MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-275D09
Chromosome	15 (Build37)
Map Location	102,482,531 - 102,610,239
singlet/doublet	doublet
Overlap gene	LOC100043600, Atp5g2, Calcoco1
Upstream gene	Krt6b, Krt6a, Krt5, Krt71, Krt74, Krt72, Krt73, Krt2, LOC100043001, Krt1, Krt77, Krt76, Krt4, Krt79, Krt78, Krt8, Krt18, LOC676882, Eif4b, Tenc1, Spryd3, Igfbp6, Soat2, Csad, Zfp740, Itgb7, Rarg, D15Mgi27, Espl1, Pfdn5, Myg1, Aaas, Sp7, Sp1, Amhr2, Prr13, Pcbp2, Map3k12, Tarbp2, Npff, Atf7
Downstream gene	LOC637762, LOC100043050, Hoxc13, Hoxc12, Hoxc11, Hoxc10, Hoxc9, LOC100043060, Hoxc8, Hoxc6, Hoxc5, Hoxc4, LOC432989, Smug1, Cbx5, Hnrpa1, Nfe2, Copz1, Gpr84, Zfp385, Itga5, 1700006H03Rik, BC048502, LOC668321, Nckap1l, Pde1b, Ppp1r1a, Glycam1, LOC668327, LOC100043633
Link	Open Mouse BAC browser

Click to get alignment info.

name	Krt82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114566 MGI:2149248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732456N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239673 MGI:3045312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt75 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109052 MGI:1923500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432985 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432985 MGI:3646316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	EG432986 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432986 MGI:3646317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	EG406223 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406223 MGI:3646939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432987 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432987 MGI:3646318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16688 MGI:1333768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16687 MGI:1100845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110308 MGI:96702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt71 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56735 MGI:1861586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt74 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406222 MGI:3629975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105866 MGI:2146034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt73 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223915 MGI:3607712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16681 MGI:96699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043001 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Krt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16678 MGI:96698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt77 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406220 MGI:3588209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt76 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77055 MGI:1924305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16682 MGI:96701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt79 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223917 MGI:2385030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt78 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332131 MGI:1917529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16691 MGI:96705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16668 MGI:96692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC676882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Eif4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75705 MGI:95304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tenc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209039 MGI:2387586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spryd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223918 MGI:2446175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfbp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16012 MGI:96441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Soat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223920 MGI:1332226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246277 MGI:2180098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp740 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68744 MGI:1915994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16421 MGI:96616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rarg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19411 MGI:97858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	D15Mgi27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106073 MGI:2146241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Espl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105988 MGI:2146156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfdn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56612 MGI:1928753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60315 MGI:1929864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aaas (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223921 MGI:2443767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170574 MGI:2153568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20683 MGI:98372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amhr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110542 MGI:105062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prr13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66151 MGI:1913401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18521 MGI:108202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map3k12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26404 MGI:1346881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tarbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21357 MGI:103027
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npff (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54615 MGI:1891708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223922 MGI:2443472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043600 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Atp5g2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67942 MGI:1915192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Calcoco1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67488 MGI:1914738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC637762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100043050 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Hoxc13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15422 MGI:99560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15421 MGI:96194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxc11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109663 MGI:96193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxc10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209448 MGI:96192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxc9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15427 MGI:96199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043060 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Hoxc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15426 MGI:96198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15425 MGI:96197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15424 MGI:96196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15423 MGI:96195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432989 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Smug1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71726 MGI:1918976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12419 MGI:109372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hnrpa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15382 MGI:104820
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Nfe2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18022 MGI:97308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56447 MGI:1929063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr84 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80910 MGI:1934129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp385 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29813 MGI:1352495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itga5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16402 MGI:96604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700006H03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74174 MGI:1921424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 3 Proteins

name	BC048502 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223927 MGI:2652828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668321 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 205 ESTs, 4 Proteins pseudo : _no_value

name	Nckap1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105855 MGI:1926063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18574 MGI:97523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58200 MGI:1889595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glycam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14663 MGI:95759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 239 ESTs, 7 Proteins pseudo : _no_value

name	LOC100043633 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043633
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein

name	Krt82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475741 GeneID:114566 MGI:2149248
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 82 transcript_id : NM_053249.2

name	4732456N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351592 GeneID:239673 MGI:3045312
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732456N10 gene transcript_id : NM_177717.3

name	Krt75 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367706 GeneID:109052 MGI:1923500
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 75 transcript_id : NM_133357.2

name	EG406223 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092300 GeneID:406223 MGI:3646939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG406223 transcript_id : NM_001003670.1

name	EG432987 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921342 GeneID:432987 MGI:3646318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432987 transcript_id : NM_001004170.1

name	Krt6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195683 GeneID:16688 MGI:1333768
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 6B transcript_id : NM_010669.2

name	Krt6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607170 GeneID:16687 MGI:1100845
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 6A transcript_id : NM_008476.3

name	Krt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130335 GeneID:110308 MGI:96702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 5 transcript_id : NM_027011.2

name	Krt71 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910293 GeneID:56735 MGI:1861586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 71 transcript_id : NM_019956.1

name	Krt74 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092294 GeneID:406222 MGI:3629975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 74 transcript_id : NM_001003669.1

name	Krt72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47523976 GeneID:105866 MGI:2146034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 72 transcript_id : NM_213728.1

name	Krt73 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131071 GeneID:223915 MGI:3607712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 73 transcript_id : NM_212485.2

name	Krt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487418 GeneID:16681 MGI:96699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 2 transcript_id : NM_010668.2

name	Krt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116584 GeneID:16678 MGI:96698
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 1 transcript_id : NM_008473.2

name	Krt77 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51092292 GeneID:406220 MGI:3588209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 77 transcript_id : NM_001003667.1

name	Krt76 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366538 GeneID:77055 MGI:1924305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 76 transcript_id : NM_001033177.2

name	Krt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778952 GeneID:16682 MGI:96701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 4 transcript_id : NM_008475.2

name	Krt79 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164775 GeneID:223917 MGI:2385030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 79 transcript_id : NM_146063.1

name	Krt78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490387 GeneID:332131 MGI:1917529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 78 transcript_id : NM_212487.3

name	Krt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145560 GeneID:16691 MGI:96705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 8 transcript_id : NM_031170.2

name	Krt18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754481 GeneID:16668 MGI:96692
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 18 transcript_id : NM_010664.1

name	LOC676882 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266818 GeneID:676882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical LOC676882 transcript_id : XM_001480929.1

name	Eif4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130204 GeneID:75705 MGI:95304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4B transcript_id : NM_145625.2

name	Tenc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119372287 GeneID:209039 MGI:2387586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tensin like C1 domain-containing phosphatase transcript_id : NM_153533.2

name	Spryd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380796 GeneID:223918 MGI:2446175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPRY domain containing 3 transcript_id : NM_001033277.2

name	Igfbp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363898 GeneID:16012 MGI:96441
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein 6 transcript_id : NM_008344.2

name	Soat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122546 GeneID:223920 MGI:1332226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterol O-acyltransferase 2 transcript_id : NM_146064.1

name	Csad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802098 GeneID:246277 MGI:2180098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine sulfinic acid decarboxylase transcript_id : NM_144942.2

name	Zfp740 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23397412 GeneID:68744 MGI:1915994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 740 transcript_id : NM_153194.1

name	Itgb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305192 GeneID:16421 MGI:96616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 7 transcript_id : NM_013566.1

name	Rarg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181201 GeneID:19411 MGI:97858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoic acid receptor, gamma transcript_id : NM_011244.3

name	Rarg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181195 GeneID:19411 MGI:97858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoic acid receptor, gamma transcript_id : NM_001042727.1

name	D15Mgi27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354207 GeneID:106073 MGI:2146241
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA Segment, Chr 15, Mouse Genome Informatics 27 transcript_id : NM_134100.3

name	Espl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62510073 GeneID:105988 MGI:2146156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : extra spindle poles-like 1 (S. cerevisiae) transcript_id : NM_001014976.1

name	Pfdn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110556632 GeneID:56612 MGI:1928753
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prefoldin 5 transcript_id : NM_027044.3

name	Myg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130494461 GeneID:60315 MGI:1929864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanocyte proliferating gene 1 transcript_id : NM_021713.2

name	Aaas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510310 GeneID:223921 MGI:2443767
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : achalasia, adrenocortical insufficiency, alacrimia transcript_id : NM_153416.1

name	Sp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802055 GeneID:170574 MGI:2153568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trans-acting transcription factor 7 transcript_id : NM_130458.2

name	Sp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226254 GeneID:20683 MGI:98372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trans-acting transcription factor 1 transcript_id : NM_013672.2

name	Amhr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362358 GeneID:110542 MGI:105062
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anti-Mullerian hormone type 2 receptor transcript_id : NM_144547.1

name	Prr13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982676 GeneID:66151 MGI:1913401
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich 13 transcript_id : NM_025385.2

name	Pcbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6997238 GeneID:18521 MGI:108202
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(rC) binding protein 2 transcript_id : NM_011042.1

name	Map3k12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803505 GeneID:26404 MGI:1346881
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase kinase 12 transcript_id : NM_009582.3

name	Tarbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678220 GeneID:21357 MGI:103027
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAR (HIV) RNA binding protein 2 transcript_id : NM_009319.1

name	Npff (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055293 GeneID:54615 MGI:1891708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuropeptide FF-amide peptide precursor transcript_id : NM_018787.1

name	Atf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122556 GeneID:223922 MGI:2443472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 7 transcript_id : NM_146065.1

name	LOC100043600 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266820 GeneID:100043600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100043600 transcript_id : XM_001480969.1

name	Atp5g2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351827 GeneID:67942 MGI:1915192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2 transcript_id : NM_026468.2

name	Calcoco1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129828 GeneID:67488 MGI:1914738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding and coiled coil domain 1 transcript_id : NM_026192.2

name	LOC100043050 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266773 GeneID:100043050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043050 transcript_id : XM_001479409.1

name	Hoxc13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130022 GeneID:15422 MGI:99560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box C13 transcript_id : NM_010464.2

name	Hoxc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859567 GeneID:15421 MGI:96194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box C12 transcript_id : NM_010463.1

name	Hoxc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67625730 GeneID:109663 MGI:96193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box C11 transcript_id : NM_001024842.1

name	Hoxc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802296 GeneID:209448 MGI:96192
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box C10 transcript_id : NM_010462.3

name	Hoxc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130863 GeneID:15427 MGI:96199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box C9 transcript_id : NM_008272.3

name	LOC100043060 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266775 GeneID:100043060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Unknown (protein for IMAGE:1366468) transcript_id : XM_001479425.1

name	Hoxc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362260 GeneID:15426 MGI:96198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box C8 transcript_id : NM_010466.1

name	Hoxc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145518 GeneID:15425 MGI:96197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box C6 transcript_id : NM_010465.2

name	Hoxc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385258 GeneID:15424 MGI:96196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box C5 transcript_id : NM_175730.3

name	Hoxc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305148 GeneID:15423 MGI:96195
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box C4 transcript_id : NM_013553.1

name	LOC432989 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266822 GeneID:432989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical gene supported by AK052984 transcript_id : XM_001480972.1

name	Smug1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892229 GeneID:71726 MGI:1918976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single-strand selective monofunctional uracil DNA glycosylase transcript_id : NM_027885.3

name	Cbx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116008460 GeneID:12419 MGI:109372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 5 (Drosophila HP1a) transcript_id : NM_001076789.1

name	Cbx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116008459 GeneID:12419 MGI:109372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 5 (Drosophila HP1a) transcript_id : NM_007626.3

name	Hnrpa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343700 GeneID:15382 MGI:104820
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein A1 transcript_id : NM_001039129.2

name	Hnrpa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385760 GeneID:15382 MGI:104820
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein A1 transcript_id : NM_010447.3

name	Nfe2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254625 GeneID:18022 MGI:97308
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor, erythroid derived 2 transcript_id : NM_008685.2

name	Copz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789912 GeneID:56447 MGI:1929063
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit zeta 1 transcript_id : NM_019817.1

name	Gpr84 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507671 GeneID:80910 MGI:1934129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 84 transcript_id : NM_030720.1

name	Zfp385 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360326 GeneID:29813 MGI:1352495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 385 transcript_id : NM_013866.2

name	Itga5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560573 GeneID:16402 MGI:96604
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha 5 (fibronectin receptor alpha) transcript_id : NM_010577.2

name	1700006H03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266824 GeneID:74174 MGI:1921424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 3 Proteins product : RIKEN cDNA 1700006H03 gene, transcript variant 2 transcript_id : XM_895110.3

name	BC048502 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362437 GeneID:223927 MGI:2652828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048502 transcript_id : NM_177631.3

name	Nckap1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362638 GeneID:105855 MGI:1926063
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NCK associated protein 1 like transcript_id : NM_153505.3

name	Pde1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679242 GeneID:18574 MGI:97523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 1B, Ca2+-calmodulin dependent transcript_id : NM_008800.1

name	Ppp1r1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517503 GeneID:58200 MGI:1889595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 1A transcript_id : NM_021391.3

name	Glycam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370881 GeneID:14663 MGI:95759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycosylation dependent cell adhesion molecule 1 transcript_id : NM_008134.2

name	LOC100043633 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266826 GeneID:100043633
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : similar to LOC639390 protein transcript_id : XM_001480995.1

name	Krt82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21357425 CCDS:CCDS27854.1 GeneID:114566 MGI:2149248
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : keratin complex 2, basic, gene 20 protein_id : NP_444479.1

name	4732456N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244176 CCDS:CCDS27855.1 GeneID:239673 MGI:3045312
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein 4732456N10 protein_id : NP_808385.1

name	Krt75 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789317 CCDS:CCDS27856.1 GeneID:109052 MGI:1923500
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : cytokeratin KRT2-6HF product : keratinocyte associated protein 1 protein_id : NP_579935.1

name	EG406223 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092301 CCDS:CCDS27857.1 GeneID:406223 MGI:3646939
definition	codon_start : 1 product : type II keratin Kb14 protein_id : NP_001003670.1

name	EG432987 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921343 GeneID:432987 MGI:3646318
definition	codon_start : 1 product : hypothetical protein LOC432987 protein_id : NP_001004170.1

name	Krt6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195684 CCDS:CCDS27859.1 GeneID:16688 MGI:1333768
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence ISS]; GO:0045109 - intermediate filament organization [Evidence IGI]; GO:0031424 - keratinization [Evidence IGI]; GO:0002009 - morphogenesis of an epithelium [Evidence IGI] codon_start : 1 product : keratin complex 2, basic, gene 6b protein_id : NP_034799.2

name	Krt6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607171 CCDS:CCDS27860.1 GeneID:16687 MGI:1100845
definition	GO_component : GO:0005882 - intermediate filament [Evidence ISS] [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence ISS]; GO:0045109 - intermediate filament organization [Evidence IGI]; GO:0031424 - keratinization [Evidence IGI]; GO:0002009 - morphogenesis of an epithelium [Evidence IGI] codon_start : 1 note : keratin complex 2, basic, gene 6c; keratin complex 2, gene 6a; 60-kDa keratin product : keratin complex 2, basic, gene 6a protein_id : NP_032502.3

name	Krt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20911031 CCDS:CCDS27861.1 GeneID:110308 MGI:96702
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : tuftelin interacting protein 8 product : keratin complex 2, basic, gene 5 protein_id : NP_081287.1

name	Krt71 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910294 CCDS:CCDS27862.1 GeneID:56735 MGI:1861586
definition	GO_component : GO:0005882 - intermediate filament [Evidence TAS] [Evidence ISS] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS]; GO:0005198 - structural molecule activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence ISS] [Evidence TAS]; GO:0031069 - hair follicle morphogenesis [Evidence IMP] codon_start : 1 note : keratin complex 2, gene 6g; caracul product : keratin complex 2, basic, gene 6g protein_id : NP_064340.1

name	Krt74 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092295 GeneID:406222 MGI:3629975
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : type II keratin Kb37 protein_id : NP_001003669.1

name	Krt72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523977 CCDS:CCDS27863.1 GeneID:105866 MGI:2146034
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : type-II keratin Kb35 product : keratin complex 2, basic, gene 35 protein_id : NP_998893.1

name	Krt73 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059013 CCDS:CCDS27864.1 GeneID:223915 MGI:3607712
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : type II keratin Kb36 protein_id : NP_997650.1

name	Krt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487419 GeneID:16681 MGI:96699
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : keratin complex 2, gene 17 product : keratin complex 2, basic, gene 17 protein_id : NP_034798.2

name	Krt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116585 GeneID:16678 MGI:96698
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : keratin 86 product : keratin complex 2, basic, gene 1 protein_id : NP_032499.2

name	Krt77 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51092293 CCDS:CCDS27865.1 GeneID:406220 MGI:3588209
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : type II keratin Kb39; embryonic type II keratin 1; type-II intermediate filament protein product : keratin complex 2, basic, gene 39 protein_id : NP_001003667.1

name	Krt76 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701680 CCDS:CCDS27866.1 GeneID:77055 MGI:1924305
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : keratin 76 protein_id : NP_001028349.1

name	Krt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778953 GeneID:16682 MGI:96701
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence TAS] GO_function : GO:0046982 - protein heterodimerization activity [Evidence TAS]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0009790 - embryonic development [Evidence TAS]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0050680 - negative regulation of epithelial cell proliferation [Evidence IMP] codon_start : 1 note : 57kd keratin; 57kDa keratin product : keratin complex 2, basic, gene 4 protein_id : NP_032501.2

name	Krt79 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164776 CCDS:CCDS27867.1 GeneID:223917 MGI:2385030
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : keratin 6L protein_id : NP_666175.1

name	Krt78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490388 GeneID:332131 MGI:1917529
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : keratin Kb40 protein_id : NP_997652.3

name	Krt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145561 CCDS:CCDS27868.1 GeneID:16691 MGI:96705
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0042383 - sarcolemma [Evidence IDA]; GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0000904 - cellular morphogenesis during differentiation [Evidence TAS]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0007275 - development [Evidence TAS]; GO:0051707 - response to other organism [Evidence IMP] codon_start : 1 note : keratin complex 2, basic, gene 8 (MGD\|MGI:96705 GB\|AK077597, evidence: BLASTN, 100%, match=1775); putative; cytokeratin 8; cytokeratin-8 product : keratin complex 2, basic, gene 8 protein_id : NP_112447.2

name	Krt18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754482 CCDS:CCDS27869.1 GeneID:16668 MGI:96692
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : keratin complex 1, acidic, gene 18 protein_id : NP_034794.1

name	LOC676882 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266819 GeneID:676882
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480979.1

name	Eif4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704128 GeneID:75705 MGI:95304
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 4B protein_id : NP_663600.1

name	Tenc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119372288 GeneID:209039 MGI:2387586
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0019901 - protein kinase binding [Evidence ISS]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : tensin 2 product : C1 domain-containing phosphatase and tensin-like protein protein_id : NP_705761.2

name	Spryd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701624 GeneID:223918 MGI:2446175
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : SPRY domain containing 3 protein_id : NP_001028449.1

name	Igfbp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680387 CCDS:CCDS27871.1 GeneID:16012 MGI:96441
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0019838 - growth factor binding [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 exception : mismatches in translation product : insulin-like growth factor binding protein 6 protein_id : NP_032370.1

name	Soat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122547 CCDS:CCDS27872.1 GeneID:223920 MGI:1332226
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004772 - sterol O-acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 note : cholesterol acyltransferase 2; acyl-CoA:cholesterol acyltransferase product : acyl-CoA:cholesterol acyltransferase 2 protein_id : NP_666176.1

name	Csad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450351 CCDS:CCDS27873.1 GeneID:246277 MGI:2180098
definition	GO_component : GO:0005575 - cellular_component [Evidence TAS] GO_function : GO:0016831 - carboxy-lyase activity [Evidence TAS]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0019752 - carboxylic acid metabolism [Evidence IEA]; GO:0019452 - L-cysteine catabolism to taurine [Evidence TAS]; GO:0019530 - taurine metabolism [Evidence TAS] codon_start : 1 product : cysteine sulfinic acid decarboxylase protein_id : NP_659191.1

name	Zfp740 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23397413 GeneID:68744 MGI:1915994
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 740 protein_id : NP_694874.1

name	Itgb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305193 GeneID:16421 MGI:96616
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : integrin beta 7 protein_id : NP_038594.1

name	Rarg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181202 CCDS:CCDS27875.1 GeneID:19411 MGI:97858
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0048048 - embryonic eye morphogenesis [Evidence IGI]; GO:0043065 - positive regulation of apoptosis [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; RAR gamma 2 product : retinoic acid receptor, gamma isoform 1 protein_id : NP_035374.3

name	Rarg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181196 GeneID:19411 MGI:97858
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0048048 - embryonic eye morphogenesis [Evidence IGI]; GO:0043065 - positive regulation of apoptosis [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; RAR gamma 2 product : retinoic acid receptor, gamma isoform 2 protein_id : NP_001036192.1

name	D15Mgi27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527330 CCDS:CCDS27877.1 GeneID:106073 MGI:2146241
definition	codon_start : 1 product : hypothetical protein LOC106073 protein_id : NP_598861.1

name	Espl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62510074 CCDS:CCDS27878.1 GeneID:105988 MGI:2146156
definition	EC_number : 3.4.22.49 GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0007059 - chromosome segregation [Evidence IEA]; GO:0045143 - homologous chromosome segregation [Evidence IMP]; GO:0007127 - meiosis I [Evidence IMP]; GO:0000212 - meiotic spindle organization and biogenesis [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : separin; separase product : extra spindle poles-like 1 protein_id : NP_001014976.1

name	Pfdn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741463 GeneID:56612 MGI:1928753
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016272 - prefoldin complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : EIG-1; c-myc binding protein MM-1 product : prefoldin 5 protein_id : NP_081320.2

name	Myg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11096332 CCDS:CCDS27879.1 GeneID:60315 MGI:1929864
definition	codon_start : 1 product : melanocyte proliferating gene 1 protein_id : NP_068359.1

name	Aaas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510311 CCDS:CCDS27880.1 GeneID:223921 MGI:2443767
definition	GO_component : GO:0005643 - nuclear pore [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence ISS] codon_start : 1 exception : mismatches in translation note : aladin; adracalin product : achalasia, adrenocortical insufficiency, alacrimia protein_id : NP_700465.1

name	Sp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18485518 GeneID:170574 MGI:2153568
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001649 - osteoblast differentiation [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : osterix; Sp7 transcription factor product : trans-acting transcription factor 7 protein_id : NP_569725.1

name	Sp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226255 GeneID:20683 MGI:98372
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IDA]; GO:0003690 - double-stranded DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IMP] [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : trans-acting transcription factor 1 protein_id : NP_038700.2

name	Amhr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362359 CCDS:CCDS27882.1 GeneID:110542 MGI:105062
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS] [Evidence ISS] GO_function : GO:0042562 - hormone binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence ISS]; GO:0005024 - transforming growth factor beta receptor activity [Evidence TAS]; GO:0005026 - transforming growth factor beta receptor activity, type II [Evidence ISS]; GO:0005071 - transmembrane receptor protein serine/threonine kinase signaling protein activity [Evidence ISS] GO_process : GO:0001880 - Mullerian duct regression [Evidence ISS]; GO:0007548 - sex differentiation [Evidence ISS] [Evidence IMP]; GO:0007165 - signal transduction [Evidence ISS]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence TAS] [Evidence ISS] codon_start : 1 exception : mismatches in translation note : MIS TypeII receptor; MIS type II receptor product : anti-Mullerian hormone type 2 receptor protein_id : NP_653130.1

name	Prr13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313600 CCDS:CCDS27883.1 GeneID:66151 MGI:1913401
definition	codon_start : 1 product : proline rich 13 protein_id : NP_079661.1

name	Pcbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6997239 CCDS:CCDS27884.1 GeneID:18521 MGI:108202
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : heterogeneous nuclear ribonucleoprotein X product : poly(rC) binding protein 2 protein_id : NP_035172.1

name	Map3k12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543236 CCDS:CCDS27885.1 GeneID:26404 MGI:1346881
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016572 - histone phosphorylation [Evidence IDA]; GO:0007254 - JNK cascade [Evidence ISS]; GO:0018105 - peptidyl-serine phosphorylation [Evidence IDA]; GO:0018107 - peptidyl-threonine phosphorylation [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zipper (leucine) protein kinase product : mitogen activated protein kinase kinase kinase 12 protein_id : NP_033608.2

name	Tarbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678221 CCDS:CCDS27886.1 GeneID:21357 MGI:103027
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003725 - double-stranded RNA binding [Evidence IEA] [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006469 - negative regulation of protein kinase activity [Evidence ISS]; GO:0045946 - positive regulation of translation [Evidence ISS]; GO:0045070 - positive regulation of viral genome replication [Evidence ISS]; GO:0046782 - regulation of viral transcription [Evidence ISS] codon_start : 1 exception : mismatches in translation product : TAR (HIV) RNA binding protein 2 protein_id : NP_033345.1

name	Npff (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055294 CCDS:CCDS27887.1 GeneID:54615 MGI:1891708
definition	GO_function : GO:0005184 - neuropeptide hormone activity [Evidence IEA] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : neuropeptide precursor protein product : neuropeptide FF-amide peptide precursor protein_id : NP_061257.1

name	Atf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122557 GeneID:223922 MGI:2443472
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : activating transcription factor 7 protein_id : NP_666177.1

name	LOC100043600 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266821 GeneID:100043600
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481019.1

name	Atp5g2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385960 CCDS:CCDS27888.1 GeneID:67942 MGI:1915192
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0045263 - proton-transporting ATP synthase complex, coupling factor F(o) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2 protein_id : NP_080744.1

name	Calcoco1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312944 CCDS:CCDS27889.1 GeneID:67488 MGI:1914738
definition	GO_component : GO:0000790 - nuclear chromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA] [Evidence IGI] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0007165 - signal transduction [Evidence IDA]; GO:0030518 - steroid hormone receptor signaling pathway [Evidence IDA]; GO:0006350 - transcription [Evidence IDA] codon_start : 1 note : GRIP1-interacting protein product : coiled-coil transcriptional coactivator protein_id : NP_080468.1

name	LOC100043050 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266774 GeneID:100043050
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479459.1

name	Hoxc13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859562 CCDS:CCDS27890.1 GeneID:15422 MGI:99560
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox C13 protein_id : NP_034594.1

name	Hoxc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859568 CCDS:CCDS27891.1 GeneID:15421 MGI:96194
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox C12 protein_id : NP_034593.1

name	Hoxc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67625731 CCDS:CCDS27892.1 GeneID:109663 MGI:96193
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001759 - induction of an organ [Evidence IGI]; GO:0001656 - metanephros development [Evidence IGI]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : homeobox C11 protein_id : NP_001020013.1

name	Hoxc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46275806 GeneID:209448 MGI:96192
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox C10 protein_id : NP_034592.1

name	LOC100043060 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266776 GeneID:100043060
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479475.1

name	Hoxc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680255 CCDS:CCDS27893.1 GeneID:15427 MGI:96199
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox C9 protein_id : NP_032298.1

name	Hoxc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362261 CCDS:CCDS27894.1 GeneID:15426 MGI:96198
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox C8 protein_id : NP_034596.1

name	Hoxc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145519 CCDS:CCDS27895.1 GeneID:15425 MGI:96197
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox C6 protein_id : NP_034595.2

name	Hoxc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28376623 CCDS:CCDS27896.1 GeneID:15424 MGI:96196
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox C5 protein_id : NP_783857.1

name	Hoxc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305149 CCDS:CCDS27897.1 GeneID:15423 MGI:96195
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : homeobox C4 protein_id : NP_038581.1

name	LOC432989 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266823 GeneID:432989
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481022.1

name	Smug1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254179 CCDS:CCDS27898.1 GeneID:71726 MGI:1918976
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0000702 - oxidized base lesion DNA N-glycosylase activity [Evidence ISS]; GO:0017065 - single-strand selective uracil DNA N-glycosylase activity [Evidence ISS]; GO:0003697 - single-stranded DNA binding [Evidence ISS]; GO:0004844 - uracil DNA N-glycosylase activity [Evidence ISS] GO_process : GO:0006284 - base-excision repair [Evidence ISS]; GO:0006281 - DNA repair [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : single-strand selective monofunctional uracil DNA glycosylase protein_id : NP_082161.2

name	Cbx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116008461 GeneID:12419 MGI:109372
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0000776 - kinetochore [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA] codon_start : 1 note : mHP1(alpha); heterochromatin protein 1 alpha product : chromobox homolog 5 protein_id : NP_001070257.1

name	Cbx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671694 GeneID:12419 MGI:109372
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0000776 - kinetochore [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA] codon_start : 1 note : mHP1(alpha); heterochromatin protein 1 alpha product : chromobox homolog 5 protein_id : NP_031652.1

name	Hnrpa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85060507 GeneID:15382 MGI:104820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence ISS]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; helix destabilizing protein product : heterogeneous nuclear ribonucleoprotein A1 isoform b protein_id : NP_001034218.1

name	Hnrpa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754220 GeneID:15382 MGI:104820
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence ISS]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; helix destabilizing protein product : heterogeneous nuclear ribonucleoprotein A1 isoform a protein_id : NP_034577.1

name	Nfe2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254626 CCDS:CCDS27900.1 GeneID:18022 MGI:97308
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] codon_start : 1 note : nuclear factor, erythroid derived 2, 45 kDa product : nuclear factor, erythroid derived 2 protein_id : NP_032711.2

name	Copz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789913 CCDS:CCDS27901.1 GeneID:56447 MGI:1929063
definition	GO_component : GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0030126 - COPI vesicle coat [Evidence ISS]; GO:0030137 - COPI-coated vesicle [Evidence ISS] codon_start : 1 note : nonclathrin coat protein zeta1-COP product : coatomer protein complex, subunit zeta 1 protein_id : NP_062791.1

name	Gpr84 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507672 CCDS:CCDS27902.1 GeneID:80910 MGI:1934129
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : orphan G protein-coupled receptor 84 product : G protein-coupled receptor 84 protein_id : NP_109645.1

name	Zfp385 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119360327 GeneID:29813 MGI:1352495
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : hematopoietic zinc finger product : zinc finger protein 385 protein_id : NP_038894.2

name	Itga5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560574 CCDS:CCDS27903.1 GeneID:16402 MGI:96604
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0001726 - ruffle [Evidence ISS]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005178 - integrin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007044 - cell-substrate junction assembly [Evidence IDA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0007613 - memory [Evidence IMP] codon_start : 1 exception : mismatches in translation note : fibronectin receptor alpha; fibronectin receptor alpha polypeptide product : integrin alpha 5 protein_id : NP_034707.2

name	1700006H03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957811 GeneID:74174 MGI:1921424
definition	codon_start : 1 product : hypothetical protein LOC74174 isoform 2 protein_id : XP_900203.1

name	BC048502 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244024 GeneID:223927 MGI:2652828
definition	codon_start : 1 product : hypothetical protein LOC223927 protein_id : NP_808299.1

name	Nckap1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943795 GeneID:105855 MGI:1926063
definition	codon_start : 1 product : hematopoietic protein 1 protein_id : NP_705725.1

name	Pde1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679243 CCDS:CCDS27904.1 GeneID:18574 MGI:97523
definition	GO_function : GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007165 - signal transduction [Evidence IMP]; GO:0008542 - visual learning [Evidence IMP] codon_start : 1 note : phosphodiesterase 1B1, Ca2+-calmodulin dependent, 63 kDa; phosphodiesterase 1B, Ca2+-calmodulin dependent, 63 kDa product : phosphodiesterase 1B, Ca2+-calmodulin dependent protein_id : NP_032826.1

name	Ppp1r1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946734 GeneID:58200 MGI:1889595
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : inhibitor-1; protein phosphatase inhibitor-1 product : protein phosphatase 1, regulatory (inhibitor) subunit 1A protein_id : NP_067366.1

name	Glycam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468855 CCDS:CCDS27905.1 GeneID:14663 MGI:95759
definition	GO_component : GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : Sele ligand; GlyCAM 1; Glycosylation-dependent cell adhesion molecule 1 product : glycosylation dependent cell adhesion molecule 1 protein_id : NP_032160.1

name	LOC100043633 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266827 GeneID:100043633
definition	codon_start : 1 product : similar to LOC639390 protein protein_id : XP_001481045.1

name	LOC100043001 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043001
definition	number : 1 pseudo : _no_value

name	LOC100043001 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043001
definition	number : 2 pseudo : _no_value

name	LOC100043001 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043001
definition	number : 3 pseudo : _no_value

name	LOC637762 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637762
definition	number : 1 pseudo : _no_value

name	EG432985 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872160 GeneID:432985 MGI:3646316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432985 pseudo : _no_value transcript_id : NR_002868.1

name	EG432986 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872165 GeneID:432986 MGI:3646317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432986 pseudo : _no_value transcript_id : NR_002869.1

name	LOC668321 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266782 GeneID:668321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 205 ESTs, 4 Proteins product : similar to MARCKS-like protein pseudo : _no_value transcript_id : XR_034220.1

name	LOC668327 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266825 GeneID:668327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 239 ESTs, 7 Proteins product : similar to Hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit pseudo : _no_value transcript_id : XR_034943.1

clone name	MSMg01-295I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-457A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087I07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-275D09.b	B6Ng01-275D09.g
ACC	GA076312	GA076313
length	458	485
definition	B6Ng01-275D09.b	B6Ng01-275D09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(102,482,531 - 102,482,994)	(102,609,749 - 102,610,239)
sequence	tgcattcctaattagttaggttagaggggaggaagcttcatctccttcag atgatcactgttagaatgactcagtggggctggtgagatggctcaatggg taagagcacccgactgctcttctgaaggtctggagttcaaatcccagcaa ccacatggtggctcacaaccatctgtaacaagatctgacgccctcttctg gagtgtctgaagacagctacagttgtacttacatataataaataaataaa actttaaaaaaaaaaaaaaaaaagaatgactcagtgatgaccctgtgata tctgtggttacgattgtttattgatgtttgcatcagtccaggttggcagc cctcagaaggctccagtgtctcccaaccccaactggaatcaatcttattc aagaggcaaagtttcttttgttgttgttgtcgtcttttggggggaaggaa ggggtttg	tatgggaatgcagactgaaacccaaggaggttgctcctggcattctcttg ctgcagggggggttattatcccttgttctttgagtgagcaacactgttct caagactgagggaggcagtcagaaggaaggattacagttagcacttgctc tgagcaagacaggagaattctcaggacccagacaagactgaagagaagca aaattgggatcagcagctgaccagttctagatgctagaaggttggggagt agctatttgtcaaagaaaccttctaaaggatgaatttagggagcaagaca gtgctggtcttacaatgaggggactcttgtactgtgaaaatgagtaaacc tcggttcaatgcaactgggtattaagactccttatgtgcctcgcacttgg ctgggtgctgaaggcagtaaataagatacacactccttaccaggaataga cagtcaggtgtgtgtattggtggatgagggggaga
quality values	Open. Hide. 47 47 56 56 54 62 62 62 62 62 62 62 54 47 62 62 54 47 62 59 62 62 59 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 59 59 62 62 62 62 49 54 62 59 59 59 59 62 62 59 59 59 62 59 62 62 62 59 62 62 62 62 59 62 59 59 62 59 59 59 62 62 62 54 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 56 28 54 59 59 54 62 59 56 59 56 39 59 62 46 62 62 62 62 62 59 59 62 46 43 46 59 59 62 56 46 56 56 59 59 62 59 56 59 34 62 59 56 62 59 59 59 59 59 59 56 44 59 62 56 59 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 56 51 24 62 56 51 62 56 62 62 62 56 56 62 62 56 62 46 46 62 62 62 56 62 62 62 62 56 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 45 56 56 47 62 56 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 52 62 62 54 54 52 46 54 54 52 52 52 47 46 47 43 46 46 46 47 58 47 49 58 58 22 17	Open. Hide. 62 62 62 62 62 62 59 62 54 54 62 43 48 59 59 62 62 59 62 62 62 62 59 62 62 62 54 59 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 54 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 58 58 58 58 58 58 58 58 58 49 58 58 54 54 58 49 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 38 38 41 58 54 58 58 58 49 58 46 20

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_102482531_102482994
seq2: B6Ng01-275D09.b_46_509

seq1  GAATTCTGCATTCCTAATTAGTTAGGTTAGAGGGGAGGAAGCTTCATCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGCATTCCTAATTAGTTAGGTTAGAGGGGAGGAAGCTTCATCTC  50

seq1  CTTCAGATGATCACTGTTAGAATGACTCAGTGGGGCTGGTGAGATGGCTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAGATGATCACTGTTAGAATGACTCAGTGGGGCTGGTGAGATGGCTC  100

seq1  AATGGGTAAGAGCACCCGACTGCTCTTCTGAAGGTCTGGAGTTCAAATCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGGTAAGAGCACCCGACTGCTCTTCTGAAGGTCTGGAGTTCAAATCC  150

seq1  CAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGACGCCCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAACCACATGGTGGCTCACAACCATCTGTAACAAGATCTGACGCCCT  200

seq1  CTTCTGGAGTGTCTGAAGACAGCTACAGTTGTACTTACATATAATAAATA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTGGAGTGTCTGAAGACAGCTACAGTTGTACTTACATATAATAAATA  250

seq1  AATAAAACTTTAAAAAAAAAAAAAAAAAAGAATGACTCAGTGATGACCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAAACTTTAAAAAAAAAAAAAAAAAAGAATGACTCAGTGATGACCCT  300

seq1  GTGATATCTGTGGTTACGATTGTTTATTGATGTTTGCATCAGTCCAGGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGATATCTGTGGTTACGATTGTTTATTGATGTTTGCATCAGTCCAGGTT  350

seq1  GGCAGCCCTCAGAAGGCTCCAGTGTCTCCCAACCCCAACTGGAATCAATC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGCCCTCAGAAGGCTCCAGTGTCTCCCAACCCCAACTGGAATCAATC  400

seq1  TTATTCAAGAGGCAAAGTTTCTTTTGTTGTTGTTGTCGTCTTTTGGGGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTCAAGAGGCAAAGTTTCTTTTGTTGTTGTTGTCGTCTTTTGGGGGG  450

seq1  AAGGAAGGGGTTTG  464
      ||||||||||||||
seq2  AAGGAAGGGGTTTG  464

seq1: chr15_102609749_102610239
seq2: B6Ng01-275D09.g_64_554 (reverse)

seq1  TCTCCCCCTCATCCACCAATACACACACCTGACTGTCTATTCCTGGTAAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCCCTCATCCACCAATACACACACCTGACTGTCTATTCCTGGTAAG  50

seq1  GAGTGTGTATCTTATTTACTGCCTTCAGCACCCAGCCAAGTGCGAGGCAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGTGTATCTTATTTACTGCCTTCAGCACCCAGCCAAGTGCGAGGCAC  100

seq1  ATAAGGAGTCTTAATACCCAGTTGCATTGAACCGAGGTTTACTCATTTTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGGAGTCTTAATACCCAGTTGCATTGAACCGAGGTTTACTCATTTTC  150

seq1  ACAGTACAAGAGTCCCCTCATTGTAAGACCAGCACTGTCTTGCTCCCTAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTACAAGAGTCCCCTCATTGTAAGACCAGCACTGTCTTGCTCCCTAA  200

seq1  ATTCATCCTTTAGAAGGTTTCTTTGACAAATAGCTACTCCCCAACCTTCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCATCCTTTAGAAGGTTTCTTTGACAAATAGCTACTCCCCAACCTTCT  250

seq1  AGCATCTAGAACTGGTCAGCTGCTGATCCCAATTTTGCTTCTCTTCAGTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATCTAGAACTGGTCAGCTGCTGATCCCAATTTTGCTTCTCTTCAGTC  300

seq1  TTGTCTGGGTCCTGAGAATTCTCCTGTCTTGCTCAGAGCAAGTGCTAACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCTGGGTCCTGAGAATTCTCCTGTCTTGCTCAGAGCAAGTGCTAACT  350

seq1  GTAATCCTTCCTTCTGACTGCCTCCCTCAGTCTTGAGAACAGTGTTGCTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATCCTTCCTTCTGACTGCCTCCCTCAGTCTTGAGAACAGTGTTGCTC  400

seq1  ACTCAAAGAACAAGGGATAATAACCCCCCCTGCAGCAAGAGAATGCCAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCAAAGAACAAGGGATAATAACCCCCCCTGCAGCAAGAGAATGCCAGG  450

seq1  AGCAACCTCCTTGGGTTTCAGTCTGCATTCCCATAGAATTC  491
      |||||||||||||||||||||||||||||||||||||||||
seq2  AGCAACCTCCTTGGGTTTCAGTCTGCATTCCCATAGAATTC  491

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information