MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-295O03
Chromosome	15 (Build37)
Map Location	78,233,422 - 78,386,389
singlet/doublet	doublet
Overlap gene	Tst, Mpst, Kctd17, Tmprss6, Il2rb, C1qtnf6, Sstr3, EG626952
Upstream gene	BC020489, BC085284, LOC624454, EG666639, 9030421J09Rik, EG626615, 2210421G13Rik, 9130218O11Rik, LOC666661, A330102K04Rik, EG545115, LOC666348, LOC666679, 2310016F22Rik, Apol2, Myh9, Txn2, Foxred2, Eif3s7, Cacng2, Rabl4, Pvalb, Ncf4, Csf2rb2, Csf2rb1, 1700061J05Rik
Downstream gene	Rac2, Pscd4, Lrrc62, Mfng, Card10, LOC641104, LOC100041601, Cdc42ep1, Lgals2, Gga1, Sh3bp1, Pdxp, Lgals1, Nol12, Triobp, H1f0, Gcat, Galr3, LOC100042603, Ankrd54, Eif3s6ip, 1700088E04Rik, Polr2f, Sox10, LOC100041655, Pick1, Slc16a8, Baiap2l2, Pla2g6, Maff, 4732495E13Rik, Csnk1e, LOC675798, LOC100041676, Kcnj4, Kdelr3, Ddx17
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC020489 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223672 MGI:3606001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 70 ESTs, 16 Proteins

name	BC085284 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278679 MGI:3583950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs

name	EG666639 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666639 MGI:3646501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	9030421J09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245282 MGI:3036238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626615 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626615 MGI:3649094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins

name	2210421G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108956 MGI:1920912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130218O11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328561 MGI:3043522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666661 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 54 ESTs, 16 Proteins

name	A330102K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328563 MGI:3036248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 2 Proteins

name	EG545115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545115 MGI:3646982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666348 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 16 Proteins

name	LOC666679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	2310016F22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71898 MGI:1919148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apol2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239552 MGI:2444921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 19 Proteins

name	Myh9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17886 MGI:107717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56551 MGI:1929468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxred2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239554 MGI:106315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55944 MGI:1933181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12300 MGI:1316660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67042 MGI:1914292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pvalb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19293 MGI:97821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17972 MGI:109186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf2rb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12984 MGI:1339760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf2rb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12983 MGI:1339759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700061J05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73376 MGI:1920626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 4 Proteins

name	Tst (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22117 MGI:98852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpst (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246221 MGI:2179733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kctd17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72844 MGI:1920094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71753 MGI:1919003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il2rb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16185 MGI:96550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1qtnf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72709 MGI:1919959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sstr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20607 MGI:98329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626952 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626952 MGI:3648054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2 Proteins

name	Rac2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19354 MGI:97846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pscd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72318 MGI:2441702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207393 MGI:3608416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mfng (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17305 MGI:1095404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Card10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105844 MGI:2146012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC641104 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041601 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Cdc42ep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104445 MGI:1929763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107753 MGI:895068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gga1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106039 MGI:2146207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20401 MGI:104603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdxp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57028 MGI:1919282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16852 MGI:96777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97961 MGI:2146285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Triobp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110253 MGI:1349410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	H1f0 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14958 MGI:95893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26912 MGI:1349389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Galr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14429 MGI:1329003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042603 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ankrd54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223690 MGI:2444209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s6ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223691 MGI:2386251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700088E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27660 MGI:1920774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr2f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69833 MGI:1349393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20665 MGI:98358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 116 ESTs, 29 Proteins

name	LOC100041655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Pick1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18693 MGI:894645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc16a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57274 MGI:1929519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Baiap2l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207495 MGI:2652819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pla2g6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53357 MGI:1859152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maff (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17133 MGI:96910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732495E13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223693 MGI:2445179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csnk1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27373 MGI:1351660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675798 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Kcnj4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16520 MGI:104743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kdelr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105785 MGI:2145953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67040 MGI:1914290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	BC020489 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266725 GeneID:223672 MGI:3606001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 16 Proteins product : cDNA sequence BC020489, transcript variant 1 transcript_id : XM_128064.8

name	BC085284 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701567 GeneID:278679 MGI:3583950
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC085284 transcript_id : NM_001024848.1

name	LOC624454 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266726 GeneID:624454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs product : hypothetical LOC624454 transcript_id : XM_001478894.1

name	9030421J09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802549 GeneID:245282 MGI:3036238
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030421J09 gene transcript_id : NM_177744.2

name	EG626615 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398759 GeneID:626615 MGI:3649094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : predicted gene, EG626615 transcript_id : XM_891223.2

name	2210421G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347723 GeneID:108956 MGI:1920912
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210421G13 gene transcript_id : NM_175391.3

name	9130218O11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362704 GeneID:328561 MGI:3043522
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130218O11 gene transcript_id : NM_177820.3

name	LOC666661 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266679 GeneID:666661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 54 ESTs, 16 Proteins product : apolipoprotein L, 3-like transcript_id : XM_001476404.1

name	EG545115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94398766 GeneID:545115 MGI:3646982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG545115 transcript_id : XM_619334.3

name	LOC666348 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94398732 GeneID:666348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 17 ESTs, 16 Proteins product : hypothetical LOC666348, transcript variant 3 transcript_id : XM_992460.1

name	2310016F22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803109 GeneID:71898 MGI:1919148
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310016F22 gene transcript_id : NM_173743.3

name	Apol2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266685 GeneID:239552 MGI:2444921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 19 Proteins product : apolipoprotein L, 2 transcript_id : XM_139463.7

name	Myh9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326445 GeneID:17886 MGI:107717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 9, non-muscle transcript_id : NM_022410.2

name	Txn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370902 GeneID:56551 MGI:1929468
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin 2 transcript_id : NM_019913.4

name	Foxred2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972420 GeneID:239554 MGI:106315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FAD-dependent oxidoreductase domain containing 2 transcript_id : NM_001017983.1

name	Eif3s7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628628 GeneID:55944 MGI:1933181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 7 (zeta) transcript_id : NM_018749.2

name	Cacng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680825 GeneID:12300 MGI:1316660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, gamma subunit 2 transcript_id : NM_007583.1

name	Rabl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754106 GeneID:67042 MGI:1914292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB, member of RAS oncogene family-like 4 transcript_id : NM_025931.2

name	Pvalb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130845 GeneID:19293 MGI:97821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : parvalbumin transcript_id : NM_013645.3

name	Ncf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679021 GeneID:17972 MGI:109186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neutrophil cytosolic factor 4 transcript_id : NM_008677.1

name	Csf2rb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131167 GeneID:12984 MGI:1339760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) transcript_id : NM_007781.2

name	Csf2rb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375090 GeneID:12983 MGI:1339759
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 2 receptor, beta 1, low-affinity (granulocyte-macrophage) transcript_id : NM_007780.3

name	1700061J05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266687 GeneID:73376 MGI:1920626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 4 Proteins product : RIKEN cDNA 1700061J05 gene transcript_id : XM_181371.8

name	Tst (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803079 GeneID:22117 MGI:98852
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thiosulfate sulfurtransferase, mitochondrial transcript_id : NM_009437.3

name	Mpst (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301474 GeneID:246221 MGI:2179733
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mercaptopyruvate sulfurtransferase transcript_id : NM_138670.2

name	Kctd17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486940 GeneID:72844 MGI:1920094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 17 transcript_id : NM_001081367.1

name	Tmprss6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125656151 GeneID:71753 MGI:1919003
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane serine protease 6 transcript_id : NM_027902.2

name	Il2rb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14195581 GeneID:16185 MGI:96550
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 2 receptor, beta chain transcript_id : NM_008368.3

name	C1qtnf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350257 GeneID:72709 MGI:1919959
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C1q and tumor necrosis factor related protein 6 transcript_id : NM_028331.3

name	Sstr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778972 GeneID:20607 MGI:98329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : somatostatin receptor 3 transcript_id : NM_009218.3

name	EG626952 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266734 GeneID:626952 MGI:3648054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2 Proteins product : predicted gene, EG626952 transcript_id : XM_891575.3

name	Rac2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86355518 GeneID:19354 MGI:97846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-related C3 botulinum substrate 2 transcript_id : NM_009008.3

name	Pscd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89337279 GeneID:72318 MGI:2441702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology, Sec7 and coiled/coil domains 4 transcript_id : NM_028195.3

name	Lrrc62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62990173 GeneID:207393 MGI:3608416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 62 transcript_id : NM_183141.2

name	Mfng (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130740 GeneID:17305 MGI:1095404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : manic fringe homolog (Drosophila) transcript_id : NM_008595.2

name	Card10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538833 GeneID:105844 MGI:2146012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caspase recruitment domain family, member 10 transcript_id : NM_130859.2

name	LOC100041601 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266698 GeneID:100041601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100041601 transcript_id : XM_001476669.1

name	Cdc42ep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802537 GeneID:104445 MGI:1929763
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 effector protein (Rho GTPase binding) 1 transcript_id : NM_027219.2

name	Lgals2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372017 GeneID:107753 MGI:895068
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose-binding, soluble 2 transcript_id : NM_025622.2

name	Gga1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122346 GeneID:106039 MGI:2146207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi associated, gamma adaptin ear containing, ARF binding protein 1 transcript_id : NM_145929.1

name	Sh3bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838508 GeneID:20401 MGI:104603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain binding protein 1 transcript_id : NM_009164.2

name	Pdxp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838507 GeneID:57028 MGI:1919282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyridoxal (pyridoxine, vitamin B6) phosphatase transcript_id : NM_020271.3

name	Lgals1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838506 GeneID:16852 MGI:96777
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose binding, soluble 1 transcript_id : NM_008495.2

name	Nol12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838504 GeneID:97961 MGI:2146285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 12 transcript_id : NM_133800.3

name	Triobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88501748 GeneID:110253 MGI:1349410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRIO and F-actin binding protein transcript_id : NM_001039156.1

name	Triobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88501742 GeneID:110253 MGI:1349410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRIO and F-actin binding protein transcript_id : NM_138579.4

name	Triobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88501746 GeneID:110253 MGI:1349410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRIO and F-actin binding protein transcript_id : NM_001039155.1

name	Triobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88501744 GeneID:110253 MGI:1349410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRIO and F-actin binding protein transcript_id : NM_001024716.1

name	H1f0 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85838505 GeneID:14958 MGI:95893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H1 histone family, member 0 transcript_id : NM_008197.3

name	Gcat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348705 GeneID:26912 MGI:1349389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine C-acetyltransferase (2-amino-3-ketobutyrate-coenzyme A ligase) transcript_id : NM_013847.3

name	Galr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657113 GeneID:14429 MGI:1329003
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galanin receptor 3 transcript_id : NM_015738.1

name	LOC100042603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266739 GeneID:100042603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042603 transcript_id : XM_001479325.1

name	Ankrd54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450058 GeneID:223690 MGI:2444209
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 54 transcript_id : NM_144849.1

name	Eif3s6ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51093839 GeneID:223691 MGI:2386251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 6 interacting protein transcript_id : NM_145139.2

name	1700088E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677332 GeneID:27660 MGI:1920774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700088E04 gene transcript_id : NM_138581.2

name	Polr2f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037180 GeneID:69833 MGI:1349393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide F transcript_id : NM_027231.1

name	Sox10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149266700 GeneID:20665 MGI:98358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 mRNAs, 116 ESTs, 29 Proteins product : SRY-box containing gene 10, transcript variant 1 transcript_id : XM_128139.6

name	LOC100041655 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149266702 GeneID:100041655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041655 transcript_id : XM_001476760.1

name	Pick1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930723 GeneID:18693 MGI:894645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein interacting with C kinase 1 transcript_id : NM_008837.2

name	Pick1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930730 GeneID:18693 MGI:894645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein interacting with C kinase 1 transcript_id : NM_001045558.1

name	Slc16a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982695 GeneID:57274 MGI:1929519
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 16 (monocarboxylic acid transporters), member 8 transcript_id : NM_020516.2

name	Baiap2l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637819 GeneID:207495 MGI:2652819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BAI1-associated protein 2-like 2 transcript_id : NM_177580.3

name	Pla2g6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131199 GeneID:53357 MGI:1859152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group VI transcript_id : NM_016915.3

name	Maff (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130100 GeneID:17133 MGI:96910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian) transcript_id : NM_010755.3

name	4732495E13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61969667 GeneID:223693 MGI:2445179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732495E13 gene transcript_id : NM_172608.1

name	Csnk1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350602 GeneID:27373 MGI:1351660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 1, epsilon transcript_id : NM_013767.4

name	Kcnj4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46358361 GeneID:16520 MGI:104743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium inwardly-rectifying channel, subfamily J, member 4 transcript_id : NM_008427.2

name	Kdelr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527315 GeneID:105785 MGI:2145953
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 transcript_id : NM_134090.1

name	Ddx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93587672 GeneID:67040 MGI:1914290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 transcript_id : NM_001040187.1

name	Ddx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93587676 GeneID:67040 MGI:1914290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 transcript_id : NM_199080.2

name	Ddx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93588009 GeneID:67040 MGI:1914290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 transcript_id : NM_152806.3

name	Ddx17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40068490 GeneID:67040 MGI:1914290
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 17 transcript_id : NM_199079.1

name	BC020489 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20902713 GeneID:223672 MGI:3606001
definition	codon_start : 1 product : hypothetical protein LOC223672 isoform 1 protein_id : XP_128064.1

name	BC085284 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701568 CCDS:CCDS27600.1 GeneID:278679 MGI:3583950
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC278679 protein_id : NP_001020019.1

name	LOC624454 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266727 GeneID:624454
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478944.1

name	9030421J09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46810299 CCDS:CCDS27601.1 GeneID:245282 MGI:3036238
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245282 protein_id : NP_808412.1

name	EG626615 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957574 GeneID:626615 MGI:3649094
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896316.1

name	2210421G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425100 GeneID:108956 MGI:1920912
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC108956 protein_id : NP_780600.1

name	9130218O11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244374 GeneID:328561 MGI:3043522
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC328561 protein_id : NP_808488.1

name	LOC666661 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266680 GeneID:666661
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476454.1

name	EG545115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94398767 GeneID:545115 MGI:3646982
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619334.3

name	LOC666348 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94398733 GeneID:666348
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_997554.1

name	2310016F22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424585 CCDS:CCDS27604.1 GeneID:71898 MGI:1919148
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA] codon_start : 1 note : Apolipoprotein L product : hypothetical protein LOC71898 protein_id : NP_776104.1

name	Apol2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266686 GeneID:239552 MGI:2444921
definition	codon_start : 1 product : apolipoprotein L, 2 protein_id : XP_139463.5

name	Myh9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326446 CCDS:CCDS27605.1 GeneID:17886 MGI:107717
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0000904 - cellular morphogenesis during differentiation [Evidence IMP]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; myosin heavy chain IX product : myosin, heavy polypeptide 9, non-muscle isoform 1 protein_id : NP_071855.2

name	Txn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9903609 CCDS:CCDS27606.1 GeneID:56551 MGI:1929468
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : thioredoxin nuclear gene encoding mitochondrial protein; thioredoxin, mitochondrial product : thioredoxin 2 protein_id : NP_064297.1

name	Foxred2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972421 CCDS:CCDS27607.1 GeneID:239554 MGI:106315
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : FAD-dependent oxidoreductase domain containing 2 protein_id : NP_001017983.1

name	Eif3s7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628629 GeneID:55944 MGI:1933181
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : translation initiation factor eIF3 p66; mouse translation initiation factor eIF3 p66 product : eukaryotic translation initiation factor 3, subunit 7 (zeta) protein_id : NP_061219.2

name	Cacng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680826 CCDS:CCDS27608.1 GeneID:12300 MGI:1316660
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0019226 - transmission of nerve impulse [Evidence IGI]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : voltage-dependent calcium channel gamma-2 subunit protein_id : NP_031609.1

name	Rabl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313158 GeneID:67042 MGI:1914292
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAB, member of RAS oncogene family-like 4 protein_id : NP_080207.1

name	Pvalb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980767 CCDS:CCDS27609.1 GeneID:19293 MGI:97821
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : parvalbumin protein_id : NP_038673.2

name	Ncf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679022 CCDS:CCDS27610.1 GeneID:17972 MGI:109186
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 exception : mismatches in translation product : neutrophil cytosolic factor 4 protein_id : NP_032703.1

name	Csf2rb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681049 CCDS:CCDS27611.1 GeneID:12984 MGI:1339760
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IEA] codon_start : 1 product : colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) protein_id : NP_031807.1

name	Csf2rb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677418 CCDS:CCDS27612.1 GeneID:12983 MGI:1339759
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : common beta chain product : colony stimulating factor 2 receptor, beta 1, low-affinity (granulocyte-macrophage) protein_id : NP_031806.2

name	1700061J05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266688 GeneID:73376 MGI:1920626
definition	codon_start : 1 product : hypothetical protein LOC73376 protein_id : XP_181371.2

name	Tst (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678449 CCDS:CCDS27614.1 GeneID:22117 MGI:98852
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004792 - thiosulfate sulfurtransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008272 - sulfate transport [Evidence IEA] codon_start : 1 product : thiosulfate sulfurtransferase, mitochondrial protein_id : NP_033463.1

name	Mpst (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301475 CCDS:CCDS27615.1 GeneID:246221 MGI:2179733
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 exception : mismatches in translation product : 3-mercaptopyruvate sulfurtransferase protein_id : NP_619611.2

name	Kctd17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948553 GeneID:72844 MGI:1920094
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 product : potassium channel tetramerisation domain containing 17 protein_id : NP_001074836.2

name	Tmprss6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125656152 GeneID:71753 MGI:1919003
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence ISS] GO_process : GO:0001525 - angiogenesis [Evidence ISS]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence ISS]; GO:0042730 - fibrinolysis [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0006508 - proteolysis [Evidence ISS] codon_start : 1 note : matriptase-2; matriptase 2 product : type II transmembrane serine protease 6 protein_id : NP_082178.2

name	Il2rb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680427 CCDS:CCDS27616.1 GeneID:16185 MGI:96550
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0019976 - interleukin-2 binding [Evidence IPI]; GO:0004911 - interleukin-2 receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence ISS]; GO:0045885 - positive regulation of survival gene product activity [Evidence ISS] codon_start : 1 note : IL-2 receptor beta chain; IL-2/15 receptor-beta; IL-15 receptor beta chain product : interleukin 2 receptor, beta chain protein_id : NP_032394.1

name	C1qtnf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754003 GeneID:72709 MGI:1919959
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : C1q and tumor necrosis factor related protein 6 protein_id : NP_082607.2

name	Sstr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370258 CCDS:CCDS27617.1 GeneID:20607 MGI:98329
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : somatostatin receptor 3 protein_id : NP_033244.2

name	EG626952 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82957608 GeneID:626952 MGI:3648054
definition	codon_start : 1 product : similar to Lage3 protein protein_id : XP_896668.1

name	Rac2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679601 CCDS:CCDS27619.1 GeneID:19354 MGI:97846
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0030031 - cell projection biogenesis [Evidence IDA]; GO:0006935 - chemotaxis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS-related C3 botulinum substrate 2 protein_id : NP_033034.1

name	Pscd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29293805 CCDS:CCDS27620.1 GeneID:72318 MGI:2441702
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 product : cytohesin 4 protein_id : NP_082471.2

name	Lrrc62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62990174 CCDS:CCDS27621.1 GeneID:207393 MGI:3608416
definition	GO_component : GO:0009986 - cell surface [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : 5leucine rich repeat containing 62 product : leucine rich repeat containing 62 protein_id : NP_898964.2

name	Mfng (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678872 CCDS:CCDS27622.1 GeneID:17305 MGI:1095404
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA] codon_start : 1 product : O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase protein_id : NP_032621.1

name	Card10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18699996 CCDS:CCDS27623.1 GeneID:105844 MGI:2146012
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0030159 - receptor signaling complex scaffold activity [Evidence ISS] GO_process : GO:0007250 - activation of NF-kappaB-inducing kinase [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : caspase recruitment domain family, member 10 protein_id : NP_570929.1

name	LOC100041601 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266699 GeneID:100041601
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476719.1

name	Cdc42ep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312428 CCDS:CCDS27624.1 GeneID:104445 MGI:1929763
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008360 - regulation of cell shape [Evidence IEA]; GO:0007266 - Rho protein signal transduction [Evidence IDA] codon_start : 1 note : binder of Rho GTPase 5 product : CDC42 effector protein (Rho GTPase binding) 1 protein_id : NP_081495.1

name	Lgals2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385082 GeneID:107753 MGI:895068
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : lectin, galactose-binding, soluble 2 protein_id : NP_079898.1

name	Gga1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122347 CCDS:CCDS27625.1 GeneID:106039 MGI:2146207
definition	GO_component : GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : golgi associated, gamma adaptin ear containing, ARF binding protein 1 protein_id : NP_666041.1

name	Sh3bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85838509 CCDS:CCDS27626.1 GeneID:20401 MGI:104603
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : SH3-domain binding protein 1 protein_id : NP_033190.2

name	Pdxp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059486 CCDS:CCDS27627.1 GeneID:57028 MGI:1919282
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : PLP-phosophatase product : pyridoxal phosphate phosphatase protein_id : NP_064667.2

name	Lgals1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678682 CCDS:CCDS27628.1 GeneID:16852 MGI:96777
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005534 - galactose binding [Evidence NAS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007157 - heterophilic cell adhesion [Evidence NAS]; GO:0045445 - myoblast differentiation [Evidence IDA] codon_start : 1 note : beta-galactoside binding protein product : lectin, galactose binding, soluble 1 protein_id : NP_032521.1

name	Nol12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542287 CCDS:CCDS27629.1 GeneID:97961 MGI:2146285
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS] [Evidence IDA] GO_function : GO:0019843 - rRNA binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : 25 kDa nucleolar protein product : nucleolar protein 12 protein_id : NP_598561.2

name	Triobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88501749 GeneID:110253 MGI:1349410
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0045159 - myosin II binding [Evidence ISS] GO_process : GO:0030047 - actin modification [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; trio-associated repeat on actin product : TRIO and F-actin binding protein isoform 3 protein_id : NP_001034245.1

name	Triobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88501743 GeneID:110253 MGI:1349410
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0045159 - myosin II binding [Evidence ISS] GO_process : GO:0030047 - actin modification [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 5 is encoded by transcript variant 5; trio-associated repeat on actin product : TRIO and F-actin binding protein isoform 5 protein_id : NP_613045.3

name	Triobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88501747 GeneID:110253 MGI:1349410
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0045159 - myosin II binding [Evidence ISS] GO_process : GO:0030047 - actin modification [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; trio-associated repeat on actin product : TRIO and F-actin binding protein isoform 4 protein_id : NP_001034244.1

name	Triobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88501745 GeneID:110253 MGI:1349410
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0017049 - GTP-Rho binding [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0045159 - myosin II binding [Evidence ISS] GO_process : GO:0030047 - actin modification [Evidence ISS]; GO:0051016 - barbed-end actin filament capping [Evidence ISS]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; trio-associated repeat on actin product : TRIO and F-actin binding protein isoform 1 protein_id : NP_001019887.1

name	H1f0 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560697 GeneID:14958 MGI:95893
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : H1-0 histone product : H1 histone family, member 0 protein_id : NP_032223.2

name	Gcat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560488 CCDS:CCDS27630.1 GeneID:26912 MGI:1349389
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0008890 - glycine C-acetyltransferase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : aminoacetone synthase product : glycine C-acetyltransferase (2-amino-3-ketobutyrate-coenzyme A ligase) protein_id : NP_038875.2

name	Galr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657114 CCDS:CCDS27631.1 GeneID:14429 MGI:1329003
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004966 - galanin receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : galanin receptor 3 protein_id : NP_056553.1

name	LOC100042603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266740 GeneID:100042603
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479375.1

name	Ankrd54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450059 GeneID:223690 MGI:2444209
definition	codon_start : 1 note : Mus EST 475269; Mus EST 1068184 product : ankyrin repeat domain 54 protein_id : NP_659098.1

name	Eif3s6ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51093840 CCDS:CCDS27632.1 GeneID:223691 MGI:2386251
definition	GO_component : GO:0001650 - fibrillar center [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005654 - nucleoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 note : polymerase-associated factor 67kda product : eukaryotic translation initiation factor 3 subunit 6 interacting protein protein_id : NP_660121.2

name	1700088E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070386 CCDS:CCDS27633.1 GeneID:27660 MGI:1920774
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Mus EST J0827E04 product : hypothetical protein LOC27660 protein_id : NP_613047.1

name	Polr2f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037181 CCDS:CCDS27634.1 GeneID:69833 MGI:1349393
definition	GO_component : GO:0030880 - RNA polymerase complex [Evidence IEA] GO_function : GO:0003899 - DNA-directed RNA polymerase activity [Evidence IDA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006351 - transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : RNA Pol II product : DNA directed RNA polymerase II polypeptide F protein_id : NP_081507.1

name	Sox10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149266701 GeneID:20665 MGI:98358
definition	codon_start : 1 product : SRY-box containing gene 10 isoform 1 protein_id : XP_128139.5

name	LOC100041655 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149266703 GeneID:100041655
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476810.1

name	Pick1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930731 GeneID:18693 MGI:894645
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0042734 - presynaptic membrane [Evidence ISS]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0016887 - ATPase activity [Evidence IDA] [Evidence ISS]; GO:0046875 - ephrin receptor binding [Evidence ISS]; GO:0051020 - GTPase binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0035256 - metabotropic glutatmate receptor binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA]; GO:0008022 - protein C-terminus binding [Evidence ISS]; GO:0005080 - protein kinase C binding [Evidence TAS] [Evidence ISS] [Evidence IPI]; GO:0030971 - receptor tyrosine kinase binding [Evidence ISS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence NAS]; GO:0015872 - dopamine transport [Evidence ISS]; GO:0015844 - monoamine transport [Evidence ISS]; GO:0045161 - neuronal ion channel clustering [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0051260 - protein homooligomerization [Evidence ISS] [Evidence TAS]; GO:0007205 - protein kinase C activation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence NAS]; GO:0006605 - protein targeting [Evidence IDA]; GO:0043113 - receptor clustering [Evidence IDA]; GO:0050803 - regulation of synapse structure and function [Evidence NAS]; GO:0006890 - retrograde vesicle-mediated transport, Golgi to ER [Evidence ISS] codon_start : 1 note : protein that interacts with C kinase 1; protein kinase C, alpha binding protein product : protein interacting with C kinase 1 protein_id : NP_001039023.1

name	Pick1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930724 CCDS:CCDS27635.1 GeneID:18693 MGI:894645
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS] [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0042734 - presynaptic membrane [Evidence ISS]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0016887 - ATPase activity [Evidence IDA] [Evidence ISS]; GO:0046875 - ephrin receptor binding [Evidence ISS]; GO:0051020 - GTPase binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0035256 - metabotropic glutatmate receptor binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA]; GO:0008022 - protein C-terminus binding [Evidence ISS]; GO:0005080 - protein kinase C binding [Evidence TAS] [Evidence ISS] [Evidence IPI]; GO:0030971 - receptor tyrosine kinase binding [Evidence ISS]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence NAS]; GO:0015872 - dopamine transport [Evidence ISS]; GO:0015844 - monoamine transport [Evidence ISS]; GO:0045161 - neuronal ion channel clustering [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0051260 - protein homooligomerization [Evidence ISS] [Evidence TAS]; GO:0007205 - protein kinase C activation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence NAS]; GO:0006605 - protein targeting [Evidence IDA]; GO:0043113 - receptor clustering [Evidence IDA]; GO:0050803 - regulation of synapse structure and function [Evidence NAS]; GO:0006890 - retrograde vesicle-mediated transport, Golgi to ER [Evidence ISS] codon_start : 1 note : protein that interacts with C kinase 1; protein kinase C, alpha binding protein product : protein interacting with C kinase 1 protein_id : NP_032863.2

name	Slc16a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048452 CCDS:CCDS27636.1 GeneID:57274 MGI:1929519
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015355 - monocarboxylate porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015711 - organic anion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : monocarboxylate transporter 3; proton-coupled monocarboxylate transporter 3; preferentially expressed in RPE cells and choroid plexus epithelium product : solute carrier family 16, member 8 protein_id : NP_065262.1

name	Baiap2l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243932 GeneID:207495 MGI:2652819
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : BAI1-associated protein 2-like 2 protein_id : NP_808248.1

name	Pla2g6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393978 CCDS:CCDS27637.1 GeneID:53357 MGI:1859152
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004623 - phospholipase A2 activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA] codon_start : 1 note : 85 kDa calcium-independent phospholipase A2 product : phospholipase A2, group VI protein_id : NP_058611.1

name	Maff (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754608 CCDS:CCDS27638.1 GeneID:17133 MGI:96910
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IGI]; GO:0045604 - regulation of epidermal cell differentiation [Evidence IGI]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : avian musculoaponeurotic fibrosarcoma virus (v-maf) AS42 oncogene, protein F product : v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F protein_id : NP_034885.1

name	4732495E13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61969668 CCDS:CCDS27639.1 GeneID:223693 MGI:2445179
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC223693 protein_id : NP_766196.1

name	Csnk1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542425 CCDS:CCDS27640.1 GeneID:27373 MGI:1351660
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : KC1 epsilon; CKI, epsilon product : casein kinase 1 epsilon protein_id : NP_038795.3

name	Kcnj4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358362 CCDS:CCDS27641.1 GeneID:16520 MGI:104743
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005242 - inward rectifier potassium channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Kir 2.3 product : potassium inwardly-rectifying channel J4 protein_id : NP_032453.2

name	Kdelr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527316 CCDS:CCDS27642.1 GeneID:105785 MGI:2145953
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046923 - ER retention sequence binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006621 - protein retention in ER [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 protein_id : NP_598851.1

name	Ddx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93587673 GeneID:67040 MGI:1914290
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : DEAD box polypeptide 17 isoform 4 protein_id : NP_001035277.1

name	Ddx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068493 CCDS:CCDS27643.1 GeneID:67040 MGI:1914290
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DEAD box polypeptide 17 isoform 1 protein_id : NP_951062.1

name	Ddx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068489 GeneID:67040 MGI:1914290
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : DEAD box polypeptide 17 isoform 3 protein_id : NP_690019.2

name	Ddx17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068491 GeneID:67040 MGI:1914290
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DEAD box polypeptide 17 isoform 2 protein_id : NP_951061.1

name	EG666639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666639
definition	number : 2 pseudo : _no_value

name	EG666639 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666639
definition	number : 1 pseudo : _no_value

name	LOC666679 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666679
definition	number : 1 pseudo : _no_value

name	LOC675798 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675798
definition	number : 1 pseudo : _no_value

name	LOC675798 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675798
definition	number : 2 pseudo : _no_value

name	LOC675798 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675798
definition	number : 3 pseudo : _no_value

name	LOC675798 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675798
definition	number : 4 pseudo : _no_value

name	LOC100041676 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041676
definition	number : 2 pseudo : _no_value

name	LOC100041676 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041676
definition	number : 1 pseudo : _no_value

name	A330102K04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149266730 GeneID:328563 MGI:3036248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 2 Proteins product : RIKEN cDNA A330102K04 gene transcript_id : XR_033988.1

name	LOC641104 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149266736 GeneID:641104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 6 Proteins product : similar to transmembrane protein pseudo : _no_value transcript_id : XR_034105.1

clone name	MSMg01-328D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-275G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548N09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-438L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479B14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-537E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-280O01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-461J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447E14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-232E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399O12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423O21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232C23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-059J01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-475H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-295O03.b	B6Ng01-295O03.g
ACC	GA091640	GA091641
length	1,079	1,102
definition	B6Ng01-295O03.b	B6Ng01-295O03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(78,385,304 - 78,386,389)	(78,233,422 - 78,234,522)
sequence	tcttacttggtaatccctccacagggacaagttagccaagatatagcatt taagggaagaaagatttgctttggcttgtttccaaggctttggttggtgg ttggtcaattcttcccttttaggccagtagcgaggctggaacaccatgta ggaaggacatggtggagcagagcttgctcatctctgtaatctgccagcaa acggataaagaacaaagagccaggaccaaggtttacccttccgaaccacg gtctgagtgacctgcgccgtacgttccgcagttccacttcccaacagtct gtctgaaattagactctcggggggttaaatcagtggttaactcagaggct ccattatctagtcgtttctggaaatgatcacactcaggctgttctttatg aatttcctaggtgtctctcaattcaatcaacttgataattgagattcacc tttgcagtcccagcccatgtcagtttgacacctaatgcatttccttagat cacacttaatctccaaataaagacggttgcagaagacgaccagtctactc aacacggctgccctgttcataccccggactgcactgaggttttctccaaa cgtctcaacaattttaatattgatcaaaagttcaaactgaaactgagagt ccaggcaaattgacaaactcaaaagtatataacaccacacagtaaacact cttattcttttgggttgaacagggtgtagagagactctttcgtgcactgg gtgggagcatcacctgtcaataaaaagctactggcctattagcttagaca ggaagtaggaggtgggagtcttggcaggaagagaggattctgggatagag tctgctgtgggaggatatttgcctgaactcggaggagacagatttatgaa actgagaagaggtagccagccgtgtggcactcatgaatagaataaacagt taattgagttacgagttagtcgggaacaagcccaagctgtggcttagcca tttattaattcagagtatttcgaaggtgggttctgggccgcagcaatgcg aggcggcggcctggtaacggtgaaggtgg	gaattcccattttatagatgaggaaaactgaggcttggagttgggagaca acctactactggcaaaggccctagagatccctgaattctaagatgcctct cttctctgtgatccttcctacttactctggttgcccagactctgggggcc tgacttacatctgtctttgtttgctagtgttcctgcctgtgtgacacaca gctgcatctgaatattcttttttttattctgcatgcttactcaggactct ggaaggcgcatgaaggcctgaggggcaggcaactgcccctcccccctact cccactcccaccccccagggcaggaagttgccactgggtctctgaagacc tgcttttcatttctgccactctcagtaccttcaggaacacccagtcaagg cctccccaccccccacatcccatgctttgtatctggactgctgaacccgg aggaacctccccgaacccatcccacagagcagaccatgaccttggtggtg tgcatttgtgtccagcaaatcctctcacagaatgggtcaagtagcccctc cctgcctgtctagatggcccctggactttgcccagtgccgtcccctccaa agagcccctgaaacaaaagccatgtactgtgacagggctggggacctctg cttgtttatcaacaaccaggaaatgcaaggtcaagcagttgggctgaacc ctccacataaaagtggctgagctggaatgagaacccagtctccctggcac ttcagggcaatcagaaaaggtaggaagagtcagagagaagagagggacct tagaactcaggcagcctgtgtcccctctacaagccccgactttcctcgtc tgtaaaatgataggacgctatgtctgggccccattatcactcatttcttg gtttgcagcccaggaaagcccaatgggccagctccactctccctttcctt ccagtttcagttccaagaagaaaatggggttttgagtcagaccaggaggc atcccaggttcagagtctctggaaagtgcctaacagcatgcatctttctc ctctgacctttcccagagcaagcaggcggggagaattcaaagctggagag ag
quality values	Open. Hide. 41 62 62 62 43 47 62 62 62 49 62 62 56 47 62 62 62 62 62 44 42 62 47 62 59 59 11 59 34 28 32 46 50 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 51 58 58 58 58 58 54 47 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 41 54 43 54 58 42 54 54 54 58 58 52 54 54 58 58 52 54 58 54 58 54 58 58 58 58 58 47 58 54 58 58 54 51 46 51 49 58 47 41 58 46 58 45 39 58 58 58 50 46 58 58 45 41 49 50 58 58 51 53 53 49 49 50 51 51 51 58 58 53 54 53 50 50 58 49 49 51 58 58 37 40 58 58 53 49 58 58 47 46 49 46 51 58 58 50 58 51 51 42 58 50 51 58 54 49 51 40 51 58 58 58 19 36 52 52 50 43 42 53 39 49 44 58 44 28 58 49 47 50 40 58 58 50 58 47 39 58 58 49 38 53 45 53 53 51 58 51 49 51 58 58 42 58 50 58 54 53 39 41 58 58 51 37 54 54 52 54 32 49 35 54 49 40 54 54 49 42 36 42 49 47 52 42 51 44 39 42 54 49 25 51 34 40 36 54 42 53 45 46 29 54 53 51 54 54 42 40 47 52 37 30 34 37 37 54 54 32 49 54 54 46 25 53 34 38 37 37 54 51 40 51 39 31 21 47 47 32 53 53 53 52 29 37 32 31 37 35 47 25 25 52 32 40 31 32 32 33 32 30 37 32 16 33 31 36 45 35 33 35 33 36 33 33 31 46 14 51 31 42 51 38 33 19 30 31 32 45 30 41 30 12 22 21 43 37 31 51 20 31 22 43 25 15 26 32 30 32 47 31 21 21 31 25 42 29 34 31 31 43 38 31 42 31 42 46 33 31 9 31 31 24 31 34 48 44 27 32 31 31 25 21 31 19 32 26 33 15 31 31 16 39 15 25 17 21 28 25 18 48 35 30 38 34 36 46 31 34 36 32 29 16 29 34 29 36 13 22 12 32 27 26 16 14 32 27 33 19 31 38 22 23 30 25 29 32 34 34 24 32 27 26 23 19 31 17 28 34 30 29 48 32 34 28 31 33 29 21 19 13 22 34 34 24 24 22 21 37 9 22 10 17 17 26 19 31 24 33 47 21 17 12 18 8 25 12 25 37 33 8 18 24 21 22 4 9 15 24 12 18 18 27 12 27 27 15 28 47 28 23 25 23 15 12 18 17 16 27 9 17 9 10 23 5 30 6 18 4 21 22 18 17 16 20 40 19 7 6 9 10 12 40 21 14 15 7 10 9 5 14 12 10 17 11 3 3 2 5 18 15 5 16 10 8 24 6 7 9 12 16 9 7 11 8 4 5 10 6 15 8 11 16 12 7 18	Open. Hide. 62 47 39 44 62 62 62 47 44 62 62 62 43 39 45 21 22 24 46 38 49 43 49 43 56 62 62 59 62 62 59 59 54 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 54 54 56 62 62 59 62 59 62 62 62 62 59 54 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 56 56 49 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 46 62 62 47 31 62 62 62 47 62 62 62 62 62 62 52 62 47 54 62 62 52 62 62 62 62 62 62 62 54 49 47 62 62 52 62 39 62 58 58 58 45 42 58 58 58 58 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 58 58 58 45 41 58 58 54 58 54 54 54 54 54 54 58 58 54 52 58 48 58 54 54 58 58 58 54 54 54 58 54 54 54 50 54 52 52 41 39 54 54 52 54 58 54 52 54 58 58 54 51 53 50 51 51 58 58 40 58 47 47 51 58 52 45 38 58 58 58 51 51 50 45 50 35 32 58 49 58 51 52 52 50 48 43 41 49 39 29 58 58 39 58 50 50 49 48 50 50 49 58 49 50 50 50 58 58 43 42 51 54 49 54 58 49 50 49 51 58 51 51 41 46 41 50 58 35 49 50 49 49 38 41 18 18 39 50 52 49 51 50 51 41 58 42 58 40 50 53 49 40 44 44 24 49 44 50 42 42 39 58 58 52 47 51 50 29 31 53 54 40 41 42 53 40 50 40 37 50 51 54 38 39 47 53 44 54 40 37 44 50 52 53 53 39 53 42 47 24 54 54 49 34 42 49 39 40 53 47 54 16 42 52 52 54 37 41 37 40 53 40 53 28 19 42 44 30 42 40 40 45 34 52 40 32 45 39 38 32 37 47 49 31 25 7 49 32 18 24 34 40 36 32 27 49 51 47 47 23 32 21 42 33 45 52 47 32 47 20 53 39 29 32 46 14 51 30 51 51 26 46 21 45 21 46 38 15 9 38 31 37 31 16 38 37 31 32 30 26 30 46 30 28 28 32 31 32 29 27 43 31 31 30 30 27 29 25 30 23 31 29 32 32 42 41 41 23 18 32 21 40 46 30 21 18 14 30 21 21 31 31 42 24 29 46 46 37 31 31 32 32 33 17 30 29 29 32 32 32 25 36 31 30 21 32 38 46 32 25 30 31 23 19 28 39 27 22 31 25 27 31 30 23 37 48 32 27 21 27 23 28 16 47 28 30 26 32 27 19 44 18 18 24 20 29 47 37 16 13 44 25 19 6 18 25 44 9 25 19 31 28 34 34 23 30 19 16 19 19 13 24 47 31 14 47 14 21 30 10 17 21 24 10 10 26 43 23 32 21 17 25 21 21 24 10 28 21 30 26 20 32 39 48 34 32 32 43 43 28 7 43 48 33 21 26 21 34 21 21 4 8 14 21 28 14 8 20 11 15 23 8 27 19 32 21 12 18 9 18 15 11 7 7 13 7 19 27 28 24 18 21 7 5 40 27 16 21 17 8 15 23 11 15 8 28 14 20 13 24 16 20 13 11 6 18 40 21 13 11 12 14 12 10 10 10 16 7 8 4 17 13 9 25 9 10 5 14 1 3 2 4 15 21 8 12 9 4 6 29 15 3 12 5 21 19 5 11 13 7 18 15 11 3 2 7 6 2 5 7 7 5 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr15_78385304_78386389
seq2: B6Ng01-295O03.b_56_1134 (reverse)

seq1  CCACCTTCA-CGTTACCAGCCCGCCGCCTCCGCCATTGCTGCGGCCCAGA  49
      ||||||||| ||||||||| ||||||||||   |||||||||||||||||
seq2  CCACCTTCACCGTTACCAGGCCGCCGCCTC--GCATTGCTGCGGCCCAGA  48

seq1  ACCCACCTTCGGAATTACTTCTTGAATTAATAAATGGCTAAGCCACAAGC  99
      |||||||||| ||| ||||   |||||||||||||||||||||||| |||
seq2  ACCCACCTTC-GAAATACT--CTGAATTAATAAATGGCTAAGCCAC-AGC  94

seq1  TTGGGCTTGTTCCCCGACTAACTCGTAACTCAATTAACTGTTTATTCTAT  149
      ||||||||||| ||||||||||||||||||||||||||||||||||||| 
seq2  TTGGGCTTGTT-CCCGACTAACTCGTAACTCAATTAACTGTTTATTCTA-  142

seq1  TTCATGAGTGCCACACGGCTGGCTACCTCTTCTCAGTTTCATAAATCTGT  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATGAGTGCCACACGGCTGGCTACCTCTTCTCAGTTTCATAAATCTGT  192

seq1  CTCCTCCGAGTTCAGGCAAATATCCTCCCACAGCAGACTCTATCCCAGAA  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTCCGAGTTCAGGCAAATATCCTCCCACAGCAGACTCTATCCCAGAA  242

seq1  TCCTCTCTTCCTGCCAAGACTCCCACCTCCTACTTCCTGTCTAAGCTAAT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTCTTCCTGCCAAGACTCCCACCTCCTACTTCCTGTCTAAGCTAAT  292

seq1  AGGCCAGTAGCTTTTTATTGACAGGTGATGCTCCCACCCAGTGCACGAAA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCAGTAGCTTTTTATTGACAGGTGATGCTCCCACCCAGTGCACGAAA  342

seq1  GAGTCTCTCTACACCCTGTTCAACCCAAAAGAATAAGAGTGTTTACTGTG  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTCTCTCTACACCCTGTTCAACCCAAAAGAATAAGAGTGTTTACTGTG  392

seq1  TGGTGTTATATACTTTTGAGTTTGTCAATTTGCCTGGACTCTCAGTTTCA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGTTATATACTTTTGAGTTTGTCAATTTGCCTGGACTCTCAGTTTCA  442

seq1  GTTTGAACTTTTGATCAATATTAAAATTGTTGAGACGTTTGGAGAAAACC  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGAACTTTTGATCAATATTAAAATTGTTGAGACGTTTGGAGAAAACC  492

seq1  TCAGTGCAGTCCGGGGTATGAACAGGGCAGCCGTGTTGAGTAGACTGGTC  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTGCAGTCCGGGGTATGAACAGGGCAGCCGTGTTGAGTAGACTGGTC  542

seq1  GTCTTCTGCAACCGTCTTTATTTGGAGATTAAGTGTGATCTAAGGAAATG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTCTGCAACCGTCTTTATTTGGAGATTAAGTGTGATCTAAGGAAATG  592

seq1  CATTAGGTGTCAAACTGACATGGGCTGGGACTGCAAAGGTGAATCTCAAT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTAGGTGTCAAACTGACATGGGCTGGGACTGCAAAGGTGAATCTCAAT  642

seq1  TATCAAGTTGATTGAATTGAGAGACACCTAGGAAATTCATAAAGAACAGC  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCAAGTTGATTGAATTGAGAGACACCTAGGAAATTCATAAAGAACAGC  692

seq1  CTGAGTGTGATCATTTCCAGAAACGACTAGATAATGGAGCCTCTGAGTTA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGTGTGATCATTTCCAGAAACGACTAGATAATGGAGCCTCTGAGTTA  742

seq1  ACCACTGATTTAACCCCCCGAGAGTCTAATTTCAGACAGACTGTTGGGAA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACTGATTTAACCCCCCGAGAGTCTAATTTCAGACAGACTGTTGGGAA  792

seq1  GTGGAACTGCGGAACGTACGGCGCAGGTCACTCAGACCGTGGTTCGGAAG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAACTGCGGAACGTACGGCGCAGGTCACTCAGACCGTGGTTCGGAAG  842

seq1  GGTAAACCTTGGTCCTGGCTCTTTGTTCTTTATCCGTTTGCTGGCAGATT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAAACCTTGGTCCTGGCTCTTTGTTCTTTATCCGTTTGCTGGCAGATT  892

seq1  ACAGAGATGAGCAAGCTCTGCTCCACCATGTCCTTCCTACATGGTGTTCC  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAGATGAGCAAGCTCTGCTCCACCATGTCCTTCCTACATGGTGTTCC  942

seq1  AGCCTCGCTACTGGCCTAAAAGGGAAGAATTGACCAACCACCAACCAAAG  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTCGCTACTGGCCTAAAAGGGAAGAATTGACCAACCACCAACCAAAG  992

seq1  CCTTGGAAACAAGCCAAAGCAAATCTTTCTTCCCTTAAATGCTATATCTT  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGGAAACAAGCCAAAGCAAATCTTTCTTCCCTTAAATGCTATATCTT  1042

seq1  GGCTAACTTGTCCCTGTGGAGGGATTACCAAGTAAGA  1086
      |||||||||||||||||||||||||||||||||||||
seq2  GGCTAACTTGTCCCTGTGGAGGGATTACCAAGTAAGA  1079

seq1: chr15_78233422_78234522
seq2: B6Ng01-295O03.g_65_1166

seq1  GAATTCCCATTTTATAGATGAGGAAAACTGAGGCTTGGAGTTGGGAGACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCATTTTATAGATGAGGAAAACTGAGGCTTGGAGTTGGGAGACA  50

seq1  ACCTACTACTGGCAAAGGCCCTAGAGATCCCTGAATTCTAAGATGCCTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTACTACTGGCAAAGGCCCTAGAGATCCCTGAATTCTAAGATGCCTCT  100

seq1  CTTCTCTGTGATCCTTCCTACTTACTCTGGTTGCCCAGACTCTGGGGGCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCTGTGATCCTTCCTACTTACTCTGGTTGCCCAGACTCTGGGGGCC  150

seq1  TGACTTACATCTGTCTTTGTTTGCTAGTGTTCCTGCCTGTGTGACACACA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTTACATCTGTCTTTGTTTGCTAGTGTTCCTGCCTGTGTGACACACA  200

seq1  GCTGCATCTGAATATTCTTTTTTTTATTCTGCATGCTTACTCAGGACTCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCATCTGAATATTCTTTTTTTTATTCTGCATGCTTACTCAGGACTCT  250

seq1  GGAAGGCGCATGAAGGCCTGAGGGGCAGGCAACTGCCCCTCCCCCCTACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGCGCATGAAGGCCTGAGGGGCAGGCAACTGCCCCTCCCCCCTACT  300

seq1  CCCACTCCCACCCCCCAGGGCAGGAAGTTGCCACTGGGTCTCTGAAGACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACTCCCACCCCCCAGGGCAGGAAGTTGCCACTGGGTCTCTGAAGACC  350

seq1  TGCTTTTCATTTCTGCCACTCTCAGTACCTTCAGGAACACCCAGTCAAGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTTTCATTTCTGCCACTCTCAGTACCTTCAGGAACACCCAGTCAAGG  400

seq1  CCTCCCCACCCCCCACATCCCATGCTTTGTATCTGGACTGCTGAACCCGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCCACCCCCCACATCCCATGCTTTGTATCTGGACTGCTGAACCCGG  450

seq1  AGGAACCTCCCCGAACCCATCCCACAGAGCAGACCATGACCTTGGTGGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAACCTCCCCGAACCCATCCCACAGAGCAGACCATGACCTTGGTGGTG  500

seq1  TGCATTTGTGTCCAGCAAATCCTCTCACAGAATGGGTCAAGTAGCCCCTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATTTGTGTCCAGCAAATCCTCTCACAGAATGGGTCAAGTAGCCCCTC  550

seq1  CCTGCCTGTCTAGATGGCCCCTGGACTTTGCCCAGTGCCGTCCCCTCCAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCCTGTCTAGATGGCCCCTGGACTTTGCCCAGTGCCGTCCCCTCCAA  600

seq1  AGAGCCCCTGAAACAAAAGCCATGTACTGTGACAGGGCTGGGGACCTCTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCCCCTGAAACAAAAGCCATGTACTGTGACAGGGCTGGGGACCTCTG  650

seq1  CTTGTTTATCAACAACCAGGAAATGCAAGGTCAAGCAGTTGGGCTGAACC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTTTATCAACAACCAGGAAATGCAAGGTCAAGCAGTTGGGCTGAACC  700

seq1  CTCCACATAAAAGTGGCTGAGCTGGAATGAGAACCCAGTCTCCCTGGCAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCACATAAAAGTGGCTGAGCTGGAATGAGAACCCAGTCTCCCTGGCAC  750

seq1  TTCAGGGCAATCAGAAAAGGTAGGAAGAGTCAGAGAGAAGAGAGGGACCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGGGCAATCAGAAAAGGTAGGAAGAGTCAGAGAGAAGAGAGGGACCT  800

seq1  TAGAACTCAGGCAGCCTGTGTCCCCTCTACAAGCCCCGACTTTCCTCGTC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAACTCAGGCAGCCTGTGTCCCCTCTACAAGCCCCGACTTTCCTCGTC  850

seq1  TGTAAAATGATAGGACGCTATGTCTGGGCCCCATTATCACTCATTTCTTG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAAAATGATAGGACGCTATGTCTGGGCCCCATTATCACTCATTTCTTG  900

seq1  GTTTGCAG-CCAGGAAAGCCCAAT-GGCCAGCTCCACTCTCCCTT--CCT  946
      |||||||| ||||||||||||||| ||||||||||||||||||||  | |
seq2  GTTTGCAGCCCAGGAAAGCCCAATGGGCCAGCTCCACTCTCCCTTTCCTT  950

seq1  CCAGTTTCAGTTCCAAGAAGAAAATGGGGTTTTGAGTCAAGACCAGGAGG  996
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  CCAGTTTCAGTTCCAAGAAGAAAATGGGGTTTTGAGTC-AGACCAGGAGG  999

seq1  CATCCCAGGTTCAGAGTCTCTGGAAAGTGCCTAACAAGCATGCATCTTTC  1046
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  CATCCCAGGTTCAGAGTCTCTGGAAAGTGCCTAAC-AGCATGCATCTTTC  1048

seq1  TCCTCTGACC-TTCCCAGAGCCAAGCAGGC-GGGAGAAATCAAAGGCCTG  1094
      |||||||||| ||||||||| ||||||||| ||||||| ||||||  |||
seq2  TCCTCTGACCTTTCCCAGAG-CAAGCAGGCGGGGAGAATTCAAAG--CTG  1095

seq1  GAGAGAG  1101
      |||||||
seq2  GAGAGAG  1102

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information