTCTCAGCTCTACCTACACCAAG  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTTTTATATATCTGGATGTAGAACTCTCAGCTCTACCTACACCAAG  500

seq1  CCTGCCTGGATGCTGCCATGCTCCTGCCTTGATTTTAATGGACAGAACCT  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCCTGGATGCTGCCATGCTCCTGCCTTGATTTTAATGGACAGAACCT  550

seq1  CTGAACCTGTAAGCCAGCCCCAATTAAATGTTGTCCTTATAAAAGTTGCC  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAACCTGTAAGCCAGCCCCAATTAAATGTTGTCCTTATAAAAGTTGCC  600

seq1  TTGGTCATGGTGCCTCTTCACAGCAATAATACTCTAGCTAAGACCATGAC  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTCATGGTGCCTCTTCACAGCAATAATACTCTAGCTAAGACCATGAC  650

seq1  TTGAGGGGTTCACTGGATCTCTCTGACCTTCTCCCCAAGATGCCCACATT  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGGGGTTCACTGGATCTCTCTGACCTTCTCCCCAAGATGCCCACATT  700

seq1  CAACAAATCTCCCTTTTCTACTTTCTACTTTTTTAATTTAATTTTTTATT  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAAATCTCCCTTTTCTACTTTCTACTTTTTTAATTTAATTTTTTATT  750

seq1  TATTAATGTTTTAAACTTTATTCACTTTACGTCCTACTCACTGTCCCCTC  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTAATGTTTTAAACTTTATTCACTTTACGTCCTACTCACTGTCCCCTC  800

seq1  CCAGTCACCCCCTCCGACAAACCGTCCCCTTCTTGCCTCCCTTTCTCCTC  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTCACCCCCTCCGACAAACCGTCCCCTTCTTGCCTCCCTTTCTCCTC  850

seq1  TGAGCAGGTGGGGGCCCCCTTGGGTATTCCCCAACTCTGATGCTTCCAGT  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCAGGTGGGGGCCCCCTTGGGTATTCCCCAACTCTGATGCTTCCAGT  900

seq1  CTCTCTGAGGCTAGGCACATCCTCTCCTACTGGGGCCAGACAAGACAGCC  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCTGAGGCTAGGCACATCCTCTCCTACTGGGGCCAGACAAGACAGCC  950

seq1  CATCTAGAAGAACATGTCCCACTGACAGGCAACCTGCTTTCCCTTTTAAC  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTAGAAGAACATGTCCCACTGACAGGCAACCTGCTTTCCCTTTTAAC  1000

seq1  TGGGCTCCTTTGATTAGGTTATTGAGGACAGGTGGCCACCCCTGACTTGG  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCTCCTTTGATTAGGTTATTGAGGACAGGTGGCCACCCCTGACTTGG  1050

seq1  GGGCACAGATTGTCACCCCCATGTTGGTAACAATATCTTGGTTCACTTTG  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCACAGATTGTCACCCCCATGTTGGTAACAATATCTTGGTTCACTTTG  1100

seq1  CTAGAATTCTGCTGGGAACCACAGCCTGGAATTC  1126
      ||||||||||||||||||||||||||||||||||
seq2  CTAGAATTCTGCTGGGAACCACAGCCTGGAATTC  1134

seq1: chr15_57947679_57948797
seq2: B6Ng01-238A13.g_67_1168

seq1  GAATTCTCTTTTTTTTTCTTTAATGTGGATGGGTTTAAAACCCATCAGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTTTTTTTTTCTTTAATGTGGATGGGTTTAAAACCCATCAGTG  50

seq1  ATCCTGTGTGCAGACTAGAGAACAACTGGAGCTGGGTCTTCCCTTCCCTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTGTGTGCAGACTAGAGAACAACTGGAGCTGGGTCTTCCCTTCCCTG  100

seq1  TTACTATAGCTCTAGGCACACTCAGGTTGCCAGGCTATGATTAAAGGCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTATAGCTCTAGGCACACTCAGGTTGCCAGGCTATGATTAAAGGCAT  150

seq1  CTGATGCTCTTCCAGAAGGCCAGGGCTTGGCTCCCAGCATTCAAGTCTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATGCTCTTCCAGAAGGCCAGGGCTTGGCTCCCAGCATTCAAGTCTGA  200

seq1  TGGCTCACAACTGTGATTCCAGCTTGATGGCTTGAATGACCTCTTCTGGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTCACAACTGTGATTCCAGCTTGATGGCTTGAATGACCTCTTCTGGC  250

seq1  CTCCACAGGCAATCCTAGACAGGTGGCACACACTCATACATGCACACTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCACAGGCAATCCTAGACAGGTGGCACACACTCATACATGCACACTCA  300

seq1  TACTTAAGAAGACTGGGGAAATGGCTAGGCCAGTAAAAGCACTGGCTGTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTAAGAAGACTGGGGAAATGGCTAGGCCAGTAAAAGCACTGGCTGTA  350

seq1  CAGGCATGCACACCTGAGTTCAAATCCCAAAGCACATGAAAAAGCTGACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCATGCACACCTGAGTTCAAATCCCAAAGCACATGAAAAAGCTGACT  400

seq1  ACAGTCATGTGTACATCTGTAACCCCAGTGTTGGTGAGAGGATGGGGGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTCATGTGTACATCTGTAACCCCAGTGTTGGTGAGAGGATGGGGGCT  450

seq1  CAGGCTTGTTGGATACCAGCCTAACTCCAGTGTCAGTGAGAGACCGTCTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTTGTTGGATACCAGCCTAACTCCAGTGTCAGTGAGAGACCGTCTC  500

seq1  AAGGTAAGTATCAGAGCACACTCCTGACATCTGCTTATGTGAACCTGCAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTAAGTATCAGAGCACACTCCTGACATCTGCTTATGTGAACCTGCAC  550

seq1  CCACATCTCTAACGCACACAAGATTTAAGGAAGTCAAGAGAAGCAGCACT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACATCTCTAACGCACACAAGATTTAAGGAAGTCAAGAGAAGCAGCACT  600

seq1  GCACACACACACTGTGACTATAAGTAAAAGCGTCTTTCTATTACCTTGGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACACACACACTGTGACTATAAGTAAAAGCGTCTTTCTATTACCTTGGG  650

seq1  GGTTGAATTTTAAACTTTTCGAAGACTTCTGGATAAAGTAAGGGAAACAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGAATTTTAAACTTTTCGAAGACTTCTGGATAAAGTAAGGGAAACAC  700

seq1  CACCATCTCTTTTAGAGCTGCAATGTGACTGGACAGGCCGCCAACACTGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCATCTCTTTTAGAGCTGCAATGTGACTGGACAGGCCGCCAACACTGT  750

seq1  CAAAGCGCACCTGCAGTGAATTAGGACACAGATCTGCATTAAAATTAAAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGCGCACCTGCAGTGAATTAGGACACAGATCTGCATTAAAATTAAAA  800

seq1  CACTGCCTATGTCTTCATAATCAACCCACATCAACTGATTAACAATAGTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGCCTATGTCTTCATAATCAACCCACATCAACTGATTAACAATAGTA  850

seq1  GTTCAAAGATATTTTTTAAATGTTTGTTTATTTTACATGTAGGGCACCAT  900
      |||| ||||||||||||||||| |||||||||||||||||||||||||||
seq2  GTTC-AAGATATTTTTTAAATG-TTGTTTATTTTACATGTAGGGCACCAT  898

seq1  GTGGATGCTGGGAATTAAACTGAGATCTTCTCTAAGAGCTACAAATGCTC  950
      ||||||||| ||| ||||||||||||||||||| ||||||||||||||||
seq2  GTGGATGCT-GGATTTAAACTGAGATCTTCTCT-AGAGCTACAAATGCTC  946

seq1  TAAGTGCTGAGCCATCTCTCCAATTCCCCAAAGATTTTTGCTTTTAAAAT  1000
      ||||||||||||||||||| |||||||||||||| ||||||||| |||||
seq2  TAAGTGCTGAGCCATCTCT-CAATTCCCCAAAGA-TTTTGCTTTAAAAAT  994

seq1  ATATATAAAAGTTTAAGTTTCTGATAAGGAAAAAAAAGGTTTGTTTACCT  1050
      |||||||||||||  |||||||||||||||||||||  | |||||   ||
seq2  ATATATAAAAGTT--AGTTTCTGATAAGGAAAAAAA--GGTTGTT--ACT  1038

seq1  ATAAGACAAACATAAAGTGATTGAAATTACACTT-CAAGTCAAGTACAAA  1099
      || |||||||||| | |||| ||  ||||||||| || ||||  ||||| 
seq2  AT-AGACAAACAT-ACGTGAATG-GATTACACTTCCAGGTCAGTTACAAG  1085

seq1  TTTTAAAATACTCACTGAAG  1119
      ||   |||||||||||||||
seq2  TT---AAATACTCACTGAAG  1102

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information