MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-052J17
Chromosome	16 (Build37)
Map Location	36,367,199 - 36,368,354
singlet/doublet	singlet
Overlap gene	BC100530
Upstream gene	Pdia5, Sema5b, EG546663, Dirc2, Hspbap1, Parp14, LOC667133, LOC100043217, Dtx3l, Parp9, Kpna1, Wdr5b, 2310056P07Rik, Ccdc58, Csta, Stfa2l1, EG433016, EG627962, EG408196, 2010005H15Rik, Stfa1, EG209324, LOC100038854
Downstream gene	LOC639105, Stfa2, Stfa3, Casr, EG667232, Cd86, Ildr1, LOC667246, Slc15a2, LOC667023, Eaf2, Iqcb1, LOC628101, Golgb1, Hcls1, Fbxo40, LOC100043252, Polq, Stxbp5l
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pdia5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72599 MGI:1919849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20357 MGI:107555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546663 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546663 MGI:3648418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 7 Proteins

name	Dirc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224132 MGI:2387188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspbap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66667 MGI:1913917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547253 MGI:1919489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667133 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100043217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 290 ESTs, 5 Proteins

name	Dtx3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209200 MGI:2656973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80285 MGI:1933117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kpna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16646 MGI:103560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69544 MGI:1916794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310056P07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70186 MGI:1917436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381045 MGI:2146423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209294 MGI:3524930
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stfa2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268885 MGI:3524944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433016 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433016 MGI:3645124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627962 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627962 MGI:3648348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 3 Proteins pseudo : _no_value

name	EG408196 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408196 MGI:3644688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010005H15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76770 MGI:1924020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stfa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20861 MGI:106198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG209324 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209324 MGI:3648404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100038854 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC100530 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100034684 MGI:3696883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC639105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Stfa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20862 MGI:106197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stfa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20863 MGI:106196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12374 MGI:1351351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667232 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667232 MGI:3645223
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Cd86 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12524 MGI:101773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ildr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106347 MGI:2146574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667246 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Slc15a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57738 MGI:1890457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667023 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 10 Proteins pseudo : _no_value

name	Eaf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106389 MGI:2146616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqcb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320299 MGI:2443764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 20 ESTs

name	Golgb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224139 MGI:1099447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 153 ESTs, 6 Proteins

name	Hcls1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15163 MGI:104568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207215 MGI:2443753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043252 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Polq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77782 MGI:2155399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stxbp5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207227 MGI:2443815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdia5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794139 GeneID:72599 MGI:1919849
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein disulfide isomerase associated 5 transcript_id : NM_028295.1

name	Sema5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305472 GeneID:20357 MGI:107555
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B transcript_id : NM_013661.1

name	EG546663 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267528 GeneID:546663 MGI:3648418
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 7 Proteins product : predicted gene, EG546663 transcript_id : XM_001002128.2

name	Dirc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130106 GeneID:224132 MGI:2387188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : disrupted in renal carcinoma 2 (human) transcript_id : NM_153550.3

name	Hspbap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587016 GeneID:66667 MGI:1913917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Hspb associated protein 1 transcript_id : NM_175111.3

name	Parp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380136 GeneID:547253 MGI:1919489
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 14 transcript_id : NM_001039530.2

name	LOC100043217 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267375 GeneID:100043217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 290 ESTs, 5 Proteins product : similar to ribosomal protein L35a transcript_id : XM_001479761.1

name	Dtx3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133930783 GeneID:209200 MGI:2656973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deltex 3-like (Drosophila) transcript_id : NM_001013371.2

name	Parp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48976071 GeneID:80285 MGI:1933117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 9 transcript_id : NM_030253.2

name	Kpna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383300 GeneID:16646 MGI:103560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : karyopherin (importin) alpha 1 transcript_id : NM_008465.3

name	Wdr5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476275 GeneID:69544 MGI:1916794
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 5B transcript_id : NM_027113.2

name	2310056P07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312545 GeneID:70186 MGI:1917436
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310056P07 gene transcript_id : NM_027342.1

name	Ccdc58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348527 GeneID:381045 MGI:2146423
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 58 transcript_id : NM_198645.1

name	Csta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372781 GeneID:209294 MGI:3524930
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystatin A transcript_id : NM_001033239.2

name	Stfa2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371167 GeneID:268885 MGI:3524944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stefin A2 like 1 transcript_id : NM_173869.3

name	EG433016 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127140961 GeneID:433016 MGI:3645124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG433016 transcript_id : NM_001082547.1

name	EG408196 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139205 GeneID:408196 MGI:3644688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG408196 transcript_id : NM_001082542.1

name	2010005H15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802035 GeneID:76770 MGI:1924020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010005H15 gene transcript_id : NM_029733.2

name	Stfa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139201 GeneID:20861 MGI:106198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stefin A1 transcript_id : NM_001082543.1

name	EG209324 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20892418 GeneID:209324 MGI:3648404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG209324 transcript_id : XM_156070.1

name	LOC100038854 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267262 GeneID:100038854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038854 transcript_id : XM_001471462.1

name	BC100530 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139276 GeneID:100034684 MGI:3696883
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC100530 transcript_id : NM_001082546.1

name	Stfa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139251 GeneID:20862 MGI:106197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stefin A2 transcript_id : NM_001082545.1

name	Stfa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352955 GeneID:20863 MGI:106196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stefin A3 transcript_id : NM_025288.2

name	Casr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305100 GeneID:12374 MGI:1351351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium-sensing receptor transcript_id : NM_013803.1

name	EG667232 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267387 GeneID:667232 MGI:3645223
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG667232 transcript_id : XM_989186.2

name	Cd86 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542363 GeneID:12524 MGI:101773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD86 antigen transcript_id : NM_019388.2

name	Ildr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527337 GeneID:106347 MGI:2146574
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin-like domain containing receptor 1 transcript_id : NM_134109.1

name	Slc15a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227201 GeneID:57738 MGI:1890457
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 15 (H+/peptide transporter), member 2 transcript_id : NM_021301.2

name	Eaf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254104 GeneID:106389 MGI:2146616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELL associated factor 2 transcript_id : NM_134111.2

name	Iqcb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377605 GeneID:320299 MGI:2443764
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ calmodulin-binding motif containing 1 transcript_id : NM_177128.3

name	Golgb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267530 GeneID:224139 MGI:1099447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 153 ESTs, 6 Proteins product : golgi autoantigen, golgin subfamily b, macrogolgin 1 transcript_id : XM_001481060.1

name	Hcls1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680186 GeneID:15163 MGI:104568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematopoietic cell specific Lyn substrate 1 transcript_id : NM_008225.1

name	Fbxo40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82617543 GeneID:207215 MGI:2443753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 40 transcript_id : NM_001037321.1

name	Polq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30387614 GeneID:77782 MGI:2155399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), theta transcript_id : NM_029977.1

name	Stxbp5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374311 GeneID:207227 MGI:2443815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin binding protein 5-like transcript_id : NM_172440.2

name	Pdia5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794140 GeneID:72599 MGI:1919849
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0006950 - response to stress [Evidence IDA] codon_start : 1 note : protein disulfide isomerase-related; protein disulfide isomerase-associated 5 product : protein disulfide isomerase associated 5 protein_id : NP_082571.1

name	EG546663 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400159 GeneID:546663 MGI:3648418
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001002128.1

name	Sema5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305473 CCDS:CCDS28140.1 GeneID:20357 MGI:107555
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 exception : mismatches in translation product : semaphorin 5B protein_id : NP_038689.1

name	Dirc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956322 CCDS:CCDS28141.1 GeneID:224132 MGI:2387188
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : disrupted in renal carcinoma 2 protein_id : NP_705778.1

name	Hspbap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587017 CCDS:CCDS28142.1 GeneID:66667 MGI:1913917
definition	codon_start : 1 product : Hspb associated protein 1 protein_id : NP_780320.2

name	Parp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299607 CCDS:CCDS28143.1 GeneID:547253 MGI:1919489
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : collaborator of STAT6 product : poly (ADP-ribose) polymerase family, member 14 protein_id : NP_001034619.1

name	LOC100043217 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267376 GeneID:100043217
definition	codon_start : 1 product : similar to ribosomal protein L35a protein_id : XP_001479811.1

name	Dtx3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133930784 GeneID:209200 MGI:2656973
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : deltex 3-like protein_id : NP_001013389.2

name	Parp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384918 GeneID:80285 MGI:1933117
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 product : B aggressive lymphoma protein_id : NP_084529.1

name	Kpna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543047 CCDS:CCDS28144.1 GeneID:16646 MGI:103560
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006606 - protein import into nucleus [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : m-importin-alpha-S1 product : karyopherin (importin) alpha 1 protein_id : NP_032491.2

name	Wdr5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312318 CCDS:CCDS28145.1 GeneID:69544 MGI:1916794
definition	GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : WD repeat domain 5B protein_id : NP_081389.1

name	2310056P07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312546 CCDS:CCDS28146.1 GeneID:70186 MGI:1917436
definition	codon_start : 1 product : growth and transformation-dependent protein protein_id : NP_081618.1

name	Ccdc58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348528 CCDS:CCDS28147.1 GeneID:381045 MGI:2146423
definition	codon_start : 1 product : coiled-coil domain containing 58 protein_id : NP_941047.1

name	Csta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370296 GeneID:209294 MGI:3524930
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : cystatin A protein_id : NP_001028411.1

name	Stfa2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27805391 CCDS:CCDS28149.1 GeneID:268885 MGI:3524944
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 note : stefin 2-like product : stefin A2 like 1 protein_id : NP_776294.1

name	EG433016 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127140962 GeneID:433016 MGI:3645124
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 product : EG433016 protein protein_id : NP_001076016.1

name	EG408196 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139206 GeneID:408196 MGI:3644688
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 note : stefin-A1-like 1 product : stefin A1 like 1 protein_id : NP_001076011.1

name	2010005H15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386438 GeneID:76770 MGI:1924020
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 product : similar to cystatin A protein_id : NP_084009.1

name	Stfa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139202 GeneID:20861 MGI:106198
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : stefin A1 protein_id : NP_001076012.1

name	EG209324 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20892419 GeneID:209324 MGI:3648404
definition	codon_start : 1 product : similar to stefin A2 protein_id : XP_156070.1

name	LOC100038854 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267263 GeneID:100038854
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471512.1

name	BC100530 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139277 GeneID:100034684 MGI:3696883
definition	codon_start : 1 product : stefin A-like protein protein_id : NP_001076015.1

name	Stfa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:127139252 GeneID:20862 MGI:106197
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : stefin A2 protein_id : NP_001076014.1

name	Stfa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384636 CCDS:CCDS28153.1 GeneID:20863 MGI:106196
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : stefin A3 protein_id : NP_079564.1

name	Casr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305101 CCDS:CCDS28154.1 GeneID:12374 MGI:1351351
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation function : mediates changes in the extracellular concentration of calcium ions note : G protein coupled receptor, family C, group 2, member A; cation sensing receptor; extracellular calcium-sensing receptor product : G protein-coupled receptor, family C, group 2, member A protein_id : NP_038831.1

name	EG667232 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400184 GeneID:667232 MGI:3645223
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994280.1

name	Cd86 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542364 CCDS:CCDS28155.1 GeneID:12524 MGI:101773
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CD86 antigen protein_id : NP_062261.2

name	Ildr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527338 GeneID:106347 MGI:2146574
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : immunoglobulin-like domain containing receptor 1 protein_id : NP_598870.1

name	Slc15a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946598 CCDS:CCDS28156.1 GeneID:57738 MGI:1890457
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0015334 - high affinity oligopeptide transporter activity [Evidence IDA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006857 - oligopeptide transport [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : proton-dependent high affinity oligopeptide transporter PepT2 product : solute carrier family 15 (H+/peptide transporter), member 2 protein_id : NP_067276.1

name	Eaf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527340 GeneID:106389 MGI:2146616
definition	GO_component : GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0008629 - induction of apoptosis by intracellular signals [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : testosterone regulated apoptosis inducer and tumor suppressor protein_id : NP_598872.1

name	Iqcb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893085 CCDS:CCDS28157.1 GeneID:320299 MGI:2443764
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : IQ calmodulin-binding motif containing 1 protein_id : NP_796102.1

name	Golgb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267531 GeneID:224139 MGI:1099447
definition	codon_start : 1 product : golgi autoantigen, golgin subfamily b, macrogolgin 1 protein_id : XP_001481110.1

name	Hcls1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680187 GeneID:15163 MGI:104568
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0042531 - positive regulation of tyrosine phosphorylation of STAT protein [Evidence IMP]; GO:0009725 - response to hormone stimulus [Evidence IDA] codon_start : 1 exception : mismatches in translation product : hematopoietic cell specific Lyn substrate 1 protein_id : NP_032251.1

name	Fbxo40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82617544 GeneID:207215 MGI:2443753
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box protein 40 protein_id : NP_001032398.1

name	Polq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30387615 CCDS:CCDS28158.1 GeneID:77782 MGI:2155399
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP] [Evidence IGI]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : DNA polymerase theta protein_id : NP_084253.1

name	Stxbp5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369591 CCDS:CCDS28159.1 GeneID:207227 MGI:2443815
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : xb-tomosyn-2; s-tomosyn-2; b-tomosyn-2; m-tomosyn-2 product : syntaxin binding protein 5-like protein_id : NP_766028.1

name	LOC667133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667133
definition	number : 1 pseudo : _no_value

name	LOC667133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667133
definition	number : 2 pseudo : _no_value

name	LOC667133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667133
definition	number : 3 pseudo : _no_value

name	LOC639105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639105
definition	number : 3 pseudo : _no_value

name	LOC639105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639105
definition	number : 2 pseudo : _no_value

name	LOC639105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:639105
definition	number : 1 pseudo : _no_value

name	LOC667246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667246
definition	number : 1 pseudo : _no_value

name	LOC100043252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043252
definition	number : 1 pseudo : _no_value

name	LOC100043252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043252
definition	number : 2 pseudo : _no_value

name	LOC100043252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043252
definition	number : 3 pseudo : _no_value

name	EG627962 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149267382 GeneID:627962 MGI:3648348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 3 Proteins product : predicted gene, EG627962 pseudo : _no_value transcript_id : XR_034384.1

name	LOC667023 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267529 GeneID:667023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 10 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_034965.1

name	LOC628101 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267394 GeneID:628101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 20 ESTs product : hypothetical LOC628101 transcript_id : XR_035428.1

clone name	MSMg01-069A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-115D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-107O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-128E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-394F08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490I18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-506A19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217E11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-052J17.b	B6Ng01-052J17.g
ACC	DH875911	DH875912
length	1,233	1,137
definition	DH875911\|Mus musculus domesticus DNA, BAC clone: B6Ng01-052J17, 5' end.	DH875912\|Mus musculus domesticus DNA, BAC clone: B6Ng01-052J17, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctttgggtgagagcaaggatttaaggtaaacttcctttgagaagc attagttagtaaaaaacactttccacttaggaaacaatatacactgaaag attaaaactcttggcttcttgtatagaagcagaaacaataaaaatttctt acataatgtaaagttacattagccatacctagaggcaaaattttctagta attaccagttcactagaagcaaaactctttgaatttaagcattattctaa acatctgaatagatctgcaacactgttaaaaagaaattttcttgaacaca gggaaaaactttctcaggcactgtttgcaaaacaaaagaaaggccacaag ctgctctggggctgcccagagccctgcattgactcaaacgtaaaatacct tttaatctgagcatcttggccctcctgtaataaggaccgattctagagga acaatataattgtctacgcctctaactttgatactctttcttaagatgac ttacagttaaaacgttcttcacaactttagtgttgtgaaaaaattgccaa tattgcagtttcctgccaggcagcaactatagccaaactgattgtttgag ggtctaatctattcacaaagacaaacataactagataactttgtcacagt tttgtatgaagtgagctgtattagtgctttcaaaagataattactcttat aattatcttaattaacaatatatggtgagtagaaaatcttaaatttgcaa tcaaactgcaagctgcagtcaatggaacaatggcagttttaaccataatt tttaagttttcgttgcaatattagaatatatctataacttttggaaagca aaacccaagtctaaaacaatttatcatctttaaaataatattagaagcat tactatcatattacaagtttggctgccaattaatacctatgatacctatt aaagcaagctttaatgctttataaagagcactgctttaaatctatcttaa atttactattagatagaaccacatttattattatctaactagaaatatct ttaaagacccagcttcttgcctgccttatgccacgtttcagagacctcta acttgattatcaatttaacctaacatcgtgcatgtacaattattatttac aaacttttaccgaagtgaaacacgtgcagcattccataaaggacaatgag cgttcttgaccatcagagttaattttgtggcta	gaattctaatccagcctggtttacatgagagcctttctaaaaaaggaaaa tcacaaggctttgtggggcacatcttttatcccagcacttggaggcaagg acagggacttctctgtgagtttgaggctagcctaatcacagtgtgaggct gaagacatccagggctatccagagaaaccttgtctcaaaaaacaaaacca aacaacaacaaagcaaaaagataaaacaagagaatcaaaagcagcagaag aaatgagagtgtttgccatcttattcttcatgtttgtggaaaaacatatt aaaaactgcaagtaaaaatcaccatagacagttttattatccctataaag ttgggaagatcctgtgcaaccagccttgatattattaggtattttcttta aagatctctttaagcgttaacttatttagaaacacaggttattcgtgccc ttcctcatatgacacaatatgatggcattattggcacagagactgcaggg aggagccatgcttaccacacctgagtcctgggcacacatgcttgctcacg tcccccaccacatttacccccaactccactcagcatttcctgtaagggat gcagtaagacttgcctaaggccacactcatttccccattccctcagatat ttcggagataagacactagaggaggagtttacagatacctttaaaacccc gagtctcagtgctttgcaggatcatttcttctcagtgtccaagccagcaa agaagcaactcatcaagatgagtctcggaggtgtttcagaggcaagccgt gccacaccagaaatccagaagattgctgacaaggtgagtcgatgtacttc aggaaaagatgtgatcccaaccaaacttccaacatttgattttatagttg gccctgcgttaagactgtggaaatgacagaatcagaaatacatgattctg ttcagacatttatacagataatgaccattgcacttcagagaatttttaaa acccaaaataatcaactatcacactttttactggagctcagttcccagta gctgaagtgaatcatactggatcacccctataccttccacgtctgatcca ggagctctaggactggagtgatttcagtcactctagt
quality values	Open. Hide. 61 43 30 33 61 61 61 61 61 61 61 47 35 61 61 61 61 61 55 61 61 61 61 38 36 55 61 20 23 23 30 22 23 26 26 26 28 36 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 39 61 61 52 61 53 61 61 61 61 47 43 61 61 47 61 53 61 61 61 61 57 57 57 53 57 57 57 57 57 57 57 57 53 47 38 57 57 53 57 53 57 57 57 57 57 53 57 57 53 57 53 50 57 53 53 57 57 53 47 57 57 50 57 57 57 53 45 57 47 43 53 50 53 57 52 57 53 53 53 57 57 50 57 53 53 53 47 53 45 27 57 57 53 42 53 53 53 57 53 57 57 38 47 53 57 53 53 57 57 57 53 53 45 53 45 53 57 57 57 53 52 42 40 53 53 53 57 50 41 57 53 47 37 53 53 42 40 48 42 47 38 52 52 30 53 57 50 47 27 57 57 46 50 40 24 53 40 29 53 50 53 53 53 40 38 32 28 28 52 38 50 50 38 53 53 50 52 43 47 40 44 53 42 38 53 50 52 44 52 37 57 57 36 52 57 43 33 40 40 52 57 57 44 33 43 35 40 52 57 28 29 57 53 34 35 24 37 40 40 14 57 31 37 37 53 29 31 40 40 48 41 48 37 40 34 34 47 28 40 29 57 37 31 33 37 22 33 37 34 34 29 35 53 51 51 51 46 30 30 32 30 20 45 30 29 28 51 51 51 46 39 51 25 31 51 51 36 33 31 38 51 32 44 25 30 29 29 30 36 41 28 36 37 28 28 28 21 34 35 33 34 37 26 34 29 35 51 51 28 43 34 29 51 33 30 29 26 51 51 36 29 51 39 20 26 27 38 34 35 34 51 43 36 36 28 30 36 51 29 28 28 29 27 28 35 34 51 29 28 51 46 33 23 46 20 27 27 29 39 43 24 39 31 25 38 20 29 26 28 30 22 29 29 31 23 29 29 23 38 28 29 34 46 9 7 44 33 28 31 31 34 30 19 31 16 21 23 22 31 9 23 23 25 33 23 11 14 26 51 10 27 29 27 34 34 20 22 28 51 20 20 28 27 27 26 33 31 51 32 20 26 17 24 11 28 51 15 38 28 22 51 27 17 14 10 10 19 34 29 34 23 23 44 24 21 44 21 22 10 10 4 12 30 19 28 12 44 14 35 44 27 19 30 11 18 32 29 8 4 6 9 4 4 4 18 23 22 6 8 5 15 42 7 27 19 28 14 20 8 5 7 12 22 30 20 14 18 13 7 6 29 18 10 7 10 22 16 23 10 6 8 10 8 29 13 42 12 8 8 23 8 6 7 3 5 10 3 10 17 25 13 18 15 11 5 5 15 19 5 6 7 20 19 26 22 5 4 4 13 4 2 3 4 4 10 5 13 11 13 13 15 9 23 7 11 5 3 8 18 13 7 36 11 18 5 6 7 13 20 8 18 5 9 13 20 5 6 10 7 3 4 3 9 6 4 12 11 20 4 16 12 15 11 24 13 10 15 3 1 4 18 11 19 7 4 3 3 3 4 4 5 4 3 2 4 8 14 4 4 6 6 5 7 3 3 2 4 1 4 5 3 6 13 8 5 1 13 13 9 4 19 6 17 13 19 6 12 19 5 13 6 7 9 13 3 7 15 6 7 5 4 3 3 10 7 5 8 5 7 14 24 18 7 9 6 6 7 5 5 3	Open. Hide. 61 47 43 37 61 61 36 25 26 25 25 24 9 10 14 21 21 55 50 52 61 61 55 55 61 61 61 61 55 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 59 61 61 61 61 61 61 59 45 59 45 28 28 44 37 59 59 61 59 55 59 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 59 59 61 61 59 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 52 52 52 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 43 43 61 61 61 61 61 50 61 61 61 61 61 61 61 61 53 61 53 61 61 61 61 43 43 61 61 61 53 61 61 61 61 53 61 43 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 47 42 61 61 53 61 57 53 52 53 53 53 57 53 57 53 57 47 33 30 47 57 57 47 31 43 57 53 53 45 34 42 47 47 40 42 53 47 53 57 45 53 47 27 47 39 53 32 53 47 43 36 50 53 53 45 53 42 53 53 57 53 53 40 50 47 47 57 20 39 45 53 45 52 53 53 40 53 53 53 53 53 47 47 45 53 53 53 47 45 50 53 50 28 57 42 45 50 57 41 37 52 37 53 15 41 28 50 57 38 50 38 39 40 42 42 45 50 37 46 43 15 43 53 34 53 52 53 37 38 50 34 40 33 21 45 45 40 57 41 32 57 57 36 53 57 53 52 32 52 33 34 31 52 33 33 27 25 41 36 42 32 34 53 38 32 7 11 34 14 39 28 28 52 9 13 25 38 37 35 41 32 36 21 53 27 48 53 21 57 31 40 52 34 36 40 33 47 52 27 43 40 24 38 30 33 33 33 37 31 40 35 36 40 28 25 20 40 53 21 40 25 41 37 35 13 45 12 53 21 25 11 57 33 34 37 10 53 8 14 10 26 25 24 38 41 31 32 32 31 39 24 30 23 29 47 30 20 48 51 34 32 38 29 18 10 46 29 15 31 13 31 30 21 30 25 31 14 30 25 15 30 18 32 31 28 31 33 21 28 30 35 25 18 23 12 30 21 12 7 14 12 51 38 30 17 29 19 31 19 29 20 25 29 36 23 29 32 20 7 8 36 19 17 24 29 33 23 26 23 28 11 11 19 29 29 28 8 41 29 20 10 8 30 8 29 22 28 24 13 24 24 23 20 13 17 29 19 32 18 12 29 16 22 29 13 46 41 17 46 28 25 29 20 23 18 13 27 22 29 17 17 15 25 36 6 11 15 25 14 27 29 29 22 12 9 17 18 23 30 25 9 7 17 12 7 20 51 28 14 14 8 31 22 21 41 20 33 28 20 28 46 11 16 38 8 10 29 15 19 23 21 22 27 25 10 18 9 28 23 28 51 51 51 19 29 38 42 21 19 38 23 11 30 38 39 18 13 9 7 12 14 6 10 10 13 4 10 7 9 3 4 8 38 37 42 31 23 14 9 33 23 30 13 34 13 22 8 5 25 7 7 44 25 8 19 16 21 21 23 8 15 18 6 12 6 21 10 22 29 15 4 3 12 14 8 13 11 31 11 3 4 5 4 5 7 6 5 9 4 22 12 9 7 10 9 16 25 16 5 16 10 25 20 12 7 19 4 7 7 16 10 22 5 3 7 16 4 16 14 4 4 9 14 11 4 4 19 22 18 31 10 4 3 5 13 7 5 8 7 9 9 13 15 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_36367199_36368354
seq2: B6Ng01-052J17.g_66_1202 (reverse)

seq1  ACTAGAGTGACTGGAAAATTCCATCAGTCCTTAGAGCTCCTGGGATCAGA  50
      |||||||||||||  ||||  |  |||||| |||||||||| ||||||||
seq2  ACTAGAGTGACTG--AAATCACTCCAGTCC-TAGAGCTCCT-GGATCAGA  46

seq1  CGTGTGAGGTATAGAGATGATCCAGTATGAATTCACCTTCAGCTACTGGG  100
      ||||  |||||||| | |||||||||||| ||||| ||||||||||||||
seq2  CGTGGAAGGTATAGGGGTGATCCAGTATG-ATTCA-CTTCAGCTACTGGG  94

seq1  GAAACTGAGGCTCCAGTAAAAAGTGTGATTAGGTTGATTTTATTTTTGGG  150
        |||||| ||||||||||||||||||||   |||||||    |||||||
seq2  --AACTGA-GCTCCAGTAAAAAGTGTGAT--AGTTGATT---ATTTTGGG  136

seq1  TTTTTAAAAATTTCTCTGAAGTGCATTGTTCATTATCTGTATAAATGTCT  200
      ||||  |||| |||||||||||||| || |||||||||||||||||||||
seq2  TTTT--AAAAATTCTCTGAAGTGCAATGGTCATTATCTGTATAAATGTCT  184

seq1  GAACAGAATCATGTATTTCTGATTTCTGTCATTTCCCACAGTCTTAACGC  250
      |||||||||||||||||||||| ||||||||||| |||||||||||||||
seq2  GAACAGAATCATGTATTTCTGA-TTCTGTCATTT-CCACAGTCTTAACGC  232

seq1  AGGGCCAACTTATAAATCAAATGTTGGAAGTTTGGTTTGGGATCACATCT  300
      ||||||||||   |||||||||||||||||||||| ||||||||||||||
seq2  AGGGCCAACTATAAAATCAAATGTTGGAAGTTTGG-TTGGGATCACATCT  281

seq1  TTTCCTGAAGTACATCGACTCACCTTGTCAGCAATCTTCTGGATTTCTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCTGAAGTACATCGACTCACCTTGTCAGCAATCTTCTGGATTTCTGG  331

seq1  TGTGGCACGGCTTGCCTCTGAAACACCTCCGAGACTCATCTTGATGAGTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGCACGGCTTGCCTCTGAAACACCTCCGAGACTCATCTTGATGAGTT  381

seq1  GCTTCTTTGCTGGCTTGGACACTGAGAAGAAATGATCCTGCAAAGCACTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCTTTGCTGGCTTGGACACTGAGAAGAAATGATCCTGCAAAGCACTG  431

seq1  AGACTCGGGGTTTTAAAGGTATCTGTAAACTCCTCCTCTAGTGTCTTATC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTCGGGGTTTTAAAGGTATCTGTAAACTCCTCCTCTAGTGTCTTATC  481

seq1  TCCGAAATATCTGAGGGAATGGGGAAATGAGTGTGGCCTTAGGCAAGTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGAAATATCTGAGGGAATGGGGAAATGAGTGTGGCCTTAGGCAAGTCT  531

seq1  TACTGCATCCCTTACAGGAAATGCTGAGTGGAGTTGGGGGTAAATGTGGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGCATCCCTTACAGGAAATGCTGAGTGGAGTTGGGGGTAAATGTGGT  581

seq1  GGGGGACGTGAGCAAGCATGTGTGCCCAGGACTCAGGTGTGGTAAGCATG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGACGTGAGCAAGCATGTGTGCCCAGGACTCAGGTGTGGTAAGCATG  631

seq1  GCTCCTCCCTGCAGTCTCTGTGCCAATAATGCCATCATATTGTGTCATAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCCTCCCTGCAGTCTCTGTGCCAATAATGCCATCATATTGTGTCATAT  681

seq1  GAGGAAGGGCACGAATAACCTGTGTTTCTAAATAAGTTAACGCTTAAAGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAAGGGCACGAATAACCTGTGTTTCTAAATAAGTTAACGCTTAAAGA  731

seq1  GATCTTTAAAGAAAATACCTAATAATATCAAGGCTGGTTGCACAGGATCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTTTAAAGAAAATACCTAATAATATCAAGGCTGGTTGCACAGGATCT  781

seq1  TCCCAACTTTATAGGGATAATAAAACTGTCTATGGTGATTTTTACTTGCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAACTTTATAGGGATAATAAAACTGTCTATGGTGATTTTTACTTGCA  831

seq1  GTTTTTAATATGTTTTTCCACAAACATGAAGAATAAGATGGCAAACACTC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTTAATATGTTTTTCCACAAACATGAAGAATAAGATGGCAAACACTC  881

seq1  TCATTTCTTCTGCTGCTTTTGATTCTCTTGTTTTATCTTTTTGCTTTGTT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTCTTCTGCTGCTTTTGATTCTCTTGTTTTATCTTTTTGCTTTGTT  931

seq1  GTTGTTTGGTTTTGTTTTTTGAGACAAGGTTTCTCTGGATAGCCCTGGAT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTTTGGTTTTGTTTTTTGAGACAAGGTTTCTCTGGATAGCCCTGGAT  981

seq1  GTCTTCAGCCTCACACTGTGATTAGGCTAGCCTCAAACTCACAGAGAAGT  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTCAGCCTCACACTGTGATTAGGCTAGCCTCAAACTCACAGAGAAGT  1031

seq1  CCCTGTCCTTGCCTCCAAGTGCTGGGATAAAAGATGTGCCCCACAAAGCC  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGTCCTTGCCTCCAAGTGCTGGGATAAAAGATGTGCCCCACAAAGCC  1081

seq1  TTGTGATTTTCCTTTTTTAGAAAGGCTCTCATGTAAACCAGGCTGGATTA  1150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGATTTTCCTTTTTTAGAAAGGCTCTCATGTAAACCAGGCTGGATTA  1131

seq1  GAATTC  1156
      ||||||
seq2  GAATTC  1137

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information