MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-093J07
Chromosome	16 (Build37)
Map Location	4,502,883 - 4,724,026
singlet/doublet	doublet
Overlap gene	Srl, Tcfap4, Glis2, Magmas, Coro7, Vasn, Dnaja3, Nmral1
Upstream gene	LOC100042270, LOC100042937, LOC100042283, Olfr161, Olfr162-ps1, Olfr163-ps1, LOC100042949, Mefv, EG620395, Zfp263, Olfr15, Zfp174, Zfp597, 1200013P24Rik, 1700037C18Rik, Cluap1, LOC664851, Nlrc3, Btbd12, Dnase1, Trap1, Crebbp, EG436332, Adcy9, EG620313
Downstream gene	Hmox2, 5730403B10Rik, 4930562C15Rik, 1500031H01Rik, Mgrn1, Nudt16l1, Anks3, 4930451G09Rik, Sept12, EG432995, Rogdi, 3930401K13Rik, Ubn1, Ppl, Sec14l5, Nagpa, AU021092, Alg1, 5730409G15Rik, LOC100042436
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	LOC100042937 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	LOC100042283 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Olfr161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258859 MGI:3032605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr162-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258057 MGI:3029996
definition	gene_synonym : MOR131-2P note : olfactory receptor 162, pseudogene 1 pseudo : _no_value

name	Olfr163-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258018 MGI:3029997
definition	gene_synonym : MOR131-3_p; MOR263-8P note : olfactory receptor 163, pseudogene 1 pseudo : _no_value

name	LOC100042949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Mefv (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54483 MGI:1859396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620395 MGI:3645496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 3 Proteins

name	Zfp263 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74120 MGI:1921370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18312 MGI:106182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385674 MGI:2686600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71063 MGI:1918313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200013P24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74763 MGI:1922013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700037C18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73261 MGI:1920511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cluap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76779 MGI:1924029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664851 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664851
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Nlrc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268857 MGI:2444070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52864 MGI:106299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnase1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13419 MGI:103157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68015 MGI:1915265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crebbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12914 MGI:1098280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436332 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436332 MGI:3643508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Adcy9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11515 MGI:108450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620313 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620313 MGI:3644670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 152 ESTs, 6 Proteins

name	Srl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106393 MGI:2146620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcfap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83383 MGI:103239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glis2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83396 MGI:1932535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magmas (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66449 MGI:1913699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78885 MGI:1926135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vasn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246154 MGI:2177651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnaja3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83945 MGI:1933786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nmral1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67824 MGI:1915074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15369 MGI:109373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730403B10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66626 MGI:1913876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930562C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78809 MGI:1926059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	1500031H01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207740 MGI:1916255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 83 ESTs, 6 Proteins

name	Mgrn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17237 MGI:2447670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt16l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66911 MGI:1914161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anks3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72615 MGI:1919865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930451G09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74684 MGI:1921934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 2 Proteins

name	Sept12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71089 MGI:1918339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG432995 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432995 MGI:3643379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Rogdi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66049 MGI:1913299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3930401K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74022 MGI:1921272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ubn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170644 MGI:1891307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19041 MGI:1194898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec14l5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665119 MGI:3616084
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 6 Proteins

name	Nagpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27426 MGI:1351598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU021092 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239691 MGI:2146559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208211 MGI:2384774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730409G15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70511 MGI:1917761
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100042270 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267268 GeneID:100042270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins product : similar to Unknown (protein for MGC:41421) transcript_id : XM_001477847.1

name	Olfr161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239305 GeneID:258859 MGI:3032605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 161 transcript_id : NM_146860.1

name	LOC100042949 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267295 GeneID:100042949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100042949 transcript_id : XM_001479839.1

name	Mefv (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506892 GeneID:54483 MGI:1859396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mediterranean fever transcript_id : NM_019453.1

name	EG620395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267297 GeneID:620395 MGI:3645496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 3 Proteins product : predicted gene, EG620395 transcript_id : XM_884793.3

name	Zfp263 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343562 GeneID:74120 MGI:1921370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 263 transcript_id : NM_148924.2

name	Olfr15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174769 GeneID:18312 MGI:106182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 15 transcript_id : NM_008762.2

name	Zfp174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487046 GeneID:385674 MGI:2686600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 174 transcript_id : NM_001081217.1

name	Zfp597 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370271 GeneID:71063 MGI:1918313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 597 transcript_id : NM_001033159.2

name	1200013P24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134254441 GeneID:74763 MGI:1922013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200013P24 gene transcript_id : NM_029090.3

name	1700037C18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037322 GeneID:73261 MGI:1920511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700037C18 gene transcript_id : NM_028484.1

name	Cluap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130654 GeneID:76779 MGI:1924029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : clusterin associated protein 1 transcript_id : NM_029738.2

name	Nlrc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486872 GeneID:268857 MGI:2444070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, CARD domain containing 3 transcript_id : NM_001081280.1

name	Btbd12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130426 GeneID:52864 MGI:106299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 12 transcript_id : NM_177472.4

name	Dnase1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47087133 GeneID:13419 MGI:103157
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyribonuclease I transcript_id : NM_010061.4

name	Trap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129831 GeneID:68015 MGI:1915265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TNF receptor-associated protein 1 transcript_id : NM_026508.2

name	Crebbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70995310 GeneID:12914 MGI:1098280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CREB binding protein transcript_id : NM_001025432.1

name	Adcy9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752979 GeneID:11515 MGI:108450
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate cyclase 9 transcript_id : NM_009624.1

name	EG620313 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267299 GeneID:620313 MGI:3644670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 152 ESTs, 6 Proteins product : predicted gene, EG620313 transcript_id : XM_885040.3

name	Srl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129867 GeneID:106393 MGI:2146620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sarcalumenin transcript_id : NM_175347.4

name	Tcfap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130735 GeneID:83383 MGI:103239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor AP4 transcript_id : NM_031182.2

name	Glis2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:95006994 GeneID:83396 MGI:1932535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GLIS family zinc finger 2 transcript_id : NM_031184.3

name	Magmas (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385011 GeneID:66449 MGI:1913699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction transcript_id : NM_025571.1

name	Coro7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802552 GeneID:78885 MGI:1926135
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin 7 transcript_id : NM_030205.3

name	Vasn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981692 GeneID:246154 MGI:2177651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vasorin transcript_id : NM_139307.2

name	Dnaja3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350102 GeneID:83945 MGI:1933786
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily A, member 3 transcript_id : NM_023646.3

name	Nmral1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24431936 GeneID:67824 MGI:1915074
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NmrA-like family domain containing 1 transcript_id : NM_026393.1

name	Hmox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754213 GeneID:15369 MGI:109373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heme oxygenase (decycling) 2 transcript_id : NM_010443.1

name	5730403B10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803220 GeneID:66626 MGI:1913876
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730403B10 gene transcript_id : NM_025670.3

name	4930562C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267270 GeneID:78809 MGI:1926059
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : RIKEN cDNA 4930562C15 gene transcript_id : XM_974329.2

name	1500031H01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400030 GeneID:207740 MGI:1916255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 83 ESTs, 6 Proteins product : RIKEN cDNA 1500031H01 gene transcript_id : XM_974374.1

name	Mgrn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130643 GeneID:17237 MGI:2447670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mahogunin, ring finger 1 transcript_id : NM_029657.3

name	Nudt16l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803368 GeneID:66911 MGI:1914161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1 transcript_id : NM_025839.2

name	Anks3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361387 GeneID:72615 MGI:1919865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and sterile alpha motif domain containing 3 transcript_id : NM_028301.2

name	Sept12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388519 GeneID:71089 MGI:1918339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 12 transcript_id : NM_027669.2

name	EG432995 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400033 GeneID:432995 MGI:3643379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : predicted gene, EG432995 transcript_id : XM_488763.3

name	Rogdi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508430 GeneID:66049 MGI:1913299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rogdi homolog (Drosophila) transcript_id : NM_133185.2

name	3930401K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392065 GeneID:74022 MGI:1921272
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3930401K13 gene transcript_id : NM_028720.2

name	3930401K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392073 GeneID:74022 MGI:1921272
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3930401K13 gene transcript_id : NM_001079814.1

name	Ubn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368745 GeneID:170644 MGI:1891307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubinuclein 1 transcript_id : NM_026666.3

name	Ppl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421038 GeneID:19041 MGI:1194898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : periplakin transcript_id : NM_008909.2

name	Sec14l5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267310 GeneID:665119 MGI:3616084
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 6 Proteins product : SEC14-like 5 (S. cerevisiae) transcript_id : XM_974707.2

name	Nagpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371629 GeneID:27426 MGI:1351598
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase transcript_id : NM_013796.2

name	AU021092 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701617 GeneID:239691 MGI:2146559
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU021092 transcript_id : NM_001033220.1

name	Alg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703729 GeneID:208211 MGI:2384774
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) transcript_id : NM_145362.1

name	5730409G15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803575 GeneID:70511 MGI:1917761
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730409G15 gene transcript_id : NM_027446.2

name	LOC100042436 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267272 GeneID:100042436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001478201.1

name	LOC100042270 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267269 GeneID:100042270
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477897.1

name	Olfr161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239306 CCDS:CCDS27906.1 GeneID:258859 MGI:3032605
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-112942-113883; olfactory receptor MOR131-1 product : olfactory receptor 161 protein_id : NP_667071.1

name	LOC100042949 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267296 GeneID:100042949
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479889.1

name	Mefv (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506893 CCDS:CCDS27907.1 GeneID:54483 MGI:1859396
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence ISS] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence NAS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006954 - inflammatory response [Evidence ISS] [Evidence IEA] codon_start : 1 exception : mismatches in translation note : marenostrin product : Mediterranean fever protein_id : NP_062326.1

name	EG620395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82958893 GeneID:620395 MGI:3645496
definition	codon_start : 1 product : similar to cripto protein_id : XP_889886.1

name	Zfp263 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956276 CCDS:CCDS27909.1 GeneID:74120 MGI:1921370
definition	GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : kruppel-associated box-zinc finger protein NT2 product : zinc finger protein 263 protein_id : NP_683726.1

name	Olfr15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174770 CCDS:CCDS27910.1 GeneID:18312 MGI:106182
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR256-17; GA_x54KRFPKG5P-348087-349025 product : olfactory receptor 15 protein_id : NP_032788.2

name	Zfp174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487047 GeneID:385674 MGI:2686600
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 174 protein_id : NP_001074686.1

name	Zfp597 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370272 CCDS:CCDS27911.1 GeneID:71063 MGI:1918313
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger protein 597 protein_id : NP_001028331.2

name	1200013P24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312874 GeneID:74763 MGI:1922013
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74763 protein_id : NP_083366.1

name	1700037C18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037323 GeneID:73261 MGI:1920511
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC73261 protein_id : NP_082760.1

name	Cluap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930457 CCDS:CCDS27912.1 GeneID:76779 MGI:1924029
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : clusterin associated protein 1 protein_id : NP_084014.1

name	Nlrc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486873 GeneID:268857 MGI:2444070
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051092 - activation of NF-kappaB transcription factor [Evidence ISS]; GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence ISS]; GO:0042110 - T cell activation [Evidence ISS] codon_start : 1 note : Caterpiller 16.2 product : caterpillar 16.2 protein_id : NP_001074749.1

name	Btbd12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734487 GeneID:52864 MGI:106299
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : BTB (POZ) domain containing 12 protein_id : NP_803423.2

name	Dnase1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059022 CCDS:CCDS27913.1 GeneID:13419 MGI:103157
definition	EC_number : 3.1.21.1 GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004536 - deoxyribonuclease activity [Evidence IEA]; GO:0004530 - deoxyribonuclease I activity [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006308 - DNA catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : deoxyribonuclease I protein_id : NP_034191.2

name	Trap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385998 CCDS:CCDS27914.1 GeneID:68015 MGI:1915265
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 product : TNF receptor-associated protein 1 protein_id : NP_080784.1

name	Crebbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70995311 CCDS:CCDS27915.1 GeneID:12914 MGI:1098280
definition	EC_number : 2.3.1.48 GO_component : GO:0000123 - histone acetyltransferase complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0000940 - outer kinetochore of condensed chromosome [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0016407 - acetyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0003677 - DNA binding [Evidence IDA]; GO:0004402 - histone acetyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051577 - MyoD binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence IDA] [Evidence TAS]; GO:0003712 - transcription cofactor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016573 - histone acetylation [Evidence ISS]; GO:0042592 - homeostasis [Evidence ISS]; GO:0051091 - positive regulation of transcription factor activity [Evidence TAS]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001666 - response to hypoxia [Evidence ISS]; GO:0007165 - signal transduction [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : CREB binding protein protein_id : NP_001020603.1

name	Adcy9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752980 CCDS:CCDS27917.1 GeneID:11515 MGI:108450
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004016 - adenylate cyclase activity [Evidence TAS]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA] GO_process : GO:0007190 - adenylate cyclase activation [Evidence TAS]; GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 exception : mismatches in translation product : adenylate cyclase 9 protein_id : NP_033754.1

name	EG620313 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82958891 GeneID:620313 MGI:3644670
definition	codon_start : 1 product : similar to cofactor A protein_id : XP_890133.1

name	Srl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328417 CCDS:CCDS27918.1 GeneID:106393 MGI:2146620
definition	GO_component : GO:0016529 - sarcoplasmic reticulum [Evidence IEA] codon_start : 1 product : sarcalumenin protein_id : NP_780556.2

name	Tcfap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13626034 CCDS:CCDS27919.1 GeneID:83383 MGI:103239
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : transcription factor AP-4 (activating enhancer-binding protein 4) protein_id : NP_112459.1

name	Glis2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909577 CCDS:CCDS27920.1 GeneID:83396 MGI:1932535
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : GLI-Kruppel family member GLI5; Kruppel-like factor 16 (neuronal) product : GLIS family zinc finger 2 protein_id : NP_112461.2

name	Magmas (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385012 GeneID:66449 MGI:1913699
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mitochondria associated granulocyte macrophage CSF signaling molecule; magmas processed gene 1 product : mitochondria-associated granulocyte macrophage CSF signaling molecule protein_id : NP_079847.1

name	Coro7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560028 GeneID:78885 MGI:1926135
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0000299 - integral to membrane of membrane fraction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005625 - soluble fraction [Evidence IDA] codon_start : 1 exception : mismatches in translation product : coronin 7 protein_id : NP_084481.2

name	Vasn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981693 CCDS:CCDS27921.1 GeneID:246154 MGI:2177651
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : Slit-like 2 protein_id : NP_647468.2

name	Dnaja3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560085 CCDS:CCDS27922.1 GeneID:83945 MGI:1933786
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IPI]; GO:0051082 - unfolded protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IPI] codon_start : 1 exception : mismatches in translation product : DnaJ (Hsp40) homolog, subfamily A, member 3 protein_id : NP_076135.2

name	Nmral1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24431937 CCDS:CCDS27923.1 GeneID:67824 MGI:1915074
definition	GO_function : GO:0016564 - transcriptional repressor activity [Evidence IEA] GO_process : GO:0006808 - regulation of nitrogen utilization [Evidence IEA] codon_start : 1 product : NmrA-like family domain containing 1 protein_id : NP_080669.1

name	Hmox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754214 CCDS:CCDS27924.1 GeneID:15369 MGI:109373
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0004392 - heme oxygenase (decyclizing) activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006788 - heme oxidation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : heme oxygenase (decycling) 2 protein_id : NP_034573.1

name	5730403B10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542001 CCDS:CCDS27925.1 GeneID:66626 MGI:1913876
definition	codon_start : 1 product : hypothetical protein LOC66626 protein_id : NP_079946.2

name	4930562C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267271 GeneID:78809 MGI:1926059
definition	codon_start : 1 product : hypothetical protein LOC78809 protein_id : XP_979423.2

name	1500031H01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400031 GeneID:207740 MGI:1916255
definition	codon_start : 1 product : hypothetical protein LOC207740 protein_id : XP_979468.1

name	Mgrn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229238 GeneID:17237 MGI:2447670
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000209 - protein polyubiquitination [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : mahoganoid product : mahogunin, ring finger 1 protein_id : NP_083933.1

name	Nudt16l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385314 CCDS:CCDS27927.1 GeneID:66911 MGI:1914161
definition	codon_start : 1 product : syndesmos protein_id : NP_080115.1

name	Anks3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19072790 CCDS:CCDS27928.1 GeneID:72615 MGI:1919865
definition	codon_start : 1 exception : mismatches in translation product : ankyrin repeat and sterile alpha motif domain containing 3 protein_id : NP_082577.1

name	Sept12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312734 CCDS:CCDS27929.1 GeneID:71089 MGI:1918339
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA] codon_start : 1 product : septin 12 protein_id : NP_081945.1

name	EG432995 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400034 GeneID:432995 MGI:3643379
definition	codon_start : 1 product : hypothetical protein protein_id : XP_488763.3

name	Rogdi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508431 GeneID:66049 MGI:1913299
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030097 - hemopoiesis [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA] codon_start : 1 product : leucine zipper domain protein protein_id : NP_573448.2

name	3930401K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392066 CCDS:CCDS27930.1 GeneID:74022 MGI:1921272
definition	GO_function : GO:0004616 - phosphogluconate dehydrogenase (decarboxylating) activity [Evidence IEA] GO_process : GO:0006098 - pentose-phosphate shunt [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; cytokine-like nuclear factor n-pac product : cytokine-like nuclear factor n-pac isoform 2 protein_id : NP_082996.2

name	3930401K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392074 GeneID:74022 MGI:1921272
definition	GO_function : GO:0004616 - phosphogluconate dehydrogenase (decarboxylating) activity [Evidence IEA] GO_process : GO:0006098 - pentose-phosphate shunt [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; cytokine-like nuclear factor n-pac product : cytokine-like nuclear factor n-pac isoform 1 protein_id : NP_001073282.1

name	Ubn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71534247 CCDS:CCDS27931.1 GeneID:170644 MGI:1891307
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0030216 - keratinocyte differentiation [Evidence TAS] codon_start : 1 product : ubinuclein 1 protein_id : NP_080942.1

name	Ppl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421039 CCDS:CCDS27932.1 GeneID:19041 MGI:1194898
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0019897 - extrinsic to plasma membrane [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0031424 - keratinization [Evidence IEA] codon_start : 1 note : 195kDa protein product : periplakin protein_id : NP_032935.2

name	Sec14l5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267311 GeneID:665119 MGI:3616084
definition	codon_start : 1 product : similar to hCG18754 protein_id : XP_979801.2

name	Nagpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794508 CCDS:CCDS27933.1 GeneID:27426 MGI:1351598
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003944 - N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alpha-GlcNAcase product : N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase protein_id : NP_038824.1

name	AU021092 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701618 CCDS:CCDS27934.1 GeneID:239691 MGI:2146559
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC239691 protein_id : NP_001028392.1

name	Alg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703730 GeneID:208211 MGI:2384774
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004578 - chitobiosyldiphosphodolichol beta-mannosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : beta-1,4 mannosyltransferase product : beta-1,4-mannosyltransferase protein_id : NP_663337.1

name	5730409G15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315977 CCDS:CCDS27935.1 GeneID:70511 MGI:1917761
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70511 protein_id : NP_081722.1

name	LOC100042436 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267273 GeneID:100042436
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478251.1

name	LOC100042283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042283
definition	number : 1 pseudo : _no_value

name	LOC100042283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042283
definition	number : 2 pseudo : _no_value

name	LOC664851 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664851
definition	number : 1 pseudo : _no_value

name	LOC100042937 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267292 GeneID:100042937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to synaptojanin 2 binding protein pseudo : _no_value transcript_id : XR_034413.1

name	EG436332 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149267261 GeneID:436332 MGI:3643508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG436332 pseudo : _no_value transcript_id : XR_035105.1

name	4930451G09Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149267305 GeneID:74684 MGI:1921934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 2 Proteins product : RIKEN cDNA 4930451G09 gene transcript_id : XR_034499.1

clone name	MSMg01-484B10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082E11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-354G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-305D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523D11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-377L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513I13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-541M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282P15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-093J07.b	B6Ng01-093J07.g
ACC	DH905030	DH905031
length	1,045	869
definition	DH905030\|Mus musculus domesticus DNA, BAC clone: B6Ng01-093J07, 5' end.	DH905031\|Mus musculus domesticus DNA, BAC clone: B6Ng01-093J07, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(4,722,971 - 4,724,026)	(4,502,883 - 4,503,747)
sequence	gaattcaagatgaccttacaaagatgtgcacctaggctaaaagagaagct cttttcctcgtggcctcgcagaaggatggagatcagtgctaagaggcaag gttgattatagtgttggttcagagtctcagaccctaagaccctgaagact tgacagttctgtgcccagggccttgcagtctttcctctctggttccctca gtctcagctctttgctctttcttgtctctctgcatccactgtccttccct tttttttttttaagatttatttattattatatataagtactgtagctgtt ttcagatgcaccagaacagggcgtcagatctcattacggatggttgttag ccaccatgtggttgctgggatttgaactcaggaccttcggaagagcagta ggtgctcttaaccactgagccatctctccagcccctccactgtccttcct atgctggtttttcttcatctgttcaacttccttttctgatgtcaaatagt tggctgccttgacttggtggttctacacaccacagagctgcctcttgagt cacccattgtaggtctctcttctcctcagaggtcgctggccactagttca tgaaggcagaggaagcaagagcagaaagcagggttcagagggctgtgagg atgacggacttgcagggacacggtcagtgagacagctctactttactctt ccaggggtagggtatataaggcttttagggtatgggtggacagggctgat tggtcctaaacacattacctacttaccatatgggcaggagtggtggattg gttataacacagcacccagttatcattcaggtgggaaactagagtggaac tcgtgtactgaggcatccagagttttgtagagagctctgctcaggtcaca acccagataagtcagcatctgtgctcagagacacttctctagtaaagtag tcacaaacagaagctcctcggaggaggaagtctccattttgcaggagctc aaaaagctatcagatatggcaactgtgaccttaagagcaggttct	gaattcttagcccacctacatcttctccctttgaaaaagatcaaagactt caacacacttgctttttacctataaagtacacagaactgacataataatt ttgttttccacctcatacctagttcctatgaatatctggtttgagagata tacagagaaattgctataaatcctctaaccattggcagatatgtagggct tgtggtagatgccagggggattcataatgtaaatgatgtttgtttatttt tcgtttgtgggtgattagttggctagttgggtttcttatttttgtttatt tgtctttgaaataagctctcagatagtgtggtgtggccttcaaactcatt atgtggccagggctggtcttaagctccgaatcctaagcctctatctccca agtgctaagatcacaggcatacatcaccaggcccagacaattggtttttg agtttttgtgaggttttttgtttgttgtcttttgtaacagggtttcttta tctatatcaccctggatgtcctggaactcacagagatcttcctgtacctc ccaggtactgggatcaaaggcattgtcagcactgcccagctaattgattt tttaagccaaggttgtgctatatagttctgggtggcttggtactatattt aactcagcctggcctcaaaccacagcagtctttgtgctttagcctaagtg atgggtattaagaggatgtgttaccacacctgacttgcgcactctttttg aaagatgagtatctctagggggaagacatcatcagtccttagctgggagt gtggctcagatgggtagagttctggcccagcacacacaaagccctaggtt taattccccaggactgcat
quality values	Open. Hide. 55 61 39 38 61 38 31 47 61 49 49 49 61 61 61 61 61 61 59 43 61 61 61 59 49 11 12 16 24 12 12 13 23 12 30 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 59 61 61 61 39 52 41 24 44 28 26 44 37 59 55 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 55 55 59 61 59 61 61 61 61 59 61 61 59 59 61 59 59 59 61 61 59 55 61 61 61 61 61 61 61 55 55 59 61 61 61 61 61 52 41 35 61 59 59 52 41 59 59 59 43 59 59 49 59 59 49 59 49 59 36 59 49 52 31 52 43 52 44 55 59 50 43 59 61 61 59 61 61 59 59 59 39 61 59 59 59 45 59 59 52 43 61 59 61 59 59 61 61 59 59 59 59 52 33 59 59 49 52 52 43 59 59 59 59 49 61 61 59 61 61 59 59 61 59 59 59 52 59 61 59 59 59 59 59 59 52 59 59 61 61 61 61 61 61 61 59 59 59 59 59 59 61 61 59 59 52 41 36 61 61 59 59 59 59 59 45 59 61 59 36 59 39 49 43 28 59 61 52 61 49 59 45 49 41 43 45 43 59 59 59 61 61 61 59 59 52 59 59 52 59 59 59 59 59 59 61 59 59 61 61 61 61 61 61 61 59 61 59 61 59 59 61 59 61 61 61 61 61 61 61 61 55 61 61 55 61 55 61 61 61 61 61 55 52 55 55 55 61 55 55 55 52 61 61 61 61 61 61 55 61 61 61 61 61 55 61 55 55 52 49 52 55 61 55 55 49 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 50 61 55 61 61 55 61 61 49 61 50 55 61 55 61 55 55 55 55 55 55 55 50 50 50 47 39 61 61 50 61 61 61 50 53 50 61 61 53 61 52 61 61 61 61 50 53 53 61 53 61 53 35 61 31 61 50 47 33 47 53 61 61 43 61 32 52 50 43 31 39 47 47 39 61 61 61 61 45 61 45 47 45 61 30 61 61 61 42 61 50 61 53 61 30 61 50 42 61 61 53 39 43 50 28 61 61 52 52 50 43 30 57 27 53 53 45 57 53 42 52 42 21 47 43 22 50 52 34 42 47 34 38 43 53 45 50 29 16 41 53 30 30 30 53 45 53 45 47 50 50 47 53 52 50 50 30 23 45 52 52 40 48 39 50 33 47 47 33 36 37 50 34 39 39 47 20 17 41 57 53 34 45 32 57 52 28 42 40 29 45 38 47 13 23 10 52 57 57 39 36 15 57 37 21 28 30 35 57 35 34 53 32 27 16 21 34 57 53 28 50 42 39 24 41 47 38 24 35 46 31 41 57 34 38 30 40 20 33 32 32 24 53 36 36 36 32 43 36 34 28 24 42 42 38 57 57 38 28 31 21 40 52 29 41 37 52 22 26 45 29 14 36 37 20 24 33 33 37 40 30 25 23 37 24 10 29 18 21 45 28 27 25 47 48 31 33 37 31 33 40 37 25 33 30 20 30 57 23 30 47 33 24 30 28 31 28 20 19 11 5 13 29 24 28 23 18 25 48 34 13 18 27 38 31 27 30 17 19 35 22 48 26 16 33 13 29 46 51 8 23 17 38 28 48 12 24 12 12 29 28 33 25 28 22 20 12 24 23 11 26 9 28 9 33 31 41 20 16 6 27 11 31 46 11 29 33 7 6 5 20 35 33 23 29 20 30 29 28 14 5 4 7 6 23 13 14 22 20 12 17 13 24 23 33 5 7 5 46 12 39 29 29 15 26 22 10 33 14 19 21 11 22 36 11 29 21 22 22 17 30 28 9 13 5 26 8 14 24 7 18 14 33 23 25 29 8 12 15 14 34 51 51 28 22 31 12 33 17 16 16 12 17 8 6 6 15 7 12 14 15 11 29 13 18 24 9 29 6 5 5 26 25 19 27 38 12 10 21 15 14 27 12 24 23 27 16 15 7 12 6 8 10 22 29 7 17 12 20	Open. Hide. 59 61 59 59 61 34 34 28 19 12 26 26 19 21 24 30 59 59 59 49 59 59 61 61 61 59 61 59 59 55 59 61 59 61 61 61 61 61 59 61 59 59 59 59 61 59 61 61 61 61 59 52 59 44 39 49 36 43 43 59 59 59 55 55 59 61 59 59 59 59 59 59 59 59 59 59 59 59 59 59 61 61 59 59 61 61 59 61 61 61 59 59 59 55 59 59 59 59 59 61 59 61 61 61 61 59 59 59 59 52 59 61 61 59 59 61 59 59 59 61 59 50 61 61 61 61 61 59 61 59 61 59 61 59 61 59 59 59 61 59 59 61 61 61 59 61 55 59 61 61 61 61 61 61 59 61 59 37 59 59 61 59 61 59 59 61 61 59 59 59 61 59 61 59 61 61 61 59 61 61 59 61 61 61 59 59 61 59 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 59 59 37 59 59 52 52 44 41 49 44 55 55 59 59 59 59 49 59 59 59 59 59 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 43 61 59 59 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 59 59 59 59 59 59 61 61 61 59 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 52 61 61 59 61 61 61 59 61 59 59 59 59 59 59 61 59 59 59 61 61 61 61 59 59 59 59 45 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 52 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 55 61 55 49 55 61 61 61 61 61 61 61 61 49 52 61 61 61 52 61 61 61 61 52 61 61 61 61 61 52 61 52 61 61 55 61 61 61 52 61 55 55 55 61 55 55 47 37 55 49 55 50 50 55 55 61 55 55 61 61 55 61 61 61 55 55 47 43 35 55 49 50 61 55 61 61 61 39 39 50 49 49 55 49 55 43 47 61 61 61 61 61 50 50 55 35 47 61 61 55 55 50 50 53 61 53 43 47 29 47 61 61 43 61 61 61 61 47 27 61 27 61 35 35 43 32 50 43 43 50 50 50 47 47 43 53 61 61 61 47 38 61 61 61 61 61 43 31 61 61 39 53 50 50 50 50 39 43 38 39 38 43 42 15 12 9 8 10 20 47 47 13 39 52 40 61 47 27 33 33 35 24 20 47 45 43 32 52 28 31 45 53 23 42 53 50 61 45 45 19 31 33 24 53 18 20 39 15 17 13 15 14 10 50 40 38 25 10 53 50 30 17 10 12 39 57 31 53 22 52 39 25 52 37 50 52 39 30 19 47 16 47 27 53 53 33 40 39 15 40 43 37 22 30 35 16 28 38 18 8 24 30 23 30 29 40 45 34 20 24 10 9 23 12 35 20 40 45 45 47 41 50 21 12 17 13 11 12 19 17 32 18 28 27 19 7 22 36 42 24 33 29 17 14 20 47 7 37 30 31 45 17 12 8 30 30 9 28 27 21 32 28 32 14 38 14 11 12 14 9 10 7 12 9 7 5 8 10 9 20 14 30 28 12 17 36 21 22 17 20 10 23 32 20 29 19 27 38 38 27 25 11 17 12 8 7 9 18 16 12 37 53 24 30 21 25 8 36 17 17 23 12 9 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_4722971_4724026
seq2: B6Ng01-093J07.b_50_1094 (reverse)

seq1  AGAACCCTGCTCTTAAGGTCACAGTTTGCCATATCTGATTAGCTCTCTGA  50
      |||| ||||||||||||||||||| ||||||||||||| ||||| | |||
seq2  AGAA-CCTGCTCTTAAGGTCACAG-TTGCCATATCTGA-TAGCTTTTTGA  47

seq1  GCTCCCTGCAAAATGGAGGACTTCCTTCCTCCGAGGAGCTTCCTGTTCTG  100
      ||| ||||||||||||| ||||||| ||||||||||||||| ||||| ||
seq2  GCT-CCTGCAAAATGGA-GACTTCC-TCCTCCGAGGAGCTT-CTGTT-TG  92

seq1  TGACTAACCTTACTTAGAG-AGTGTCTCTGAGCACAGATGCCTGACTTTA  149
      ||||| || |||| ||||| |||||||||||||||||||| ||||| |||
seq2  TGACT-ACTTTAC-TAGAGAAGTGTCTCTGAGCACAGATG-CTGAC-TTA  138

seq1  TCTGGGTTGTGACCCTGAGCAGAGCTCTCTAC-AAACTCTGGATGCCTCA  198
      |||||||||||| ||||||||||||||||||| |||||||||||||||||
seq2  TCTGGGTTGTGA-CCTGAGCAGAGCTCTCTACAAAACTCTGGATGCCTCA  187

seq1  GTACACGAGTTCCACTCTAGTTTCCCACCTGAATGATAACTGGGTGCTGT  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACACGAGTTCCACTCTAGTTTCCCACCTGAATGATAACTGGGTGCTGT  237

seq1  GTTATAACCAATCCACCACTCCTGCCCATATGGTAAGTAGGTAATGTGTT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTATAACCAATCCACCACTCCTGCCCATATGGTAAGTAGGTAATGTGTT  287

seq1  TAGGACCAATCAGCCCTGTCCACCCATACCCTAAAAGCCTTATATACCCT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGACCAATCAGCCCTGTCCACCCATACCCTAAAAGCCTTATATACCCT  337

seq1  ACCCCTGGAAGAGTAAAGTAGAGCTGTCTCACTGACCGTGTCCCTGCAAG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCTGGAAGAGTAAAGTAGAGCTGTCTCACTGACCGTGTCCCTGCAAG  387

seq1  TCCGTCATCCTCACAGCCCTCTGAACCCTGCTTTCTGCTCTTGCTTCCTC  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGTCATCCTCACAGCCCTCTGAACCCTGCTTTCTGCTCTTGCTTCCTC  437

seq1  TGCCTTCATGAACTAGTGGCCAGCGACCTCTGAGGAGAAGAGAGACCTAC  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTTCATGAACTAGTGGCCAGCGACCTCTGAGGAGAAGAGAGACCTAC  487

seq1  AATGGGTGACTCAAGAGGCAGCTCTGTGGTGTGTAGAACCACCAAGTCAA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGGTGACTCAAGAGGCAGCTCTGTGGTGTGTAGAACCACCAAGTCAA  537

seq1  GGCAGCCAACTATTTGACATCAGAAAAGGAAGTTGAACAGATGAAGAAAA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGCCAACTATTTGACATCAGAAAAGGAAGTTGAACAGATGAAGAAAA  587

seq1  ACCAGCATAGGAAGGACAGTGGAGGGGCTGGAGAGATGGCTCAGTGGTTA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGCATAGGAAGGACAGTGGAGGGGCTGGAGAGATGGCTCAGTGGTTA  637

seq1  AGAGCACCTACTGCTCTTCCGAAGGTCCTGAGTTCAAATCCCAGCAACCA  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCACCTACTGCTCTTCCGAAGGTCCTGAGTTCAAATCCCAGCAACCA  687

seq1  CATGGTGGCTAACAACCATCCGTAATGAGATCTGACGCCCTGTTCTGGTG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGTGGCTAACAACCATCCGTAATGAGATCTGACGCCCTGTTCTGGTG  737

seq1  CATCTGAAAACAGCTACAGTACTTATATATAATAATAAATAAATCTTAAA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTGAAAACAGCTACAGTACTTATATATAATAATAAATAAATCTTAAA  787

seq1  AAAAAAAAAGGGAAGGACAGTGGATGCAGAGAGACAAGAAAGAGCAAAGA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAGGGAAGGACAGTGGATGCAGAGAGACAAGAAAGAGCAAAGA  837

seq1  GCTGAGACTGAGGGAACCAGAGAGGAAAGACTGCAAGGCCCTGGGCACAG  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGAGACTGAGGGAACCAGAGAGGAAAGACTGCAAGGCCCTGGGCACAG  887

seq1  AACTGTCAAGTCTTCAGGGTCTTAGGGTCTGAGACTCTGAACCAACACTA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGTCAAGTCTTCAGGGTCTTAGGGTCTGAGACTCTGAACCAACACTA  937

seq1  TAATCAACCTTGCCTCTTAGCACTGATCTCCATCCTTCTGCGAGGCCACG  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATCAACCTTGCCTCTTAGCACTGATCTCCATCCTTCTGCGAGGCCACG  987

seq1  AGGAAAAGAGCTTCTCTTTTAGCCTAGGTGCACATCTTTGTAAGGTCATC  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAAAGAGCTTCTCTTTTAGCCTAGGTGCACATCTTTGTAAGGTCATC  1037

seq1  TTGAATTC  1056
      ||||||||
seq2  TTGAATTC  1045

seq1: chr16_4502883_4503747
seq2: B6Ng01-093J07.g_68_936

seq1  GAATTCTTAGCCCACCTACATCTTCTCCCTTTGAAAAAGATCAAAGACTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTAGCCCACCTACATCTTCTCCCTTTGAAAAAGATCAAAGACTT  50

seq1  CAACACACTTGCTTTTTACCTATAAAGTACACAGAACTGACATAATAATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACACACTTGCTTTTTACCTATAAAGTACACAGAACTGACATAATAATT  100

seq1  TTGTTTTCCACCTCATACCTAGTTCCTATGAATATCTGGTTTGAGAGATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTTCCACCTCATACCTAGTTCCTATGAATATCTGGTTTGAGAGATA  150

seq1  TACAGAGAAATTGCTATAAATCCTCTAACCATTGGCAGATATGTAGGGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGAGAAATTGCTATAAATCCTCTAACCATTGGCAGATATGTAGGGCT  200

seq1  TGTGGTAGATGCCAGGGGGATTCATAATGTAAATGATGTTTGTTTATTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGTAGATGCCAGGGGGATTCATAATGTAAATGATGTTTGTTTATTTT  250

seq1  TCGTTTGTGGGTGATTAGTTGGCTAGTTGGGTTTCTTATTTTTGTTTATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTTTGTGGGTGATTAGTTGGCTAGTTGGGTTTCTTATTTTTGTTTATT  300

seq1  TGTCTTTGAAATAAGCTCTCAGATAGTGTGGTGTGGCCTTCAAACTCATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTTTGAAATAAGCTCTCAGATAGTGTGGTGTGGCCTTCAAACTCATT  350

seq1  ATGTGGCCAGGGCTGGTCTTAAGCTCCGAATCCTAAGCCTCTATCTCCCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGGCCAGGGCTGGTCTTAAGCTCCGAATCCTAAGCCTCTATCTCCCA  400

seq1  AGTGCTAAGATCACAGGCATACATCACCAGGCCCAGACAATTGGTTTTTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTAAGATCACAGGCATACATCACCAGGCCCAGACAATTGGTTTTTG  450

seq1  AGTTTTTGTGAGGTTTTTTGTTTGTTGTCTTTTGTAACAGGGTTTCTTTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTTTGTGAGGTTTTTTGTTTGTTGTCTTTTGTAACAGGGTTTCTTTA  500

seq1  TCTATATCACCCTGGATGTCCTGGAACTCACAGAGATCTTCCTGTACCTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATATCACCCTGGATGTCCTGGAACTCACAGAGATCTTCCTGTACCTC  550

seq1  CCAGGTACTGGGATCAAAGGCATTGTCAGCACTGCCCAGCTAATTGATTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGTACTGGGATCAAAGGCATTGTCAGCACTGCCCAGCTAATTGATTT  600

seq1  TTTAAGCCAAGGTTGTGCTATATAGTTCTGGGTGGCTTGGTACTATATTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAGCCAAGGTTGTGCTATATAGTTCTGGGTGGCTTGGTACTATATTT  650

seq1  AACTCAGCCTGGCCTCAAACCACAGCAGTCTTTGTGCTTTAGCCTAAGTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCAGCCTGGCCTCAAACCACAGCAGTCTTTGTGCTTTAGCCTAAGTG  700

seq1  AT-GGTATTAAGAGGATGTGTTACCACACCTGACTTGCGCACTCATTTTG  749
      || ||||||||||||||||||||||||||||||||||||||||| |||||
seq2  ATGGGTATTAAGAGGATGTGTTACCACACCTGACTTGCGCACTCTTTTTG  750

seq1  AAAGATGAGTATCTCTA-GGGGAAGACATCATCAGTCCTTAGCTGGGAGT  798
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  AAAGATGAGTATCTCTAGGGGGAAGACATCATCAGTCCTTAGCTGGGAGT  800

seq1  GTGGCTCAGAT-GGTAGAGTGCTGGCCCAGCACACACAAAGCCCTAGGTT  847
      ||||||||||| |||||||| |||||||||||||||||||||||||||||
seq2  GTGGCTCAGATGGGTAGAGTTCTGGCCCAGCACACACAAAGCCCTAGGTT  850

seq1  CAA-TCCCCAGGACTGCAT  865
       || |||||||||||||||
seq2  TAATTCCCCAGGACTGCAT  869

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information