MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-250M03
Chromosome	15 (Build37)
Map Location	76,148,178 - 76,298,839
singlet/doublet	doublet
Overlap gene	Exosc4, Gpaa1, Cyc1, Sharpin, Maf1, EG626280, Brp16, Tssk5, Bop1, Scx
Upstream gene	LOC100041107, 9030619P08Rik, Ly6h, Gpihbp1, Zfp41, 2810039B14Rik, Top1mt, Rhpn1, Mafa, Zc3h3, LOC672572, Gsdmdc1, Naprt1, Eef1d, Tigd5, Pycrl, Tsta3, Zfp623, Eif2s3x-ps1, Zfp707, 2410075B13Rik, Mapk15, AA409316, K230010J24Rik, Scrib, 2410104I19Rik, Nrbp2, Eppk1, BC024139, Plec1, LOC671535, Grina, Spatc1, LOC100041269, Oplah
Downstream gene	Hsf1, Dgat1, Scrt1, LOC666497, EG666504, Fbxl6, Gpr172b, Adck5, Cpsf1, Slc39a4, Vps28, Nfkbil2, Cyhr1, Kifc2, Foxh1, Ppp1r16a, Gpt1, Mfsd3, Recql4, Lrrc14, Lrrc24, C030006K11Rik, D15Wsu169e, Zfp251, Zfp7, Commd5, Rpl8, Zfp647, 1110038F14Rik, Mb, Apol6, Rbm9, LOC100042318, Apol3, BC020489, BC085284, LOC624454, EG666639
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041107 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	9030619P08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105892 MGI:3612405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ly6h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23934 MGI:1346030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpihbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68453 MGI:1915703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22701 MGI:99186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2810039B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72665 MGI:1919915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	Top1mt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72960 MGI:1920210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhpn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14787 MGI:1098783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mafa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378435 MGI:2673307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zc3h3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223642 MGI:2663721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672572 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672572
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 21 Proteins pseudo : _no_value

name	Gsdmdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69146 MGI:1916396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Naprt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223646 MGI:2442664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eef1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66656 MGI:1913906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tigd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105734 MGI:2145902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pycrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66194 MGI:1913444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsta3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22122 MGI:98857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp623 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78834 MGI:1926084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif2s3x-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26906 MGI:1349404
definition	note : eukaryotic translation initiation factor 2, subunit 3, pseudogene 1 pseudo : _no_value

name	Zfp707 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69020 MGI:1916270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410075B13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223648 MGI:1925902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 1 Protein

name	Mapk15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332110 MGI:2652894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA409316 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105732 MGI:2145900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	K230010J24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432964 MGI:3588184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Scrib (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105782 MGI:2145950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410104I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67959 MGI:1915209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nrbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223649 MGI:2385017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eppk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223650 MGI:2386306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC024139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271278 MGI:2442591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plec1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18810 MGI:1277961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 11 mRNAs

name	LOC671535 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 135 ESTs, 8 Proteins

name	Grina (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66168 MGI:1913418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spatc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74281 MGI:1921531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041269 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Oplah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75475 MGI:1922725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109075 MGI:1923576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpaa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14731 MGI:1202392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66445 MGI:1913695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sharpin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106025 MGI:1913331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68877 MGI:1916127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626280 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626280 MGI:3647392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Brp16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59053 MGI:1930628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73542 MGI:1920792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bop1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12181 MGI:1334460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20289 MGI:102934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15499 MGI:96238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13350 MGI:1333825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scrt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170729 MGI:2176606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins pseudo : _no_value

name	EG666504 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666504 MGI:3647471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Fbxl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30840 MGI:1354705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr172b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52710 MGI:1289288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adck5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268822 MGI:2679274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94230 MGI:2679722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72027 MGI:1919277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66914 MGI:1914164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfkbil2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72749 MGI:1919999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyhr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54151 MGI:1859320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kifc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16581 MGI:109187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14106 MGI:1347465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r16a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73062 MGI:1920312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76282 MGI:95802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfsd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69572 MGI:1916822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Recql4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79456 MGI:1931028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223664 MGI:2445060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378937 MGI:3605040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030006K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223665 MGI:1925941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	D15Wsu169e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223666 MGI:107858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp251 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71591 MGI:1918841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223669 MGI:99208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Commd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66398 MGI:1913648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26961 MGI:1350927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp647 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239546 MGI:3052806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110038F14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117171 MGI:2152337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17189 MGI:96922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apol6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71939 MGI:1919189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 2 Proteins

name	Rbm9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93686 MGI:1933973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Apol3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75761 MGI:1923011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC020489 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223672 MGI:3606001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 70 ESTs, 16 Proteins

name	BC085284 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278679 MGI:3583950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs

name	EG666639 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666639 MGI:3646501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041107 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266657 GeneID:100041107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to CDNA sequence BC025446 transcript_id : XM_001475809.1

name	9030619P08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886450 GeneID:105892 MGI:3612405
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030619P08 gene transcript_id : NM_001039720.1

name	Ly6h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625648 GeneID:23934 MGI:1346030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphocyte antigen 6 complex, locus H transcript_id : NM_011837.2

name	Gpihbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037120 GeneID:68453 MGI:1915703
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GPI-anchored HDL-binding protein 1 transcript_id : NM_026730.1

name	Zfp41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113462003 GeneID:22701 MGI:99186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 41 transcript_id : NM_011759.2

name	Zfp41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113462001 GeneID:22701 MGI:99186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 41 transcript_id : NM_001044718.1

name	2810039B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266661 GeneID:72665 MGI:1919915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : RIKEN cDNA 2810039B14 gene transcript_id : XM_001475872.1

name	Top1mt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801374 GeneID:72960 MGI:1920210
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA topoisomerase 1, mitochondrial transcript_id : NM_028404.2

name	Rhpn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680084 GeneID:14787 MGI:1098783
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhophilin, Rho GTPase binding protein 1 transcript_id : NM_008164.1

name	Mafa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34996508 GeneID:378435 MGI:2673307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A (avian) transcript_id : NM_194350.1

name	Zc3h3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26006470 GeneID:223642 MGI:2663721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 3 transcript_id : NM_172121.1

name	Gsdmdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348546 GeneID:69146 MGI:1916396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gasdermin domain containing 1 transcript_id : NM_026960.2

name	Naprt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801783 GeneID:223646 MGI:2442664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nicotinate phosphoribosyltransferase domain containing 1 transcript_id : NM_172607.3

name	Eef1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54287683 GeneID:66656 MGI:1913906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) transcript_id : NM_023240.2

name	Eef1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699437 GeneID:66656 MGI:1913906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) transcript_id : NM_029663.1

name	Tigd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185888 GeneID:105734 MGI:2145902
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tigger transposable element derived 5 transcript_id : NM_178646.3

name	Pycrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508438 GeneID:66194 MGI:1913444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyrroline-5-carboxylate reductase-like transcript_id : NM_025412.2

name	Tsta3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13654267 GeneID:22122 MGI:98857
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tissue specific transplantation antigen P35B transcript_id : NM_031201.1

name	Zfp623 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364325 GeneID:78834 MGI:1926084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 623 transcript_id : NM_030199.3

name	Zfp707 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486707 GeneID:69020 MGI:1916270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 707 transcript_id : NM_001081065.1

name	Mapk15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342667 GeneID:332110 MGI:2652894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase 15 transcript_id : NM_177922.2

name	AA409316 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29789362 GeneID:105732 MGI:2145900
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA409316 transcript_id : NM_134087.1

name	K230010J24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266664 GeneID:432964 MGI:3588184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA K230010J24 gene transcript_id : XM_484483.4

name	Scrib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373162 GeneID:105782 MGI:2145950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scribbled homolog (Drosophila) transcript_id : NM_134089.1

name	2410104I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347837 GeneID:67959 MGI:1915209
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410104I19 gene transcript_id : NM_133691.3

name	2410104I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677816 GeneID:67959 MGI:1915209
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410104I19 gene transcript_id : NM_028364.1

name	Nrbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450054 GeneID:223649 MGI:2385017
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor binding protein 2 transcript_id : NM_144847.1

name	Eppk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537521 GeneID:223650 MGI:2386306
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epiplakin 1 transcript_id : NM_144848.2

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322903 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_011117.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322924 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201385.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322920 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201386.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322926 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201387.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322928 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201388.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322930 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201389.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322932 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201390.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322934 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201391.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322936 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201392.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322938 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201393.1

name	Plec1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41322940 GeneID:18810 MGI:1277961
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plectin 1 transcript_id : NM_201394.1

name	LOC671535 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266711 GeneID:671535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 124 ESTs, 8 Proteins product : similar to Plec1 protein, transcript variant 2 transcript_id : XM_001477932.1

name	LOC671535 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266709 GeneID:671535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 106 ESTs, 8 Proteins product : similar to Plec1 protein, transcript variant 1 transcript_id : XM_001477922.1

name	Grina (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130342 GeneID:66168 MGI:1913418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, N-methyl D-asparate-associated protein 1 (glutamate binding) transcript_id : NM_023168.3

name	Spatc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037362 GeneID:74281 MGI:1921531
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis and centriole associated 1 transcript_id : NM_028852.1

name	LOC100041269 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266666 GeneID:100041269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to sphingomyelin phosphodiesterase 3, neutral membrane transcript_id : XM_001476072.1

name	Oplah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130148 GeneID:75475 MGI:1922725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5-oxoprolinase (ATP-hydrolysing) transcript_id : NM_153122.2

name	Exosc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368131 GeneID:109075 MGI:1923576
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 4 transcript_id : NM_175399.3

name	Gpaa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981728 GeneID:14731 MGI:1202392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GPI anchor attachment protein 1 transcript_id : NM_010331.2

name	Cyc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363130 GeneID:66445 MGI:1913695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c-1 transcript_id : NM_025567.2

name	Sharpin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076870 GeneID:106025 MGI:1913331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SHANK-associated RH domain interacting protein transcript_id : NM_025340.1

name	Maf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982639 GeneID:68877 MGI:1916127
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAF1 homolog (S. cerevisiae) transcript_id : NM_026859.2

name	EG626280 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266671 GeneID:626280 MGI:3647392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG626280 transcript_id : XM_890873.3

name	Brp16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946997 GeneID:59053 MGI:1930628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain protein 16 transcript_id : NM_021555.1

name	Tssk5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676381 GeneID:73542 MGI:1920792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 5 transcript_id : NM_183099.2

name	Bop1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304930 GeneID:12181 MGI:1334460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : block of proliferation 1 transcript_id : NM_013481.1

name	Scx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254412 GeneID:20289 MGI:102934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scleraxis transcript_id : NM_198885.2

name	Hsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130831 GeneID:15499 MGI:96238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock factor 1 transcript_id : NM_008296.2

name	Dgat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981804 GeneID:13350 MGI:1333825
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol O-acyltransferase 1 transcript_id : NM_010046.2

name	Scrt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722996 GeneID:170729 MGI:2176606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scratch homolog 1, zinc finger protein (Drosophila) transcript_id : NM_130893.3

name	EG666504 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398749 GeneID:666504 MGI:3647471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : predicted gene, EG666504 transcript_id : XM_984290.1

name	Fbxl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305044 GeneID:30840 MGI:1354705
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 6 transcript_id : NM_013909.1

name	Gpr172b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378563 GeneID:52710 MGI:1289288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 172B transcript_id : NM_029643.3

name	Adck5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801210 GeneID:268822 MGI:2679274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aarF domain containing kinase 5 transcript_id : NM_172960.2

name	Cpsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16751834 GeneID:94230 MGI:2679722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage and polyadenylation specific factor 1 transcript_id : NM_053193.1

name	Slc39a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754010 GeneID:72027 MGI:1919277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 4 transcript_id : NM_028064.2

name	Vps28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801279 GeneID:66914 MGI:1914164
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 28 (yeast) transcript_id : NM_025842.2

name	Nfkbil2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048406 GeneID:72749 MGI:1919999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2 transcript_id : NM_183091.2

name	Cyhr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130778 GeneID:54151 MGI:1859320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine and histidine rich 1 transcript_id : NM_019396.2

name	Cyhr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30725866 GeneID:54151 MGI:1859320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine and histidine rich 1 transcript_id : NM_180962.1

name	Kifc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168296 GeneID:16581 MGI:109187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member C2 transcript_id : NM_010630.2

name	Foxh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382506 GeneID:14106 MGI:1347465
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box H1 transcript_id : NM_007989.2

name	Ppp1r16a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67514552 GeneID:73062 MGI:1920312
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 16A transcript_id : NM_033371.2

name	Gpt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33413403 GeneID:76282 MGI:95802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamic pyruvic transaminase 1, soluble transcript_id : NM_182805.1

name	Mfsd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387831 GeneID:69572 MGI:1916822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major facilitator superfamily domain containing 3 transcript_id : NM_027122.3

name	Recql4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815827 GeneID:79456 MGI:1931028
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RecQ protein-like 4 transcript_id : NM_058214.2

name	Lrrc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130136 GeneID:223664 MGI:2445060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 14 transcript_id : NM_145471.2

name	Lrrc24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375956 GeneID:378937 MGI:3605040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 24 transcript_id : NM_198119.2

name	C030006K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21735488 GeneID:223665 MGI:1925941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030006K11 gene transcript_id : NM_145472.1

name	C030006K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802964 GeneID:223665 MGI:1925941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030006K11 gene transcript_id : NM_176828.3

name	D15Wsu169e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38259213 GeneID:223666 MGI:107858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 15, Wayne State University 169, expressed transcript_id : NM_198420.1

name	Zfp251 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131107 GeneID:71591 MGI:1918841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 251 transcript_id : NM_001007568.2

name	Zfp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095020 GeneID:223669 MGI:99208
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 7 transcript_id : NM_145916.1

name	Commd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802424 GeneID:66398 MGI:1913648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COMM domain containing 5 transcript_id : NM_025536.2

name	Rpl8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755357 GeneID:26961 MGI:1350927
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L8 transcript_id : NM_012053.1

name	Zfp647 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801961 GeneID:239546 MGI:3052806
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 647 transcript_id : NM_172817.2

name	1110038F14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982592 GeneID:117171 MGI:2152337
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110038F14 gene transcript_id : NM_054099.2

name	Mb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21359819 GeneID:17189 MGI:96922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myoglobin transcript_id : NM_013593.2

name	Apol6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266677 GeneID:71939 MGI:1919189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 2 Proteins product : apolipoprotein L, 6 transcript_id : XM_001481299.1

name	Rbm9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379910 GeneID:93686 MGI:1933973
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 9 transcript_id : NM_053104.4

name	Rbm9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129875 GeneID:93686 MGI:1933973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 9 transcript_id : NM_175387.2

name	LOC100042318 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266721 GeneID:100042318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to thymosin, beta 10 transcript_id : XM_001478851.1

name	Apol3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037428 GeneID:75761 MGI:1923011
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein L 3 transcript_id : NM_029419.1

name	BC020489 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266725 GeneID:223672 MGI:3606001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 16 Proteins product : cDNA sequence BC020489, transcript variant 1 transcript_id : XM_128064.8

name	BC085284 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701567 GeneID:278679 MGI:3583950
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC085284 transcript_id : NM_001024848.1

name	LOC624454 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266726 GeneID:624454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs product : hypothetical LOC624454 transcript_id : XM_001478894.1

name	LOC100041107 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266658 GeneID:100041107
definition	codon_start : 1 product : similar to CDNA sequence BC025446 protein_id : XP_001475859.1

name	9030619P08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89886451 GeneID:105892 MGI:3612405
definition	codon_start : 1 note : LY antigen-like product : RIKEN cDNA 9030619P08 protein_id : NP_001034809.1

name	Ly6h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754586 CCDS:CCDS27544.1 GeneID:23934 MGI:1346030
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : lymphocyte antigen 6 complex, locus H protein_id : NP_035967.1

name	Gpihbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037121 CCDS:CCDS27545.1 GeneID:68453 MGI:1915703
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence IDA]; GO:0009986 - cell surface [Evidence IDA] GO_function : GO:0008035 - high-density lipoprotein binding [Evidence IDA] GO_process : GO:0030301 - cholesterol transport [Evidence IDA]; GO:0006869 - lipid transport [Evidence IDA] codon_start : 1 product : GPI-anchored HDL-binding protein 1 protein_id : NP_081006.1

name	Zfp41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113462002 GeneID:22701 MGI:99186
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 41 protein_id : NP_001038183.1

name	Zfp41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563280 GeneID:22701 MGI:99186
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 41 protein_id : NP_035889.1

name	2810039B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266662 GeneID:72665 MGI:1919915
definition	codon_start : 1 product : hypothetical protein LOC72665 protein_id : XP_001475922.1

name	Top1mt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50657345 CCDS:CCDS27547.1 GeneID:72960 MGI:1920210
definition	EC_number : 5.99.1.2 GO_component : GO:0005694 - chromosome [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003918 - DNA topoisomerase (ATP-hydrolyzing) activity [Evidence IEA]; GO:0003917 - DNA topoisomerase type I activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA] GO_process : GO:0006265 - DNA topological change [Evidence IEA]; GO:0006268 - DNA unwinding during replication [Evidence IEA] codon_start : 1 note : mitochondrial topoisomerase I product : DNA topoisomerase 1, mitochondrial protein_id : NP_082680.1

name	Rhpn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680085 CCDS:CCDS27548.1 GeneID:14787 MGI:1098783
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IPI] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation function : small GTPase Rho binding protein note : GTP-rho binding protein 1 product : rhophilin, Rho GTPase binding protein 1 protein_id : NP_032190.1

name	Mafa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34996509 CCDS:CCDS27549.1 GeneID:378435 MGI:2673307
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence ISS] [Evidence IDA]; GO:0009749 - response to glucose stimulus [Evidence ISS] codon_start : 1 product : Mafa homolog protein_id : NP_919331.1

name	Zc3h3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006471 CCDS:CCDS27550.1 GeneID:223642 MGI:2663721
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : zinc finger CCCH type domain containing 3 product : zinc finger CCCH type containing 3 protein_id : NP_742119.1

name	Gsdmdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312216 CCDS:CCDS27551.1 GeneID:69146 MGI:1916396
definition	codon_start : 1 product : gasdermin domain containing 1 protein_id : NP_081236.1

name	Naprt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982089 CCDS:CCDS27552.1 GeneID:223646 MGI:2442664
definition	GO_function : GO:0004516 - nicotinate phosphoribosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0019363 - pyridine nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : nicotinate phosphoribosyltransferase domain containing 1 protein_id : NP_766195.2

name	Eef1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699438 CCDS:CCDS27553.1 GeneID:66656 MGI:1913906
definition	GO_component : GO:0005853 - eukaryotic translation elongation factor 1 complex [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : eukaryotic translation elongation factor 1 delta isoform a protein_id : NP_083939.1

name	Eef1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54287684 CCDS:CCDS27554.1 GeneID:66656 MGI:1913906
definition	GO_component : GO:0005853 - eukaryotic translation elongation factor 1 complex [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : eukaryotic translation elongation factor 1 delta isoform b protein_id : NP_075729.2

name	Tigd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185889 GeneID:105734 MGI:2145902
definition	GO_component : GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : tigger transposable element derived 5 protein_id : NP_848761.2

name	Pycrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508439 GeneID:66194 MGI:1913444
definition	GO_function : GO:0004126 - cytidine deaminase activity [Evidence ISS]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0004735 - pyrroline-5-carboxylate reductase activity [Evidence IEA] GO_process : GO:0009972 - cytidine deamination [Evidence ISS]; GO:0006118 - electron transport [Evidence IEA]; GO:0006561 - proline biosynthesis [Evidence IEA] codon_start : 1 product : pyrroline-5-carboxylate reductase-like protein_id : NP_079688.2

name	Tsta3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13654268 CCDS:CCDS27555.1 GeneID:22122 MGI:98857
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0050662 - coenzyme binding [Evidence IEA]; GO:0050577 - GDP-L-fucose synthase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0044237 - cellular metabolism [Evidence IEA] codon_start : 1 product : tissue specific transplantation antigen P35B protein_id : NP_112478.1

name	Zfp623 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313506 CCDS:CCDS27556.1 GeneID:78834 MGI:1926084
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger CCCH type domain containing 3 protein_id : NP_084475.1

name	Zfp707 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486708 GeneID:69020 MGI:1916270
definition	codon_start : 1 product : zinc finger protein 707 protein_id : NP_001074534.1

name	Mapk15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244575 CCDS:CCDS27558.1 GeneID:332110 MGI:2652894
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS]; GO:0005622 - intracellular [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA] [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0017124 - SH3 domain binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046777 - protein amino acid autophosphorylation [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : extracellular signal-regulated kinase 7 protein_id : NP_808590.1

name	AA409316 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789363 CCDS:CCDS27559.1 GeneID:105732 MGI:2145900
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC105732 protein_id : NP_598848.1

name	K230010J24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266665 GeneID:432964 MGI:3588184
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484483.4

name	Scrib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373163 CCDS:CCDS27560.1 GeneID:105782 MGI:2145950
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008105 - asymmetric protein localization [Evidence IMP]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP] codon_start : 1 note : circletail; Scribble; scribble homolog 1 product : PDZ-domain protein scribble protein_id : NP_598850.1

name	2410104I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76677895 GeneID:67959 MGI:1915209
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; fuse-binding protein-interacting repressor product : fuse-binding protein-interacting repressor isoform b protein_id : NP_598452.2

name	2410104I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76677817 GeneID:67959 MGI:1915209
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1; fuse-binding protein-interacting repressor product : fuse-binding protein-interacting repressor isoform a protein_id : NP_082640.1

name	Nrbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450055 CCDS:CCDS27561.1 GeneID:223649 MGI:2385017
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence NAS]; GO:0004672 - protein kinase activity [Evidence IEA] [Evidence NAS] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence NAS] [Evidence IEA] codon_start : 1 product : nuclear receptor binding protein 2 protein_id : NP_659096.1

name	Eppk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537522 GeneID:223650 MGI:2386306
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : epiplakin 1 protein_id : NP_659097.2

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322904 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : plectin 1 isoform 1 protein_id : NP_035247.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322925 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : plectin 1 isoform 2 protein_id : NP_958787.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322921 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 3 is encoded by transcript variant 3 product : plectin 1 isoform 3 protein_id : NP_958788.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322931 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 6 is encoded by transcript variant 6 product : plectin 1 isoform 6 protein_id : NP_958791.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322933 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 7 is encoded by transcript variant 7 product : plectin 1 isoform 7 protein_id : NP_958792.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322935 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 8 is encoded by transcript variant 8 product : plectin 1 isoform 8 protein_id : NP_958793.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322939 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 10 is encoded by transcript variant 10 product : plectin 1 isoform 10 protein_id : NP_958795.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322941 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 11 is encoded by transcript variant 11 product : plectin 1 isoform 11 protein_id : NP_958796.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322927 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 4 is encoded by transcript variant 4 product : plectin 1 isoform 4 protein_id : NP_958789.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322929 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 5 is encoded by transcript variant 5 product : plectin 1 isoform 5 protein_id : NP_958790.1

name	Plec1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41322937 GeneID:18810 MGI:1277961
definition	GO_component : GO:0043292 - contractile fiber [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 9 is encoded by transcript variant 9 product : plectin 1 isoform 9 protein_id : NP_958794.1

name	LOC671535 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266710 GeneID:671535
definition	codon_start : 1 product : similar to Plec1 protein isoform 1 protein_id : XP_001477972.1

name	LOC671535 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266712 GeneID:671535
definition	codon_start : 1 product : similar to Plec1 protein isoform 2 protein_id : XP_001477982.1

name	Grina (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963551 CCDS:CCDS27563.1 GeneID:66168 MGI:1913418
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : glutamate receptor, ionotropic, N-methyl D-asparate-associated protein 1 protein_id : NP_075657.1

name	Spatc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037363 CCDS:CCDS27564.1 GeneID:74281 MGI:1921531
definition	GO_component : GO:0005813 - centrosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0043015 - gamma-tubulin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : spermatogenesis and centriole associated 1 protein_id : NP_083128.1

name	LOC100041269 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266667 GeneID:100041269
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476122.1

name	Oplah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346557 CCDS:CCDS27565.1 GeneID:75475 MGI:1922725
definition	EC_number : 3.5.2.9 GO_function : GO:0017168 - 5-oxoprolinase (ATP-hydrolyzing) activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : 5-oxoprolinase (ATP-hydrolysing) protein_id : NP_694762.1

name	Exosc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29611663 GeneID:109075 MGI:1923576
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA] codon_start : 1 product : exosome complex exonuclease RRP41 protein_id : NP_780608.1

name	Gpaa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754046 GeneID:14731 MGI:1202392
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0042765 - GPI-anchor transamidase complex [Evidence ISS] [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence ISS]; GO:0003923 - GPI-anchor transamidase activity [Evidence TAS] [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0015631 - tubulin binding [Evidence ISS] GO_process : GO:0016255 - attachment of GPI anchor to protein [Evidence ISS]; GO:0006506 - GPI anchor biosynthesis [Evidence ISS]; GO:0006621 - protein retention in ER [Evidence ISS] codon_start : 1 product : GPI anchor attachment protein 1 protein_id : NP_034461.1

name	Cyc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385006 CCDS:CCDS27567.1 GeneID:66445 MGI:1913695
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : cytochrome c-1 protein_id : NP_079843.1

name	Sharpin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076871 GeneID:106025 MGI:1913331
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : protein kinase C-interacting protein RBCC like 1 product : shank-interacting protein-like 1 protein_id : NP_079616.1

name	Maf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982640 CCDS:CCDS27568.1 GeneID:68877 MGI:1916127
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : repressor of RNA polymerase III transcription MAF1 protein_id : NP_081135.2

name	EG626280 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266672 GeneID:626280 MGI:3647392
definition	codon_start : 1 product : similar to KIAA1875 protein protein_id : XP_895966.3

name	Brp16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946998 CCDS:CCDS27569.1 GeneID:59053 MGI:1930628
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : brain protein 16 protein_id : NP_067530.1

name	Tssk5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676382 GeneID:73542 MGI:1920792
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : testis-specific serine kinase 5 protein_id : NP_898922.2

name	Bop1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304931 CCDS:CCDS27570.1 GeneID:12181 MGI:1334460
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0043021 - ribonucleoprotein binding [Evidence IDA] GO_process : GO:0042273 - ribosomal large subunit biogenesis [Evidence IMP]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IMP] codon_start : 1 product : block of proliferation 1 protein_id : NP_038509.1

name	Scx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38566694 CCDS:CCDS27571.1 GeneID:20289 MGI:102934
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : scleraxis protein_id : NP_942588.1

name	Hsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859480 CCDS:CCDS27572.1 GeneID:15499 MGI:96238
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0045120 - pronucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IGI]; GO:0006457 - protein folding [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : heat shock transcription factor 1 product : heat shock factor 1 protein_id : NP_032322.1

name	Dgat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753632 CCDS:CCDS27573.1 GeneID:13350 MGI:1333825
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0003846 - 2-acylglycerol O-acyltransferase activity [Evidence IDA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004144 - diacylglycerol O-acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : diacylglycerol acyltransferase; diacylglycerol acyltransferase 1 product : diacylglycerol O-acyltransferase 1 protein_id : NP_034176.1

name	Scrt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18700038 GeneID:170729 MGI:2176606
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcriptional repressor scratch product : scratch homolog 1, zinc finger protein protein_id : NP_570963.1

name	EG666504 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398750 GeneID:666504 MGI:3647471
definition	codon_start : 1 product : similar to hCG2036558 protein_id : XP_989384.1

name	Fbxl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305045 GeneID:30840 MGI:1354705
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box protein containing leucine repeats 6 product : F-box and leucine-rich repeat protein 6 protein_id : NP_038937.1

name	Gpr172b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313230 CCDS:CCDS27575.1 GeneID:52710 MGI:1289288
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 172B protein_id : NP_083919.1

name	Adck5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370472 CCDS:CCDS27576.1 GeneID:268822 MGI:2679274
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA] codon_start : 1 product : aarF domain containing kinase 5 protein_id : NP_766548.1

name	Cpsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16751835 CCDS:CCDS27577.1 GeneID:94230 MGI:2679722
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 note : CPSF160; cleavage and polyadenylation specificity factor 1 product : cleavage and polyadenylation specific factor 1 protein_id : NP_444423.1

name	Slc39a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312508 CCDS:CCDS27578.1 GeneID:72027 MGI:1919277
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005768 - endosome [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA]; GO:0005385 - zinc ion transporter activity [Evidence IDA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence IDA]; GO:0006829 - zinc ion transport [Evidence IDA] codon_start : 1 product : solute carrier family 39, member 4 protein_id : NP_082340.1

name	Vps28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385320 CCDS:CCDS27579.1 GeneID:66914 MGI:1914164
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005768 - endosome [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 28 protein_id : NP_080118.1

name	Nfkbil2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048407 CCDS:CCDS27580.1 GeneID:72749 MGI:1919999
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : I-kappa-B-related protein protein_id : NP_898914.2

name	Cyhr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506491 CCDS:CCDS27581.1 GeneID:54151 MGI:1859320
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; cysteine and histidine-rich cytoplasmic protein product : cysteine and histidine rich 1 isoform 1 protein_id : NP_062269.1

name	Cyhr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725867 CCDS:CCDS27582.1 GeneID:54151 MGI:1859320
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; cysteine and histidine-rich cytoplasmic protein product : cysteine and histidine rich 1 isoform 2 protein_id : NP_851293.1

name	Kifc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168297 CCDS:CCDS27583.1 GeneID:16581 MGI:109187
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 product : kinesin family member C2 protein_id : NP_034760.2

name	Foxh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679845 CCDS:CCDS27584.1 GeneID:14106 MGI:1347465
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0048318 - axial mesoderm development [Evidence IMP]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0035054 - embryonic heart tube anterior/posterior pattern formation [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : forkhead/winged-helix domain transcription factor note : forkhead activin signal transducer 2 product : forkhead box H1 protein_id : NP_032015.1

name	Ppp1r16a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930481 CCDS:CCDS27585.1 GeneID:73062 MGI:1920312
definition	GO_component : GO:0005829 - cytosol [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : myosin phosphatase, target subunit 3; mFLJ00392 protein product : protein phosphatase 1, regulatory (inhibitor) subunit 16A protein_id : NP_203535.1

name	Gpt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33413404 CCDS:CCDS27586.1 GeneID:76282 MGI:95802
definition	GO_function : GO:0004021 - alanine transaminase activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : glutamic pyruvic transaminase 1, soluble protein_id : NP_877957.1

name	Mfsd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560112 CCDS:CCDS27587.1 GeneID:69572 MGI:1916822
definition	codon_start : 1 product : major facilitator superfamily domain containing 3 protein_id : NP_081398.2

name	Recql4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815828 CCDS:CCDS27588.1 GeneID:79456 MGI:1931028
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA] codon_start : 1 note : RecQ helicase protein-like 4 product : RecQ protein-like 4 protein_id : NP_478121.2

name	Lrrc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703932 CCDS:CCDS27589.1 GeneID:223664 MGI:2445060
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 14 protein_id : NP_663446.1

name	Lrrc24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674275 CCDS:CCDS27590.1 GeneID:378937 MGI:3605040
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 24 protein_id : NP_932787.1

name	C030006K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735489 CCDS:CCDS27591.1 GeneID:223665 MGI:1925941
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC223665 protein_id : NP_663447.1

name	C030006K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849877 CCDS:CCDS27591.1 GeneID:223665 MGI:1925941
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC223665 protein_id : NP_789798.1

name	D15Wsu169e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259214 CCDS:CCDS27592.1 GeneID:223666 MGI:107858
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein 9530053N22 protein_id : NP_940812.1

name	Zfp251 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090226 CCDS:CCDS27593.1 GeneID:71591 MGI:1918841
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 251 protein_id : NP_001007569.1

name	Zfp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095021 GeneID:223669 MGI:99208
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger protein 86, related sequence 1 product : zinc finger protein 7 protein_id : NP_666021.1

name	Commd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313478 CCDS:CCDS27594.1 GeneID:66398 MGI:1913648
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : hypertension-related, calcium regulated product : COMM domain containing 5 protein_id : NP_079812.1

name	Rpl8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755358 CCDS:CCDS27595.1 GeneID:26961 MGI:1350927
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0019843 - rRNA binding [Evidence IEA] codon_start : 1 product : ribosomal protein L8 protein_id : NP_036183.1

name	Zfp647 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370220 CCDS:CCDS27596.1 GeneID:239546 MGI:3052806
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : KRAB zinc-finger protein product : zinc finger protein 647 protein_id : NP_766405.1

name	1110038F14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905135 GeneID:117171 MGI:2152337
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC117171 protein_id : NP_473440.1

name	Mb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21359820 CCDS:CCDS27597.1 GeneID:17189 MGI:96922
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0019825 - oxygen binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IEA] GO_process : GO:0043353 - enucleate erythrocyte differentiation [Evidence IMP]; GO:0015671 - oxygen transport [Evidence IEA]; GO:0001666 - response to hypoxia [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : myoglobin protein_id : NP_038621.2

name	Apol6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266678 GeneID:71939 MGI:1919189
definition	codon_start : 1 exception : unclassified translation discrepancy product : apolipoprotein L, 6 protein_id : XP_001481349.1

name	Rbm9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30524922 CCDS:CCDS27598.1 GeneID:93686 MGI:1933973
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] [Evidence ISS]; GO:0003714 - transcription corepressor activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0016070 - RNA metabolism [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; fox-1 homolog; hexaribonucleotide binding protein 2; Fyn-binding molecule 2 product : RNA binding motif protein 9 isoform 2 protein_id : NP_780596.1

name	Rbm9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30524926 GeneID:93686 MGI:1933973
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] [Evidence ISS]; GO:0003714 - transcription corepressor activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0016070 - RNA metabolism [Evidence ISS] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; fox-1 homolog; hexaribonucleotide binding protein 2; Fyn-binding molecule 2 product : RNA binding motif protein 9 isoform 1 protein_id : NP_444334.2

name	LOC100042318 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266722 GeneID:100042318
definition	codon_start : 1 product : similar to thymosin, beta 10 protein_id : XP_001478901.1

name	Apol3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037429 GeneID:75761 MGI:1923011
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : apolipoprotein L 3 protein_id : NP_083695.1

name	BC020489 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20902713 GeneID:223672 MGI:3606001
definition	codon_start : 1 product : hypothetical protein LOC223672 isoform 1 protein_id : XP_128064.1

name	BC085284 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701568 CCDS:CCDS27600.1 GeneID:278679 MGI:3583950
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC278679 protein_id : NP_001020019.1

name	LOC624454 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266727 GeneID:624454
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478944.1

name	EG666639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666639
definition	number : 2 pseudo : _no_value

name	EG666639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666639
definition	number : 1 pseudo : _no_value

name	LOC672572 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266704 GeneID:672572
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 21 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_033200.1

name	2410075B13Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149266706 GeneID:223648 MGI:1925902
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 1 Protein product : RIKEN cDNA 2410075B13 gene transcript_id : XR_035335.1

name	BC024139 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149266560 GeneID:271278 MGI:2442591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC024139 transcript_id : XR_035100.1

name	LOC666497 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266675 GeneID:666497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 3 Proteins product : similar to OTTHUMP00000017090 pseudo : _no_value transcript_id : XR_032628.1

clone name	MSMg01-101J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518E21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-321B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-264E03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323J22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-363B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548N09
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-300M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I08
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-250M03.b	B6Ng01-250M03.g
ACC	GA058214	GA058215
length	554	898
definition	B6Ng01-250M03.b	B6Ng01-250M03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(76,148,178 - 76,148,731)	(76,297,948 - 76,298,839)
sequence	gaattctagtgcaatagaaacttctaagggagcggggctggaacgagata aaaaggtttctgaagatagctacagtgtacttacatataataaataaata aatcttaaaaaaaaaagaaagaaagaaaaaagaaactcccaggaatctat aaggaatctataaggtgactctaagacacctagtaatggggaatatggag cctgaactggccatctccagtaaccaggtaagactcccaatggaagaact ggtaccccaacccagccacaaaagcttctttaacctacaattggtcctgc ccacaagatgtgctggggtagaagtgtcacataaatcgtgagagtggcta accaatgcctggtccagcttgagacccatgagagggagcccaccccggga accagagactggacagctagaggcctacctaggatagaatcaaccacaaa tggcaaaagaaaaaaaaaagtcaatgaaaagattgtgctatactcacaga ttggtgcctagcctagttttcatcagagaggcttcacccagcaattgata catc	gaattcccaaacctcaccattggagagcccaacccttgtcaaaggcctac tagcatttggctcccccaggtatatgcttcattgtcccgcactggaaaag tggggagacacggtgcaggctgctgagtttgcttcccacaggacgctgat catggcctgtaggcactgccactgtgattcatgtaggtatagtccctggc agagagcatttggaaggagatgtggcatgttatgggccctgcctgaggcc agggctctgacacctgcttgggaacagtggctggccagagcttggtattg taatgccactgtcccaggggcctgctgagcgcaggcagagtcagatgtgc ctgcaagttgtgttcctggggcctcttgtgagctggggtttgcaacccat ttttggtgtacagcaagaaagtgggggagatagagaaactgaatccttcc ttgttccaagcctggagaaaaacttagtcttccatcctctttatactgaa gggaaaaacaggccagagaagagtaggcctttggctcttgcctgggtaag agggactggggctgtgggcgggggcgcccacacaccggggttcctgctcc aagcactttactgccctcaggggtgagaggtgggcctgttttctccatca gtttctggttctgccaataaacccgatctggtctgagccatccgcctccc caggcaagggagaatctgttttccaggttgcggtgtgaatcctcccgtgg cacccacttctgacctaggggacaaggtcagccttttcgttgcagctaat ggtgggtgtggaaggtgcctggggtctgggcctcaggcaattttgggagt cccaggaaatctttctaggcccttggccatctggtctgttctgaatgt
quality values	Open. Hide. 62 47 33 31 62 56 62 47 56 62 47 56 56 54 62 54 56 62 62 62 62 62 62 43 62 59 62 62 62 62 62 51 44 45 34 38 34 28 32 32 49 54 59 59 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 59 62 62 62 59 59 59 62 54 54 54 43 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 47 47 54 62 62 62 54 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 58 58 58 54 58 58 58 58 52 58 58 58 58 58 52 58 58 54 52 58 42 54 54 58 58 58 58 58 52 58 58 54 48 54 58 54 58 58 58 58 58 54 58 58 52 58 54	Open. Hide. 62 47 44 47 62 62 62 47 42 62 62 42 42 38 28 24 27 24 20 32 36 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 59 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 54 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 51 62 62 33 62 62 62 62 56 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 42 62 56 62 62 45 43 62 62 62 62 62 62 62 54 54 46 62 62 62 62 62 62 62 62 62 52 62 62 62 52 52 43 47 38 62 62 46 48 62 48 62 62 42 54 52 58 54 45 49 54 42 41 41 54 52 52 54 58 37 35 54 58 54 40 48 52 45 42 39 21 36 54 54 54 54 58 46 45 15 43 42 58 52 42 42 58 52 54 50 58 58 54 52 52 46 54 32 54 47 42 39 52 54 11 32 52 58 52 27 38 52 52 35 30 52 47 52 54 53 54 25 27 45 50 42 50 50 47 50 54 51 32 42 46 32 41 8 48 48 35 42 40 51 30 41 49 49 50 50 47 42 35 24 49 48 32 39 18 58 50 28 17 58 32 40 42 37 51 50 49 49 17 18 36 42 31 31 28 43 42 47 24 41 17 36 35 50 39 32 39 39 28 41 17 58 23 39 39 36 49 39 18 27 51 35 39 26 10 9 8 22 32 50 26 30 39 30 7 49 51 29 35 15 30 35 32 33 21 25 40 29 39 52 23 50 50 30 37 9 34 35 22 40 35 12 28 39 12 10 18 47 42 21 49 27 44 40 51 30 20 13 46 32 6 35 24 37 17 25 12 35 26 32 36 18 24 17 31 35 25 14 17 13 9 18 7 17 11 6 5 13 27 40 20 18 18 29 21 10 16 13 13 7 9 13 18 40 43 15 18 19 33 15 13 14 15 9 9 15 22 27 7 21 31 31 11 9 15 9 9 7 14 20 30 33 27 39 21 14 11 24 26 13 26 21 6 9 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_76148178_76148731
seq2: B6Ng01-250M03.b_47_600

seq1  GAATTCTAGTGCAATAGAAACTTCTAAGGGAGCGGGGCTGGAACGAGATA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAGTGCAATAGAAACTTCTAAGGGAGCGGGGCTGGAACGAGATA  50

seq1  AAAAGGTTTCTGAAGATAGCTACAGTGTACTTACATATAATAAATAAATA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGTTTCTGAAGATAGCTACAGTGTACTTACATATAATAAATAAATA  100

seq1  AATCTTAAAAAAAAAAGAAAGAAAGAAAAAAGAAACTCCCAGGAATCTAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTTAAAAAAAAAAGAAAGAAAGAAAAAAGAAACTCCCAGGAATCTAT  150

seq1  AAGGAATCTATAAGGTGACTCTAAGACACCTAGTAATGGGGAATATGGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAATCTATAAGGTGACTCTAAGACACCTAGTAATGGGGAATATGGAG  200

seq1  CCTGAACTGGCCATCTCCAGTAACCAGGTAAGACTCCCAATGGAAGAACT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAACTGGCCATCTCCAGTAACCAGGTAAGACTCCCAATGGAAGAACT  250

seq1  GGTACCCCAACCCAGCCACAAAAGCTTCTTTAACCTACAATTGGTCCTGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACCCCAACCCAGCCACAAAAGCTTCTTTAACCTACAATTGGTCCTGC  300

seq1  CCACAAGATGTGCTGGGGTAGAAGTGTCACATAAATCGTGAGAGTGGCTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACAAGATGTGCTGGGGTAGAAGTGTCACATAAATCGTGAGAGTGGCTA  350

seq1  ACCAATGCCTGGTCCAGCTTGAGACCCATGAGAGGGAGCCCACCCCGGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAATGCCTGGTCCAGCTTGAGACCCATGAGAGGGAGCCCACCCCGGGA  400

seq1  ACCAGAGACTGGACAGCTAGAGGCCTACCTAGGATAGAATCAACCACAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGAGACTGGACAGCTAGAGGCCTACCTAGGATAGAATCAACCACAAA  450

seq1  TGGCAAAAGAAAAAAAAAAGTCAATGAAAAGATTGTGCTATACTCACAGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCAAAAGAAAAAAAAAAGTCAATGAAAAGATTGTGCTATACTCACAGA  500

seq1  TTGGTGCCTAGCCTAGTTTTCATCAGAGAGGCTTCACCCAGCAATTGATA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTGCCTAGCCTAGTTTTCATCAGAGAGGCTTCACCCAGCAATTGATA  550

seq1  CATC  554
      ||||
seq2  CATC  554

seq1: chr15_76297948_76298839
seq2: B6Ng01-250M03.g_67_964 (reverse)

seq1  ACATTCAGAACAGACCGACTGGCCAAGGGCCTAGAGAGATTTCCT-GGAC  49
      ||||||||||||||||   |||||||||||||||| ||||||||| ||||
seq2  ACATTCAGAACAGACCAGATGGCCAAGGGCCTAGAAAGATTTCCTGGGAC  50

seq1  TCCCAAAATGCCTTGAGGCCCAGACCCCAGGCACCTTCCACACCCACCA-  98
      |||||||||  | |||||||||||||||||||||||||||||||||||| 
seq2  TCCCAAAATTGCCTGAGGCCCAGACCCCAGGCACCTTCCACACCCACCAT  100

seq1  TAGCTGCAACG-AAAGGCTGACCTTGTCCCCTAGGTCAG-AGTGGGTGCC  146
      ||||||||||| ||||||||||||||||||||||||||| ||||||||||
seq2  TAGCTGCAACGAAAAGGCTGACCTTGTCCCCTAGGTCAGAAGTGGGTGCC  150

seq1  AC-GGAGGATTCACACCGCAACCTGGAAAACAGATTCTCCCTTGCCTGGG  195
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGGGAGGATTCACACCGCAACCTGGAAAACAGATTCTCCCTTGCCTGGG  200

seq1  GAGGCGGATGGCTCAGACCAGATCGGGTTTATTGGCAGAACCAG-AACTG  244
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  GAGGCGGATGGCTCAGACCAGATCGGGTTTATTGGCAGAACCAGAAACTG  250

seq1  ATGGAGAAAACAGGCCCACCTCTCACCCCTGAGGGCAGTAAAGTGCTTGG  294
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAGAAAACAGGCCCACCTCTCACCCCTGAGGGCAGTAAAGTGCTTGG  300

seq1  AGCAGGAACCCCGGTGTGTGGGCGCCCCCGCCCACAGCCCCAGTCCCTCT  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGAACCCCGGTGTGTGGGCGCCCCCGCCCACAGCCCCAGTCCCTCT  350

seq1  TACCCAGGCAAGAGCCAAAGGCCTACTCTTCTCTGGCCTGTTTTTCCCTT  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCAGGCAAGAGCCAAAGGCCTACTCTTCTCTGGCCTGTTTTTCCCTT  400

seq1  CAGTATAAAGAGGATGGAAGACTAAGTTTTTCTCCAGGCTTGGAACAAGG  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTATAAAGAGGATGGAAGACTAAGTTTTTCTCCAGGCTTGGAACAAGG  450

seq1  AAGGATTCAGTTTCTCTATCTCCCCCACTTTCTTGCTGTACACCAAAAAT  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGATTCAGTTTCTCTATCTCCCCCACTTTCTTGCTGTACACCAAAAAT  500

seq1  GGGTTGCAAACCCCAGCTCACAAGAGGCCCCAGGAACACAACTTGCAGGC  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTGCAAACCCCAGCTCACAAGAGGCCCCAGGAACACAACTTGCAGGC  550

seq1  ACATCTGACTCTGCCTGCGCTCAGCAGGCCCCTGGGACAGTGGCATTACA  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTGACTCTGCCTGCGCTCAGCAGGCCCCTGGGACAGTGGCATTACA  600

seq1  ATACCAAGCTCTGGCCAGCCACTGTTCCCAAGCAGGTGTCAGAGCCCTGG  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCAAGCTCTGGCCAGCCACTGTTCCCAAGCAGGTGTCAGAGCCCTGG  650

seq1  CCTCAGGCAGGGCCCATAACATGCCACATCTCCTTCCAAATGCTCTCTGC  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCAGGCAGGGCCCATAACATGCCACATCTCCTTCCAAATGCTCTCTGC  700

seq1  CAGGGACTATACCTACATGAATCACAGTGGCAGTGCCTACAGGCCATGAT  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGACTATACCTACATGAATCACAGTGGCAGTGCCTACAGGCCATGAT  750

seq1  CAGCGTCCTGTGGGAAGCAAACTCAGCAGCCTGCACCGTGTCTCCCCACT  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCGTCCTGTGGGAAGCAAACTCAGCAGCCTGCACCGTGTCTCCCCACT  800

seq1  TTTCCAGTGCGGGACAATGAAGCATATACCTGGGGGAGCCAAATGCTAGT  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCAGTGCGGGACAATGAAGCATATACCTGGGGGAGCCAAATGCTAGT  850

seq1  AGGCCTTTGACAAGGGTTGGGCTCTCCAATGGTGAGGTTTGGGAATTC  892
      ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCTTTGACAAGGGTTGGGCTCTCCAATGGTGAGGTTTGGGAATTC  898

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information