MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-252P23
Chromosome	15 (Build37)
Map Location	100,283,353 - 100,427,583
singlet/doublet	doublet
Overlap gene	Letmd1, BC035295, Tcfcp2, Pou6f1
Upstream gene	C230021P08Rik, 4930556P03Rik, Faim2, LOC545137, Aqp2, Aqp5, Aqp6, Racgap1, LOC100043473, Accn2, Smarcd1, Gpd1, 2310016M24Rik, Lass5, Lima1, LOC100043481, LOC100042918, 1700030F18Rik, Gm920, D330037H05Rik, 4930478M13Rik, Dip2b, Atf1, 4930478A21Rik, EG432981, Mettl7a, ENSMUSG00000058057, LOC554292, Ubie, Yghl1-4, Slc11a2, EG432982
Downstream gene	Dazap2, BC004728, Bin2, Ela1, Galnt6, Slc4a8, Scn8a, EG668225, Ankrd33, Acvrl1, Acvr1b, Grasp, Nr4a1, 9430023L20Rik, 6030408B16Rik, Krt80, Krt7, Krt85, Krt83, 1700011A15Rik, 5430421N21Rik, EG574415, Krt84, Krt82, 4732456N10Rik, Krt75, EG432985
Link	Open Mouse BAC browser

Click to get alignment info.

name	C230021P08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380969 MGI:3609653
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930556P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75284 MGI:1922534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Faim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72393 MGI:1919643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC545137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 ESTs, 5 Proteins pseudo : _no_value

name	Aqp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11827 MGI:1096865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aqp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11830 MGI:106215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aqp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11831 MGI:1341204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Racgap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26934 MGI:1349423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Accn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11419 MGI:1194915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83797 MGI:1933623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14555 MGI:95679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310016M24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66379 MGI:1913629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lass5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71949 MGI:1919199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lima1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65970 MGI:1920992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 6 Proteins pseudo : _no_value

name	LOC100042918 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	1700030F18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72277 MGI:1919527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm920 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380973 MGI:2685766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	D330037H05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207214 MGI:2443114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4930478M13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74984 MGI:1922234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Dip2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239667 MGI:2145977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11908 MGI:1298366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930478A21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75002 MGI:1922252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432981 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432981 MGI:3646319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 85 ESTs, 2 Proteins

name	Mettl7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70152 MGI:1916523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000058057 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668178 MGI:3710670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC554292 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:554292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubie (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:393082 MGI:3026615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yghl1-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc11a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18174 MGI:1345279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432982 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432982 MGI:3646320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Letmd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68614 MGI:1915864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC035295 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207785 MGI:2386852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcfcp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21422 MGI:98509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pou6f1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19009 MGI:102935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dazap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23994 MGI:1344344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC004728 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207818 MGI:2448476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Bin2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668218 MGI:3611448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins

name	Ela1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109901 MGI:95314
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galnt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207839 MGI:1891640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc4a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59033 MGI:1928745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scn8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20273 MGI:103169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668225 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668225 MGI:3646919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 15 Proteins

name	Ankrd33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208258 MGI:2443398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acvrl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11482 MGI:1338946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acvr1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11479 MGI:1338944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grasp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56149 MGI:1860303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15370 MGI:1352454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9430023L20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68118 MGI:1915368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030408B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77717 MGI:1924967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt80 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74127 MGI:1921377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110310 MGI:96704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt85 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53622 MGI:1859268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt83 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406219 MGI:3665486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700011A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66322 MGI:1913572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430421N21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16679 MGI:3690448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG574415 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574415 MGI:3646630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Krt84 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16680 MGI:96700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114566 MGI:2149248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732456N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239673 MGI:3045312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt75 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109052 MGI:1923500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432985 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432985 MGI:3646316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	C230021P08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49457862 GeneID:380969 MGI:3609653
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Riken cDNA C230021P08 gene transcript_id : NM_001001884.1

name	4930556P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312917 GeneID:75284 MGI:1922534
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930556P03 gene transcript_id : NM_029236.1

name	Faim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781819 GeneID:72393 MGI:1919643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas apoptotic inhibitory molecule 2 transcript_id : NM_001038658.1

name	Faim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781818 GeneID:72393 MGI:1919643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas apoptotic inhibitory molecule 2 transcript_id : NM_028224.3

name	Aqp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560619 GeneID:11827 MGI:1096865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 2 transcript_id : NM_009699.2

name	Aqp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117940061 GeneID:11830 MGI:106215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 5 transcript_id : NM_009701.4

name	Aqp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802655 GeneID:11831 MGI:1341204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aquaporin 6 transcript_id : NM_175087.3

name	Racgap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384974 GeneID:26934 MGI:1349423
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rac GTPase-activating protein 1 transcript_id : NM_012025.4

name	LOC100043473 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266812 GeneID:100043473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043473 transcript_id : XM_001480820.1

name	Accn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45433492 GeneID:11419 MGI:1194915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amiloride-sensitive cation channel 2, neuronal transcript_id : NM_009597.1

name	Smarcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347395 GeneID:83797 MGI:1933623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 transcript_id : NM_031842.2

name	Gpd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542905 GeneID:14555 MGI:95679
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerol-3-phosphate dehydrogenase 1 (soluble) transcript_id : NM_010271.2

name	2310016M24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345368 GeneID:66379 MGI:1913629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310016M24 gene transcript_id : NM_183256.2

name	Lass5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980682 GeneID:71949 MGI:1919199
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : longevity assurance homolog 5 (S. cerevisiae) transcript_id : NM_028015.2

name	Lima1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12746445 GeneID:65970 MGI:1920992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain and actin binding 1 transcript_id : NM_023063.1

name	LOC100042918 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266762 GeneID:100042918
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to ubiquinol-cytochrome c reductase hinge protein transcript_id : XM_001479066.1

name	1700030F18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388040 GeneID:72277 MGI:1919527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700030F18 gene transcript_id : NM_028180.2

name	Gm920 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266764 GeneID:380973 MGI:2685766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : gene model 920, (NCBI) transcript_id : XM_354882.5

name	D330037H05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358931 GeneID:207214 MGI:2443114
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330037H05 gene transcript_id : NM_001080948.1

name	D330037H05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358933 GeneID:207214 MGI:2443114
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330037H05 gene transcript_id : NM_001024526.2

name	4930478M13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266815 GeneID:74984 MGI:1922234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4930478M13 gene transcript_id : XM_001480834.1

name	Dip2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362828 GeneID:239667 MGI:2145977
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DIP2 disco-interacting protein 2 homolog B (Drosophila) transcript_id : NM_172819.2

name	Atf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86604723 GeneID:11908 MGI:1298366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 1 transcript_id : NM_007497.3

name	4930478A21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802437 GeneID:75002 MGI:1922252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930478A21 gene transcript_id : NM_183109.3

name	EG432981 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266766 GeneID:432981 MGI:3646319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 85 ESTs, 2 Proteins product : predicted gene, EG432981 transcript_id : XM_912766.3

name	Mettl7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374935 GeneID:70152 MGI:1916523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase like 7A transcript_id : NM_027334.3

name	ENSMUSG00000058057 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490372 GeneID:668178 MGI:3710670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, ENSMUSG00000058057 transcript_id : NM_001081471.1

name	LOC554292 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142351323 GeneID:554292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UbiE-YGHL1 fusion protein transcript_id : NM_001024672.3

name	Ubie (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098177 GeneID:393082 MGI:3026615
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UbiE-YGHL1 fusion protein transcript_id : NM_199477.2

name	Yghl1-4 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51100969 GeneID:380975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yghl1-4 transcript_id : NM_001002900.1

name	Slc11a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677988 GeneID:18174 MGI:1345279
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 transcript_id : NM_008732.1

name	EG432982 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376432 GeneID:432982 MGI:3646320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432982 transcript_id : NM_001034883.2

name	Letmd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527321 GeneID:68614 MGI:1915864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LETM1 domain containing 1 transcript_id : NM_134093.1

name	BC035295 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130114 GeneID:207785 MGI:2386852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC035295 transcript_id : NM_153407.2

name	Tcfcp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130825 GeneID:21422 MGI:98509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor CP2 transcript_id : NM_033476.2

name	Pou6f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892217 GeneID:19009 MGI:102935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 6, transcription factor 1 transcript_id : NM_010127.3

name	Dazap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982752 GeneID:23994 MGI:1344344
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DAZ associated protein 2 transcript_id : NM_011873.2

name	BC004728 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76443690 GeneID:207818 MGI:2448476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC004728 transcript_id : NM_001033872.1

name	BC004728 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76443688 GeneID:207818 MGI:2448476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC004728 transcript_id : NM_174992.3

name	Bin2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266769 GeneID:668218 MGI:3611448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : bridging integrator 2 transcript_id : XM_001000082.2

name	Ela1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239380 GeneID:109901 MGI:95314
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elastase 1, pancreatic transcript_id : NM_033612.1

name	Galnt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358967 GeneID:207839 MGI:1891640
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 transcript_id : NM_172451.2

name	Slc4a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494231 GeneID:59033 MGI:1928745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4 (anion exchanger), member 8 transcript_id : NM_021530.2

name	Scn8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117414173 GeneID:20273 MGI:103169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, voltage-gated, type VIII, alpha transcript_id : NM_001077499.1

name	EG668225 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266817 GeneID:668225 MGI:3646919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 15 Proteins product : predicted gene, EG668225 transcript_id : XM_001000159.2

name	Ankrd33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450138 GeneID:208258 MGI:2443398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 33 transcript_id : NM_144790.1

name	Acvrl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108936964 GeneID:11482 MGI:1338946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activin A receptor, type II-like 1 transcript_id : NM_009612.2

name	Acvr1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366071 GeneID:11479 MGI:1338944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activin A receptor, type 1B transcript_id : NM_007395.3

name	Grasp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:103472018 GeneID:56149 MGI:1860303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein transcript_id : NM_019518.3

name	Nr4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754215 GeneID:15370 MGI:1352454
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 4, group A, member 1 transcript_id : NM_010444.1

name	9430023L20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362390 GeneID:68118 MGI:1915368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9430023L20 gene transcript_id : NM_026566.2

name	6030408B16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352724 GeneID:77717 MGI:1924967
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030408B16 gene transcript_id : NM_001033182.2

name	Krt80 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249089 GeneID:74127 MGI:1921377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 80 transcript_id : NM_028770.2

name	Krt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981434 GeneID:110310 MGI:96704
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 7 transcript_id : NM_033073.2

name	Krt85 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980831 GeneID:53622 MGI:1859268
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 85 transcript_id : NM_016879.2

name	Krt83 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092290 GeneID:406219 MGI:3665486
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 83 transcript_id : NM_001003668.1

name	1700011A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803570 GeneID:66322 MGI:1913572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700011A15 gene transcript_id : NM_025487.2

name	5430421N21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371366 GeneID:16679 MGI:3690448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430421N21 gene transcript_id : NM_010667.2

name	Krt84 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33563237 GeneID:16680 MGI:96700
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 84 transcript_id : NM_008474.1

name	Krt82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475741 GeneID:114566 MGI:2149248
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 82 transcript_id : NM_053249.2

name	4732456N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351592 GeneID:239673 MGI:3045312
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732456N10 gene transcript_id : NM_177717.3

name	Krt75 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367706 GeneID:109052 MGI:1923500
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 75 transcript_id : NM_133357.2

name	4930556P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312918 GeneID:75284 MGI:1922534
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC75284 protein_id : NP_083512.1

name	Faim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781820 GeneID:72393 MGI:1919643
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; neural membrane protein 35 product : lifeguard isoform 2 protein_id : NP_001033747.1

name	Faim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328312 GeneID:72393 MGI:1919643
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; neural membrane protein 35 product : lifeguard isoform 1 protein_id : NP_082500.2

name	Aqp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560620 CCDS:CCDS27822.1 GeneID:11827 MGI:1096865
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence TAS] GO_process : GO:0006810 - transport [Evidence IEA]; GO:0006833 - water transport [Evidence TAS] codon_start : 1 exception : mismatches in translation product : aquaporin 2 protein_id : NP_033829.2

name	Aqp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857757 CCDS:CCDS27823.1 GeneID:11830 MGI:106215
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0009925 - basal plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005902 - microvillus [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence TAS] GO_process : GO:0006810 - transport [Evidence IEA]; GO:0006833 - water transport [Evidence TAS] codon_start : 1 product : aquaporin 5 protein_id : NP_033831.1

name	Aqp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201966 CCDS:CCDS27824.1 GeneID:11831 MGI:1341204
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA]; GO:0015250 - water channel activity [Evidence TAS] GO_process : GO:0006833 - water transport [Evidence TAS] codon_start : 1 product : aquaporin 6 protein_id : NP_780296.1

name	Racgap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755266 CCDS:CCDS27825.1 GeneID:26934 MGI:1349423
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0043014 - alpha-tubulin binding [Evidence ISS]; GO:0048487 - beta-tubulin binding [Evidence ISS]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0043015 - gamma-tubulin binding [Evidence ISS]; GO:0005096 - GTPase activator activity [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0000915 - cytokinesis, contractile ring formation [Evidence ISS]; GO:0007108 - cytokinesis, initiation of separation [Evidence ISS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0007405 - neuroblast proliferation [Evidence IEP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence ISS] codon_start : 1 product : Rac GTPase-activating protein 1 protein_id : NP_036155.1

name	LOC100043473 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266813 GeneID:100043473
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480870.1

name	Accn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45433493 CCDS:CCDS27826.1 GeneID:11419 MGI:1194915
definition	GO_component : GO:0043198 - dendritic shaft [Evidence ISS]; GO:0043197 - dendritic spine [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence ISS]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0015280 - amiloride-sensitive sodium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence IDA] [Evidence IMP]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0015077 - monovalent inorganic cation transporter activity [Evidence ISS]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0008306 - associative learning [Evidence IMP]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence IDA] [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007613 - memory [Evidence IMP]; GO:0015672 - monovalent inorganic cation transport [Evidence ISS]; GO:0001101 - response to acid [Evidence IMP] [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : acid sensing ion channel; degenerin 2 product : amiloride-sensitive cation channel 2, neuronal protein_id : NP_033727.1

name	Smarcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347396 GeneID:83797 MGI:1933623
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 protein_id : NP_114030.2

name	Gpd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753966 CCDS:CCDS27828.1 GeneID:14555 MGI:95679
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0009331 - glycerol-3-phosphate dehydrogenase complex [Evidence TAS] GO_function : GO:0004367 - glycerol-3-phosphate dehydrogenase (NAD+) activity [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016614 - oxidoreductase activity, acting on CH-OH group of donors [Evidence IEA]; GO:0016616 - oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006094 - gluconeogenesis [Evidence IMP]; GO:0046168 - glycerol-3-phosphate catabolism [Evidence IEA]; GO:0006072 - glycerol-3-phosphate metabolism [Evidence IMP] codon_start : 1 note : glycerolphosphate dehydrogenase 1, cytoplasmic adult; glycerol phosphate dehydrogenase 1, cytoplasmic adult product : glycerol-3-phosphate dehydrogenase 1 (soluble) protein_id : NP_034401.1

name	2310016M24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304032 GeneID:66379 MGI:1913629
definition	codon_start : 1 product : hypothetical protein LOC66379 protein_id : NP_899079.1

name	Lass5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312638 CCDS:CCDS27830.1 GeneID:71949 MGI:1919199
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0046513 - ceramide biosynthesis [Evidence IDA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : longevity assurance homolog 5 protein_id : NP_082291.1

name	Lima1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746446 GeneID:65970 MGI:1920992
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence ISS]; GO:0001725 - stress fiber [Evidence ISS] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence ISS]; GO:0003785 - actin monomer binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0051017 - actin filament bundle formation [Evidence ISS]; GO:0008150 - biological_process [Evidence ND]; GO:0030835 - negative regulation of actin filament depolymerization [Evidence ISS]; GO:0031529 - ruffle organization and biogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : epithelial protein lost in neoplasm-a product : epithelial protein lost in neoplasm protein_id : NP_075550.1

name	LOC100042918 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266763 GeneID:100042918
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479116.1

name	1700030F18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249212 GeneID:72277 MGI:1919527
definition	codon_start : 1 product : hypothetical protein LOC72277 protein_id : NP_082456.1

name	Gm920 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266765 GeneID:380973 MGI:2685766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_354882.5

name	D330037H05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358932 GeneID:207214 MGI:2443114
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC207214 isoform 2 protein_id : NP_001074417.1

name	D330037H05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358934 GeneID:207214 MGI:2443114
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC207214 isoform 1 protein_id : NP_001019697.2

name	4930478M13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266816 GeneID:74984 MGI:1922234
definition	codon_start : 1 product : hypothetical protein LOC74984 protein_id : XP_001480884.1

name	Dip2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370224 CCDS:CCDS27831.1 GeneID:239667 MGI:2145977
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DIP2 disco-interacting protein 2 homolog B protein_id : NP_766407.1

name	Atf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86604724 CCDS:CCDS27832.1 GeneID:11908 MGI:1298366
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : activating transcription factor 1 protein_id : NP_031523.3

name	4930478A21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625851 GeneID:75002 MGI:1922252
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC75002 protein_id : NP_898932.2

name	EG432981 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266767 GeneID:432981 MGI:3646319
definition	codon_start : 1 product : similar to protein translocation complex beta subunit protein_id : XP_917859.3

name	Mettl7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563290 CCDS:CCDS27833.1 GeneID:70152 MGI:1916523
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : methyltransferase like 7A protein_id : NP_081610.2

name	ENSMUSG00000058057 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490373 GeneID:668178 MGI:3710670
definition	codon_start : 1 product : UbiE3 protein protein_id : NP_001074940.1

name	LOC554292 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:67003561 CCDS:CCDS27835.1 GeneID:554292
definition	codon_start : 1 note : UbiE2-Hig1-4 fusion protein product : UbiE-YGHL1 fusion protein protein_id : NP_001019843.1

name	Ubie (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098178 CCDS:CCDS27836.1 GeneID:393082 MGI:3026615
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : UbiE protein protein_id : NP_955771.2

name	Yghl1-4 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51100970 GeneID:380975
definition	codon_start : 1 note : YGHL1 homolog product : Yghl1-4 protein protein_id : NP_001002900.1

name	Slc11a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677989 GeneID:18174 MGI:1345279
definition	GO_component : GO:0012505 - endomembrane system [Evidence IDA]; GO:0005768 - endosome [Evidence IDA]; GO:0010008 - endosome membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0015087 - cobalt ion transporter activity [Evidence IDA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006824 - cobalt ion transport [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : potential transporter note : natural resistance-associated macrophage protein 2; microcytic anemia; microcytic anemia, viable anaemia product : solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2 protein_id : NP_032758.1

name	EG432982 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702230 GeneID:432982 MGI:3646320
definition	codon_start : 1 product : hypothetical protein LOC432982 protein_id : NP_001030055.1

name	Letmd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527322 CCDS:CCDS27838.1 GeneID:68614 MGI:1915864
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : cervical cancer receptor protein_id : NP_598854.1

name	BC035295 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510287 CCDS:CCDS27839.1 GeneID:207785 MGI:2386852
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : TGF-beta induced apoptosis protein 12 product : cDNA sequence BC035295 protein_id : NP_700456.1

name	Tcfcp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15628025 CCDS:CCDS27840.1 GeneID:21422 MGI:98509
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence TAS] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription factor CP2 protein_id : NP_258437.1

name	Pou6f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753746 GeneID:19009 MGI:102935
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : POU domain, class 6, transcription factor 1 protein_id : NP_034257.1

name	Dazap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982753 CCDS:CCDS27841.1 GeneID:23994 MGI:1344344
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : proline rich protein expressed in brain product : DAZ associated protein 2 protein_id : NP_036003.2

name	BC004728 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76443691 CCDS:CCDS27842.1 GeneID:207818 MGI:2448476
definition	codon_start : 1 note : small cell adhesion glycoprotein; small cell transmembrane and glycosylated protein product : small trans-membrane and glycosylated protein protein_id : NP_001029044.1

name	BC004728 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76443689 CCDS:CCDS27842.1 GeneID:207818 MGI:2448476
definition	codon_start : 1 note : small cell adhesion glycoprotein; small cell transmembrane and glycosylated protein product : small trans-membrane and glycosylated protein protein_id : NP_778157.2

name	Bin2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266770 GeneID:668218 MGI:3611448
definition	codon_start : 1 product : similar to Bridging integrator 2 protein_id : XP_001000082.2

name	Ela1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239381 GeneID:109901 MGI:95314
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008125 - pancreatic elastase I activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : elastase 1, pancreatic protein_id : NP_291090.1

name	Galnt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369605 CCDS:CCDS27843.1 GeneID:207839 MGI:1891640
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0004653 - polypeptide N-acetylgalactosaminyltransferase activity [Evidence IDA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : N-acetylgalactosaminyltransferase T-6 product : UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 protein_id : NP_766039.1

name	Slc4a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111494232 GeneID:59033 MGI:1928745
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 note : sodium bicarbonate cotransporter isoform 3 kNBC-3 product : solute carrier family 4 (anion exchanger), member 8 protein_id : NP_067505.2

name	Scn8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117414174 GeneID:20273 MGI:103169
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0001518 - voltage-gated sodium channel complex [Evidence IC] [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005248 - voltage-gated sodium channel activity [Evidence NAS] [Evidence ISS] GO_process : GO:0007628 - adult walking behavior [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007517 - muscle development [Evidence IMP]; GO:0006814 - sodium ion transport [Evidence NAS] [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : voltage-gated sodium channel type VIII alpha protein product : sodium channel, voltage-gated, type VIII, alpha protein_id : NP_001070967.1

name	EG668225 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398922 GeneID:668225 MGI:3646919
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000159.1

name	Ankrd33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450139 CCDS:CCDS27845.1 GeneID:208258 MGI:2443398
definition	codon_start : 1 product : ankyrin repeat domain 33 protein_id : NP_659039.1

name	Acvrl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:108936965 GeneID:11482 MGI:1338946
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016361 - activin receptor activity, type I [Evidence ISS]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005024 - transforming growth factor beta receptor activity [Evidence ISS] [Evidence IEA]; GO:0004675 - transmembrane receptor protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IDA] codon_start : 1 note : activin receptor-like kinase-1 product : activin A receptor, type II-like 1 protein_id : NP_033742.2

name	Acvr1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680630 CCDS:CCDS27846.1 GeneID:11479 MGI:1338944
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0048185 - activin binding [Evidence IPI]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004675 - transmembrane receptor protein serine/threonine kinase activity [Evidence TAS] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS]; GO:0009790 - embryonic development [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0001942 - hair follicle development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence ISS] codon_start : 1 product : activin A receptor, type 1B protein_id : NP_031421.1

name	Grasp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:103472019 CCDS:CCDS27847.1 GeneID:56149 MGI:1860303
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005641 - nuclear envelope lumen [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006886 - intracellular protein transport [Evidence ISS]; GO:0007165 - signal transduction [Evidence IPI] codon_start : 1 note : GRP1-associated scaffold protein product : GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein protein_id : NP_062391.3

name	Nr4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754216 CCDS:CCDS27848.1 GeneID:15370 MGI:1352454
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0043154 - negative regulation of caspase activity [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : hormone receptor product : nuclear receptor subfamily 4, group A, member 1 protein_id : NP_034574.1

name	9430023L20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311929 CCDS:CCDS27849.1 GeneID:68118 MGI:1915368
definition	codon_start : 1 product : hypothetical protein LOC68118 protein_id : NP_080842.1

name	6030408B16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701688 GeneID:77717 MGI:1924967
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC77717 protein_id : NP_001028354.1

name	Krt80 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249090 GeneID:74127 MGI:1921377
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : keratin 80 protein_id : NP_083046.2

name	Krt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14861854 CCDS:CCDS27851.1 GeneID:110310 MGI:96704
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : sarcolectin; Cytokeratin 7 product : keratin complex 2, basic, gene 7 protein_id : NP_149064.1

name	Krt85 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980832 GeneID:53622 MGI:1859268
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : keratin complex 2, basic, gene 18 product : keratin complex 2, basic gene 18 protein_id : NP_058575.2

name	Krt83 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092291 CCDS:CCDS27852.1 GeneID:406219 MGI:3665486
definition	codon_start : 1 exception : mismatches in translation note : type-II keratin Kb25 product : keratin complex 2, basic, gene 25 protein_id : NP_001003668.1

name	1700011A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384908 GeneID:66322 MGI:1913572
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66322 protein_id : NP_079763.1

name	5430421N21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315985 GeneID:16679 MGI:3690448
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : keratin 86 product : keratin complex 2, basic, gene 10 protein_id : NP_034797.1

name	Krt84 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563238 CCDS:CCDS27853.1 GeneID:16680 MGI:96700
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : keratin complex 2, gene 16 product : keratin complex 2, basic, gene 16 protein_id : NP_032500.1

name	Krt82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21357425 CCDS:CCDS27854.1 GeneID:114566 MGI:2149248
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : keratin complex 2, basic, gene 20 protein_id : NP_444479.1

name	4732456N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244176 CCDS:CCDS27855.1 GeneID:239673 MGI:3045312
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein 4732456N10 protein_id : NP_808385.1

name	Krt75 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789317 CCDS:CCDS27856.1 GeneID:109052 MGI:1923500
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : cytokeratin KRT2-6HF product : keratinocyte associated protein 1 protein_id : NP_579935.1

name	LOC545137 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266811 GeneID:545137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 ESTs, 5 Proteins product : similar to ubiquitously expressed transcript pseudo : _no_value transcript_id : XR_034848.1

name	LOC100043481 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266814 GeneID:100043481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 6 Proteins product : similar to ribosomal protein L37 pseudo : _no_value transcript_id : XR_034863.1

name	EG574415 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872166 GeneID:574415 MGI:3646630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG574415 pseudo : _no_value transcript_id : NR_002872.1

name	EG432985 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872160 GeneID:432985 MGI:3646316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432985 pseudo : _no_value transcript_id : NR_002868.1

clone name	MSMg01-445L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191A21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-456M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449P10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-231C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232E10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-232G11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-363F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-476A08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-370P05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-460H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526M16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-420M06
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-272H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183P05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-252P23.b	B6Ng01-252P23.g
ACC	GA059848	GA059849
length	1,102	479
definition	B6Ng01-252P23.b	B6Ng01-252P23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(100,426,480 - 100,427,583)	(100,283,353 - 100,283,837)
sequence	gaattccaggacagacaaggctattcagagagaccctgtatctgagagga gagggaggagaagaaaaacaaaactggtataaactcttattcccctccaa gacttactttgacattgtaactttagtacttgggcagtcattccatgaga gagcaaatgcttccacgtccaggaccataaataatcaagtaaataaaatt ataacagagatcttttacatttcataatgttttatgatttaaaccatctt gtactcatgctttatttcagttaaaataatagcaatagtaggatggggga atgtaactccatagtgccagtccatcactctttcccaaggtcccatcagc taagagcgtgcacctgaaacctcagcacttgggcttgagaggcagggaga ctggaagtttgcagtcatcagggatagggagttccaggccaggctggaat acattgcaaccttgtctcaacaaacaaacaattcaaccatacaataacaa aacacttaaccagcatttgtgtgttaggccctatggaaaatgcttgacat cagtgcttctcaattcctttgaacaggggtcaagccctttcacaagggtt gcatattggatatttacattgctgttcacaacagtagcaaaattagagtt aggaaagagcaatgaaataattttaaagttggggagtcaccacaacacga ggaactgtattaaagggctgcggcattgggaaggttgagaaccgctgtct tccataaatattaccaattcaaagttggacatagtgacacaggggtgtag tgatcacatgattgaacctagttacatagagaaacccaggccgaaaaatg ttaccacgggggctggggatatggcccaatcctttgagagcattgctgct ctagcagagggcccagggttctgttcccagcggccacatggcccctccca cctgcctgtaaaatccgaagcagggaaatccacagagaaagcagctgaga agtctcaaggctggaaaagggagtgcccgaagagatgtaaaattccttta agtcattgaaaatactctggaactagaaagtgctatgctggccaacattg tc	ttttcagaagcaagaagataaaataatgacgctttccagaaagtaggtag acatgcagttttactaaatgaagtggctcagactcagagaggggagtacc gtatcttctctcatctgcagatcctatatttgaatttttatatatgtgta tacaaagccatgaaaagaagagagaggtattaaggaaggaaataagagag agaaagacggtaacaaaatatatgtgacacaagagtggaaaggggacact ttggaggggtttaagggtccaaggagggtcagggaagatggaagaaggag atgccagaggaggatcaccagaaacacagtatgaactaccacaataaagg ccatcactttgtatactaatttaaaaacaaagaagggcctgcaagatggc tcagagggcaaaggtgcttgcaaccaaatctaaggatctgagttcatgtc ttggaactcctgttgggggggaggggaga
quality values	Open. Hide. 58 36 22 29 62 62 31 14 62 62 35 38 38 62 47 56 51 47 62 62 62 62 62 47 62 41 37 62 62 62 62 62 44 59 56 38 49 62 46 51 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 59 62 42 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 49 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 35 41 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 62 54 62 62 62 62 62 58 58 58 58 58 58 52 58 58 58 58 58 58 54 54 58 58 47 54 58 58 58 58 58 54 54 58 54 58 58 58 58 58 58 58 58 58 58 58 54 52 54 54 54 58 58 58 54 58 54 52 52 52 52 54 58 48 52 52 43 58 48 58 54 51 58 58 58 58 51 54 51 58 58 58 51 41 53 51 58 51 51 54 46 58 58 58 58 58 58 50 40 53 25 34 34 50 51 51 58 58 58 51 54 40 58 58 39 46 41 54 53 58 50 58 51 58 51 53 58 58 51 50 58 31 49 49 51 49 58 51 58 51 50 50 41 47 58 58 51 40 58 53 58 53 53 51 58 58 58 47 31 51 50 50 51 49 50 51 50 46 39 41 51 47 39 39 41 33 36 27 44 54 50 49 54 46 37 54 51 54 49 50 37 53 49 50 32 49 41 39 53 54 41 54 42 44 35 13 44 32 33 42 54 28 54 32 46 18 33 45 45 51 29 40 53 53 32 49 24 31 29 54 47 44 33 34 45 40 37 44 19 49 53 37 40 31 49 40 30 40 46 32 40 21 25 29 34 31 31 32 51 24 33 19 39 24 19 49 53 52 30 53 31 37 31 42 45 30 31 31 29 31 31 31 42 38 21 29 31 29 27 29 31 34 31 33 43 32 23 32 26 32 26 24 34 36 45 51 9 7 40 31 15 14 27 30 9 12 43 46 46 46 25 12 28 32 31 27 24 18 21 29 15 42 46 46 31 36 31 32 48 46 30 32 26 31 31 18 21 7 41 36 29 20 12 13 32 8 31 25 27 34 22 41 23 31 31 31 33 43 31 30 31 34 32 32 34 32 25 34 26 7 17 8 28 23 16 29 20 25 14 32 12 33 24 25 33 31 10 9 11 13 17 27 19 32 14 14 26 15 21 22 19 31 16 12 4 22 30 19 11 15 32 22 12 15 11 20 30 21 14 15 21 21 33 43 48 34 32 20 29 27 25 19 15 32 16 25 43 9 31 43 15 25 13 26 18 21 12 9 32 26 34 40 18 18 22 16 10 10 28 24 25 30 13 8 4 16 4 7 13 5 10 27 10 26 20 9 15 10 40 28 9 25 30 10 3 4 14 16 23 15 21 6 18 10 4 5 5 13 24 13 14 17 38 38 18 13 16 6 17 14 28 23 7 6 27 7 15 7 9 12 8 17 28 26 12 17 16 19 17 12 18 6 17 8 13 7 21 11 5 13 27 14 5 17 10 6 6 16 6 16 8 18 7 8 7 8 6 4 7 6 20 16 16 10 12	Open. Hide. 62 62 62 46 49 21 23 43 28 25 32 28 28 48 62 62 62 59 39 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 56 54 62 62 56 56 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 54 54 62 62 62 54 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 49 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 58 58 58 58 54 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 58 49 42 58 58 58 49 27 19

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_100426480_100427583
seq2: B6Ng01-252P23.b_46_1147 (reverse)

seq1  GACAATGTTGCGCAGCCATTAGCAC-TTCTAGTCCAAGAGTATTTTCAAT  49
      ||||||||||  ||||   |||||| ||||||| | ||||||||||||||
seq2  GACAATGTTGGCCAGC--ATAGCACTTTCTAGTTCCAGAGTATTTTCAAT  48

seq1  GACCTAAAAGGAAATTTTACATCTCTTCGGGCACTCCCCTTTCCAGCCTG  99
      ||| ||||  | |||||||||||||||||||||||||| |||||||||| 
seq2  GACTTAAA--GGAATTTTACATCTCTTCGGGCACTCCCTTTTCCAGCCTT  96

seq1  GGAACTTCCTCAGCTGCTTTCTCTGTGGATTTCCCTGCTTCGGATTTTAC  149
      |  |||| ||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACTT-CTCAGCTGCTTTCTCTGTGGATTTCCCTGCTTCGGATTTTAC  145

seq1  AGGCAGGTGGGAGGGGCCATGTGGCCGCTGGGAACAGAA-CCTGGGCCCT  198
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  AGGCAGGTGGGAGGGGCCATGTGGCCGCTGGGAACAGAACCCTGGGCCCT  195

seq1  CTGCTAGAGCAGCAATGCTCTC-AAGGATTGGGCCATATCCCCAGCCCCC  247
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  CTGCTAGAGCAGCAATGCTCTCAAAGGATTGGGCCATATCCCCAGCCCCC  245

seq1  GTGGTAACATTTTTCGGCCTGGGTTTCTCTATGTAACTAGGTTCAATCAT  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTAACATTTTTCGGCCTGGGTTTCTCTATGTAACTAGGTTCAATCAT  295

seq1  GTGATCACTACACCCCTGTGTCACTATGTCCAACTTTGAATTGGTAATAT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATCACTACACCCCTGTGTCACTATGTCCAACTTTGAATTGGTAATAT  345

seq1  TTATGGAAGACAGCGGTTCTCAACCTTCCCAATGCCGCAGCCCTTTAATA  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGGAAGACAGCGGTTCTCAACCTTCCCAATGCCGCAGCCCTTTAATA  395

seq1  CAGTTCCTCGTGTTGTGGTGACTCCCCAACTTTAAAATTATTTCATTGCT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTCCTCGTGTTGTGGTGACTCCCCAACTTTAAAATTATTTCATTGCT  445

seq1  CTTTCCTAACTCTAATTTTGCTACTGTTGTGAACAGCAATGTAAATATCC  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCCTAACTCTAATTTTGCTACTGTTGTGAACAGCAATGTAAATATCC  495

seq1  AATATGCAACCCTTGTGAAAGGGCTTGACCCCTGTTCAAAGGAATTGAGA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATGCAACCCTTGTGAAAGGGCTTGACCCCTGTTCAAAGGAATTGAGA  545

seq1  AGCACTGATGTCAAGCATTTTCCATAGGGCCTAACACACAAATGCTGGTT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACTGATGTCAAGCATTTTCCATAGGGCCTAACACACAAATGCTGGTT  595

seq1  AAGTGTTTTGTTATTGTATGGTTGAATTGTTTGTTTGTTGAGACAAGGTT  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGTTTTGTTATTGTATGGTTGAATTGTTTGTTTGTTGAGACAAGGTT  645

seq1  GCAATGTATTCCAGCCTGGCCTGGAACTCCCTATCCCTGATGACTGCAAA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAATGTATTCCAGCCTGGCCTGGAACTCCCTATCCCTGATGACTGCAAA  695

seq1  CTTCCAGTCTCCCTGCCTCTCAAGCCCAAGTGCTGAGGTTTCAGGTGCAC  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCAGTCTCCCTGCCTCTCAAGCCCAAGTGCTGAGGTTTCAGGTGCAC  745

seq1  GCTCTTAGCTGATGGGACCTTGGGAAAGAGTGATGGACTGGCACTATGGA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTTAGCTGATGGGACCTTGGGAAAGAGTGATGGACTGGCACTATGGA  795

seq1  GTTACATTCCCCCATCCTACTATTGCTATTATTTTAACTGAAATAAAGCA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTACATTCCCCCATCCTACTATTGCTATTATTTTAACTGAAATAAAGCA  845

seq1  TGAGTACAAGATGGTTTAAATCATAAAACATTATGAAATGTAAAAGATCT  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTACAAGATGGTTTAAATCATAAAACATTATGAAATGTAAAAGATCT  895

seq1  CTGTTATAATTTTATTTACTTGATTATTTATGGTCCTGGACGTGGAAGCA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTATAATTTTATTTACTTGATTATTTATGGTCCTGGACGTGGAAGCA  945

seq1  TTTGCTCTCTCATGGAATGACTGCCCAAGTACTAAAGTTACAATGTCAAA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCTCTCTCATGGAATGACTGCCCAAGTACTAAAGTTACAATGTCAAA  995

seq1  GTAAGTCTTGGAGGGGAATAAGAGTTTATACCAGTTTTGTTTTTCTTCTC  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGTCTTGGAGGGGAATAAGAGTTTATACCAGTTTTGTTTTTCTTCTC  1045

seq1  CTCCCTCTCCTCTCAGATACAGGGTCTCTCTGAATAGCCTTGTCTGTCCT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCTCTCCTCTCAGATACAGGGTCTCTCTGAATAGCCTTGTCTGTCCT  1095

seq1  GGAATTC  1104
      |||||||
seq2  GGAATTC  1102

seq1: chr15_100283353_100283837
seq2: B6Ng01-252P23.g_67_551

seq1  GAATTCTTTTCAGAAGCAAGAAGATAAAATAATGACGCTTTCCAGAAAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTTCAGAAGCAAGAAGATAAAATAATGACGCTTTCCAGAAAGT  50

seq1  AGGTAGACATGCAGTTTTACTAAATGAAGTGGCTCAGACTCAGAGAGGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTAGACATGCAGTTTTACTAAATGAAGTGGCTCAGACTCAGAGAGGGG  100

seq1  AGTACCGTATCTTCTCTCATCTGCAGATCCTATATTTGAATTTTTATATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACCGTATCTTCTCTCATCTGCAGATCCTATATTTGAATTTTTATATA  150

seq1  TGTGTATACAAAGCCATGAAAAGAAGAGAGAGGTATTAAGGAAGGAAATA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTATACAAAGCCATGAAAAGAAGAGAGAGGTATTAAGGAAGGAAATA  200

seq1  AGAGAGAGAAAGACGGTAACAAAATATATGTGACACAAGAGTGGAAAGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAGAGAAAGACGGTAACAAAATATATGTGACACAAGAGTGGAAAGGG  250

seq1  GACACTTTGGAGGGGTTTAAGGGTCCAAGGAGGGTCAGGGAAGATGGAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACTTTGGAGGGGTTTAAGGGTCCAAGGAGGGTCAGGGAAGATGGAAG  300

seq1  AAGGAGATGCCAGAGGAGGATCACCAGAAACACAGTATGAACTACCACAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAGATGCCAGAGGAGGATCACCAGAAACACAGTATGAACTACCACAA  350

seq1  TAAAGGCCATCACTTTGTATACTAATTTAAAAACAAAGAAGGGCCTGCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGGCCATCACTTTGTATACTAATTTAAAAACAAAGAAGGGCCTGCAA  400

seq1  GATGGCTCAGAGGGCAAAGGTGCTTGCAACCAAATCTAAGGATCTGAGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGCTCAGAGGGCAAAGGTGCTTGCAACCAAATCTAAGGATCTGAGTT  450

seq1  CATGTCTTGGAACTCCTGTTGGGGGGGAGGGGAGA  485
      |||||||||||||||||||||||||||||||||||
seq2  CATGTCTTGGAACTCCTGTTGGGGGGGAGGGGAGA  485

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information