MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-157H13
Chromosome	16 (Build37)	16 (Build37)
Map Location	3,112,199 - 3,112,926	3,257,983 - 3,259,127
singlet/doublet	singlet	singlet
Overlap gene	none
Upstream gene	LOC100042177
Downstream gene	LOC100042915, LOC100042188, LOC100042251, LOC100042925, LOC100042270, LOC100042937, LOC100042283, Olfr161, Olfr162-ps1, Olfr163-ps1, LOC100042949, Mefv, EG620395, Zfp263, Olfr15, Zfp174, Zfp597, 1200013P24Rik, 1700037C18Rik, Cluap1, LOC664851, Nlrc3, Btbd12, Dnase1, Trap1, Crebbp
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	LOC100042915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042188 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042188
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	LOC100042251 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	LOC100042937 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	LOC100042283 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Olfr161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258859 MGI:3032605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr162-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258057 MGI:3029996
definition	gene_synonym : MOR131-2P note : olfactory receptor 162, pseudogene 1 pseudo : _no_value

name	Olfr163-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258018 MGI:3029997
definition	gene_synonym : MOR131-3_p; MOR263-8P note : olfactory receptor 163, pseudogene 1 pseudo : _no_value

name	LOC100042949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Mefv (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54483 MGI:1859396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620395 MGI:3645496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 3 Proteins

name	Zfp263 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74120 MGI:1921370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18312 MGI:106182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385674 MGI:2686600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71063 MGI:1918313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200013P24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74763 MGI:1922013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700037C18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73261 MGI:1920511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cluap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76779 MGI:1924029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664851 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664851
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Nlrc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268857 MGI:2444070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52864 MGI:106299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnase1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13419 MGI:103157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68015 MGI:1915265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crebbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12914 MGI:1098280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267265 GeneID:100042177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001477689.1

name	LOC100042270 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267268 GeneID:100042270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins product : similar to Unknown (protein for MGC:41421) transcript_id : XM_001477847.1

name	Olfr161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239305 GeneID:258859 MGI:3032605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 161 transcript_id : NM_146860.1

name	LOC100042949 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267295 GeneID:100042949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100042949 transcript_id : XM_001479839.1

name	Mefv (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506892 GeneID:54483 MGI:1859396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mediterranean fever transcript_id : NM_019453.1

name	EG620395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267297 GeneID:620395 MGI:3645496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 3 Proteins product : predicted gene, EG620395 transcript_id : XM_884793.3

name	Zfp263 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343562 GeneID:74120 MGI:1921370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 263 transcript_id : NM_148924.2

name	Olfr15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174769 GeneID:18312 MGI:106182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 15 transcript_id : NM_008762.2

name	Zfp174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487046 GeneID:385674 MGI:2686600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 174 transcript_id : NM_001081217.1

name	Zfp597 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370271 GeneID:71063 MGI:1918313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 597 transcript_id : NM_001033159.2

name	1200013P24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134254441 GeneID:74763 MGI:1922013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200013P24 gene transcript_id : NM_029090.3

name	1700037C18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037322 GeneID:73261 MGI:1920511
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700037C18 gene transcript_id : NM_028484.1

name	Cluap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130654 GeneID:76779 MGI:1924029
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : clusterin associated protein 1 transcript_id : NM_029738.2

name	Nlrc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486872 GeneID:268857 MGI:2444070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, CARD domain containing 3 transcript_id : NM_001081280.1

name	Btbd12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130426 GeneID:52864 MGI:106299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 12 transcript_id : NM_177472.4

name	Dnase1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47087133 GeneID:13419 MGI:103157
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyribonuclease I transcript_id : NM_010061.4

name	Trap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129831 GeneID:68015 MGI:1915265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TNF receptor-associated protein 1 transcript_id : NM_026508.2

name	Crebbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70995310 GeneID:12914 MGI:1098280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CREB binding protein transcript_id : NM_001025432.1

name	LOC100042177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267266 GeneID:100042177
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001477739.1

name	LOC100042270 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267269 GeneID:100042270
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477897.1

name	Olfr161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239306 CCDS:CCDS27906.1 GeneID:258859 MGI:3032605
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-112942-113883; olfactory receptor MOR131-1 product : olfactory receptor 161 protein_id : NP_667071.1

name	LOC100042949 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267296 GeneID:100042949
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479889.1

name	Mefv (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506893 CCDS:CCDS27907.1 GeneID:54483 MGI:1859396
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence ISS] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence NAS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006954 - inflammatory response [Evidence ISS] [Evidence IEA] codon_start : 1 exception : mismatches in translation note : marenostrin product : Mediterranean fever protein_id : NP_062326.1

name	EG620395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82958893 GeneID:620395 MGI:3645496
definition	codon_start : 1 product : similar to cripto protein_id : XP_889886.1

name	Zfp263 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956276 CCDS:CCDS27909.1 GeneID:74120 MGI:1921370
definition	GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : kruppel-associated box-zinc finger protein NT2 product : zinc finger protein 263 protein_id : NP_683726.1

name	Olfr15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174770 CCDS:CCDS27910.1 GeneID:18312 MGI:106182
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR256-17; GA_x54KRFPKG5P-348087-349025 product : olfactory receptor 15 protein_id : NP_032788.2

name	Zfp174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487047 GeneID:385674 MGI:2686600
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 174 protein_id : NP_001074686.1

name	Zfp597 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370272 CCDS:CCDS27911.1 GeneID:71063 MGI:1918313
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger protein 597 protein_id : NP_001028331.2

name	1200013P24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312874 GeneID:74763 MGI:1922013
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74763 protein_id : NP_083366.1

name	1700037C18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037323 GeneID:73261 MGI:1920511
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC73261 protein_id : NP_082760.1

name	Cluap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930457 CCDS:CCDS27912.1 GeneID:76779 MGI:1924029
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : clusterin associated protein 1 protein_id : NP_084014.1

name	Nlrc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486873 GeneID:268857 MGI:2444070
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051092 - activation of NF-kappaB transcription factor [Evidence ISS]; GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence ISS]; GO:0042110 - T cell activation [Evidence ISS] codon_start : 1 note : Caterpiller 16.2 product : caterpillar 16.2 protein_id : NP_001074749.1

name	Btbd12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42734487 GeneID:52864 MGI:106299
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : BTB (POZ) domain containing 12 protein_id : NP_803423.2

name	Dnase1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059022 CCDS:CCDS27913.1 GeneID:13419 MGI:103157
definition	EC_number : 3.1.21.1 GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004536 - deoxyribonuclease activity [Evidence IEA]; GO:0004530 - deoxyribonuclease I activity [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006308 - DNA catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : deoxyribonuclease I protein_id : NP_034191.2

name	Trap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385998 CCDS:CCDS27914.1 GeneID:68015 MGI:1915265
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 product : TNF receptor-associated protein 1 protein_id : NP_080784.1

name	Crebbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70995311 CCDS:CCDS27915.1 GeneID:12914 MGI:1098280
definition	EC_number : 2.3.1.48 GO_component : GO:0000123 - histone acetyltransferase complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0000940 - outer kinetochore of condensed chromosome [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0016407 - acetyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0003677 - DNA binding [Evidence IDA]; GO:0004402 - histone acetyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051577 - MyoD binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence IDA] [Evidence TAS]; GO:0003712 - transcription cofactor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016573 - histone acetylation [Evidence ISS]; GO:0042592 - homeostasis [Evidence ISS]; GO:0051091 - positive regulation of transcription factor activity [Evidence TAS]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001666 - response to hypoxia [Evidence ISS]; GO:0007165 - signal transduction [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : CREB binding protein protein_id : NP_001020603.1

name	LOC100042915 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042915
definition	number : 1 pseudo : _no_value

name	LOC100042251 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042251
definition	number : 1 pseudo : _no_value

name	LOC100042925 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042925
definition	number : 1 pseudo : _no_value

name	LOC100042283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042283
definition	number : 1 pseudo : _no_value

name	LOC100042283 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042283
definition	number : 2 pseudo : _no_value

name	LOC664851 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664851
definition	number : 1 pseudo : _no_value

name	LOC100042188 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267267 GeneID:100042188
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Zbed4 protein pseudo : _no_value transcript_id : XR_033357.1

name	LOC100042937 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267292 GeneID:100042937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to synaptojanin 2 binding protein pseudo : _no_value transcript_id : XR_034413.1

clone name	MSMg01-379M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053C11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-507C07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-126D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-290B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059L17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462P04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-138L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521M18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-512F18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543L10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-133N01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-119I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356F20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484B10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082E11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-354G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-305D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-157H13.b	B6Ng01-157H13.g
ACC	DH951697	DH951698
length	880	1,120
definition	DH951697\|Mus musculus domesticus DNA, BAC clone: B6Ng01-157H13, 5' end.	DH951698\|Mus musculus domesticus DNA, BAC clone: B6Ng01-157H13, 3' end.
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(3,112,199 - 3,112,926)	(3,257,983 - 3,259,127)
sequence	gaattcaaccagagaactccactatatccctcttagaaagagtagctgga gcttatctttaaggcttcctggtctaggggaatgcttctcgcttggggtc tgacaggtcctgggttcaaatcttggaagagacctctgcttttgccaatc caaccctgagaattaaagtcaatcttggctgcttagaaggtatgacttag caaaagaaaacagaaatctgtaagtacttgtagtggctattcctggttgt gaacttgactatatttggaatgaactacaatccagaattggaaggctcac cagtgacccttatctggaggcttggagatccttatctggatcttggtatg gagatcttaagccatagtggctatggattccagaagattgaatctccgag tttaaggaacacacctttaatctgagctacacctttcatctgggattaaa ggtgtggtggaacacacctttaatctgggctacaccttctgctggagaca atataaggacattggaagaagggagtctagctcttgctccttcgcctgct tgctgtgtgagactgagtaactgctagatccttggacttccattcacagc tgcgactgaaccattattgggaattgggctgtcgactgtaagtcatcaat aaattcttttactatatagagactatccatgagttctgtgactctagaga accctaactaatacagaaattggtaccaggtgtggttctagagtaacaga agtacaaggataaatcttttaaaatactggaattgggcttgttgatccac cagcactttcaactactgaaacctctccagattctctccctcctgggagc tcaaagaatttttgaagacccatggttgaa	gaattccagagaccacagtggaaacccaataggaaagttgcattccaggt tgtccagaaaatggtagagaagaaatactatgcaataaactacgatacac cagaatacagtcagagctaagccaatcttcaaaccaagtaaattcattgt ccaacaacttgacagtgttatgaaattataagtacagttatgcataacta attttcattgtgtaaagctaaaaagacaaagacaagcaaaaccctaactc ttatatacctcgctcccttggacctcagaaatattttagaggaacagcat gctataagaaaaaatttaagttagcaaaatttatggaatatatactatgt gcatattgtagacattatagatatgacactgttctaggaatcagaaatat ggtagtataatgttacaacattcataagaaacaatcccctattcttgcaa aagtttgtgaatgtttttcacttgctcaaattgttttcccaaccccttat tattcagagactctgtccctagtttgctgtcaactaacaaaagcacaggt cacttcagaagtaacttttcttttatacaatcttgatctggaatagtcct catatcacccttttctaatatttcttcagacacttttcctgagcctatta atatcatcttgctttttagttcatcagtgaacaatcggtgcagttttata tctctaaaataaaacatggtgctttttaggtgtattatataattacaaat aagaatgagtacatgttgatagtctatacataaatttgtaattggataag atatgattttagtcacacatctttaagtagtagcttttatgcagaaacaa attgacacatatgtctaagtagataccggtaatctctcttgtaatttaga tgctgggaatggtttacagtgttccaatgtagaggagccatactatgtgt tctgtttccgaggggtgatttcatggtttaccctgctatgactttctagg atgatcttggatgagtgctatcatctcttttatagtatttattttgtacc gattgagaggaaggattttcctttttgtgactataaatgctgaagctcca ggaacgttcaagtatgcatc
quality values	Open. Hide. 57 42 27 38 61 38 25 53 61 43 27 61 61 61 61 61 61 61 61 47 35 61 61 61 61 61 61 25 34 38 28 28 37 33 25 37 55 50 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 44 59 52 41 28 44 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 52 61 59 59 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 52 55 55 55 55 61 61 55 61 61 61 61 61 61 61 55 55 55 61 55 61 55 61 61 61 61 61 61 55 55 61 55 61 52 61 52 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 43 61 61 55 55 61 55 61 61 61 61 61 61 61 55 61 61 61 50 61 61 61 61 61 61 61 37 50 61 61 50 50 50 50 50 50 50 38 50 53 61 61 61 61 61 61 61 61 61 53 61 53 61 61 53 61 31 61 61 61 33 53 53 47 53 61 61 53 61 53 43 52 50 45 50 42 45 61 53 61 53 52 61 45 61 34 61 47 42 31 50 43 42 61 61 61 61 45 61 42 61 61 53 45 46 38 42 53 53 45 53 57 57 57 47 47 11 13 57 57 57 57 53 57 57 39 43 47 53 34 53 53 38 47 31 23 53 45 45 52 38 33 57 53 45 57 53 47 53 50 39 53 45 40 30 42 45 38 38 52 50 53 52 53 52 47 47 45 45 50 52 53 38 53 43 39 34 53 45 45 52 52 45 53 53 45 53 52 50 32 42 52 34 47 26 23 32 38 45 42 53 47 28 26 18 47 45 53 33 38 57 57 47 47 47 47 45 45 30 30 52 32 27 45 24 57 45 30 34 26 29 35 39 50 29 43 36 23 32 50 35 31 23 47 46 31 32 29 30 21 14 13 37 37 38 53 57 38 37 42 38 53 53 53 30 57 57 19 22 35 38 23 15 8 16 22 10 41 10 27 23 16 12 20 34 10 39 35 33 28 37 48 24 40 41 19 34 37 23 48 52 32 18 22 25 9 24 30 35 40 24 37 37 10 10 8 8 12 19 34 40 37 20 20 27 11 35 31 25 29 9 6 33 24 29 29 37 27 37 41 28 41 14 28 33 28 14 6 29 13 30 27 30 31 45 45 30 30 34 37 25 32 21 23 23 5 20 23 25 23 27 28 25 20	Open. Hide. 61 47 47 49 55 52 22 12 11 26 12 11 15 14 10 20 28 49 52 61 61 61 61 59 61 59 59 49 59 61 61 61 61 59 55 59 61 59 59 61 59 52 59 59 59 59 43 52 61 55 49 59 35 49 44 27 27 59 59 59 61 59 55 61 61 61 61 61 61 61 61 61 59 55 59 59 59 59 59 59 59 61 59 59 59 55 44 59 59 59 59 59 59 45 59 59 52 59 52 59 59 49 49 61 59 59 59 59 43 52 49 44 52 52 61 59 59 59 52 59 52 59 59 49 59 59 59 52 49 37 59 59 59 61 59 59 59 61 59 61 61 61 61 61 61 59 61 61 61 59 59 55 59 59 59 49 52 59 59 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 59 55 59 61 59 59 59 59 59 59 61 61 61 61 61 61 61 59 59 59 59 52 59 59 61 61 61 61 61 59 59 59 59 59 59 61 61 61 59 59 61 59 52 59 59 59 61 59 59 61 59 59 59 59 59 59 59 59 59 59 59 59 55 59 59 59 59 61 61 44 59 59 59 59 59 59 59 52 59 59 59 59 52 59 59 43 59 59 59 52 59 52 41 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 59 59 52 52 59 52 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 59 59 59 59 59 61 61 59 61 59 59 59 61 61 61 61 61 59 52 61 59 52 59 61 61 61 61 61 61 61 61 59 55 55 55 52 55 55 61 52 52 55 55 52 61 55 55 55 55 52 52 43 61 61 61 61 55 61 61 61 55 55 55 61 61 61 55 61 61 61 43 43 43 52 37 49 52 39 52 55 55 52 55 61 61 55 61 52 55 52 49 50 49 49 49 29 49 49 49 55 55 55 49 50 55 49 37 43 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 50 50 37 35 28 35 37 43 55 43 49 49 43 49 47 47 61 61 61 55 49 49 49 43 36 35 50 43 43 43 43 43 36 61 52 53 50 50 50 50 50 43 61 43 47 50 50 50 53 53 43 43 43 50 43 43 61 61 50 50 53 43 50 53 50 50 35 50 50 47 50 50 50 39 27 42 42 39 39 35 42 35 33 61 43 45 50 43 47 47 50 53 52 61 61 53 45 39 43 39 50 45 61 61 50 61 61 61 52 45 50 35 50 32 42 61 45 61 61 61 61 47 45 53 57 57 57 40 29 57 30 28 40 38 26 28 34 38 53 47 33 30 32 38 34 40 42 57 57 45 37 31 39 43 53 52 47 42 47 37 47 42 32 27 45 25 23 32 34 32 24 29 29 23 25 37 50 42 38 32 33 45 43 37 32 47 42 47 53 47 43 45 45 52 47 47 47 53 53 57 57 32 57 47 57 57 33 22 47 32 47 47 47 47 47 39 30 34 39 47 32 34 45 33 53 43 34 22 41 46 53 39 50 52 52 53 35 27 31 36 23 57 53 47 35 20 37 34 35 32 28 35 46 47 26 53 28 34 47 57 57 23 36 14 57 31 53 42 40 26 33 24 38 38 36 30 38 32 42 35 37 23 23 33 37 31 53 23 46 8 26 42 33 33 40 29 34 21 32 53 37 33 44 40 36 40 38 23 31 37 40 29 27 52 21 53 37 57 37 28 57 53 52 24 40 40 15 57 53 33 37 23 36 36 30 31 10 13 15 44 41 40 57 57 25 34 33 37 32 14 41 13 37 12 29 32 39 46 30 23 37 20 33 9 27 28 30 26 25 13 45 45 44 27 29 31 27 21 20 30 30 15 10 27 46 22 15 47 29 14 14 17 30 16 35 28 27 29 29 10 20 15 30 29 26 25 8 7 9 13 13 29 5 12 29 12 25 28 28 14 25 30 17 11 29 43 14 19 19 25 37 34 31 17 19 16 27 18 23 15 46 41 22 30 28 39 9 16 39 31 14 10 15 28 8 43 23 22 24 20 16 23 13 38 13 51 20 25 6 7 34 14 13 24 6 19 28 7 20 17 23 23 18 26 18 6 11 8 25 6 51 10 14 13 6 23 9 26 32 11 5 14 10 22 38 33 15 18 9 35 30 19 14 21 12 8 14 28 14 33 9 5 5 8 19 34 8 14 35 10 12 16 29 5 5 29 11 21 35 18 20 9 23 13 21 24 13 17 17 7 28 6 15 14 19 13 31 11 19 6 8 12 10 23 34 17 8 12 5 10 5 4 5 34 14 13 7 37 37 8 10 7 14 13 14 10 29 6 12 28 7 5 27 7 6 29 29 4 6 9 13 29 30 16 11 12 7 24 32 27 6 2 1 6 13 5 4 8 4 20 29 4 2 3 4 5 12 6 11 6 5 5 10 10 7 4 3 11 15 4 3 2 5 18 5 15 6 9 6 11 17 9 7 9 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_3112199_3112926
seq2: B6Ng01-157H13.b_47_774

seq1  GAATTCAACCAGAGAACTCCACTATATCCCTCTTAGAAAGAGTAGCTGGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAACCAGAGAACTCCACTATATCCCTCTTAGAAAGAGTAGCTGGA  50

seq1  GCTTATCTTTAAGGCTTCCTGGTCTAGGGGAATGCTTCTCGCTTAGGGTC  100
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  GCTTATCTTTAAGGCTTCCTGGTCTAGGGGAATGCTTCTCGCTTGGGGTC  100

seq1  TGACAGGTCCTGGGTTCAAATCTTGGAAGAGACCTCTGCTTTTGCCAATC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACAGGTCCTGGGTTCAAATCTTGGAAGAGACCTCTGCTTTTGCCAATC  150

seq1  CAACCCTGAGAATTAAAGTCAATCTTGGCTGCTTAGAAGGTATGACTTAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCCTGAGAATTAAAGTCAATCTTGGCTGCTTAGAAGGTATGACTTAG  200

seq1  CAAAAGAAAACAGAAATCTGTAAGTACTTGTAGTGGCTATTCCTGGTTGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAGAAAACAGAAATCTGTAAGTACTTGTAGTGGCTATTCCTGGTTGT  250

seq1  GAACTTGACTATATTTGGAATGAACTACAATCCAGAATTGGAAGGCTCAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTTGACTATATTTGGAATGAACTACAATCCAGAATTGGAAGGCTCAC  300

seq1  CAGTGACCCTTATCTGGAGGCTTGGAGATCCTTATCTGGATCTTGGTATG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGACCCTTATCTGGAGGCTTGGAGATCCTTATCTGGATCTTGGTATG  350

seq1  GAGATCTTAAGCCATAGTGGCTATGGATTCCAGAAGATTGAATCTCCGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGATCTTAAGCCATAGTGGCTATGGATTCCAGAAGATTGAATCTCCGAG  400

seq1  TTTAAGGAACACACCTTTAATCTGAGCTACACCTTTCATCTGGGATTAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAGGAACACACCTTTAATCTGAGCTACACCTTTCATCTGGGATTAAA  450

seq1  GGTGTGGTGGAACACACCTTTAATCTGGGCTACACCTTCTGCTGGAGACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTGGTGGAACACACCTTTAATCTGGGCTACACCTTCTGCTGGAGACA  500

seq1  ATATAAGGACATTGGAAGAAGGGAGTCTAGCTCTTGCTCCTTCGCCTGCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAAGGACATTGGAAGAAGGGAGTCTAGCTCTTGCTCCTTCGCCTGCT  550

seq1  TGCTGTGTGAGACTGAGTAACTGCTAGATCCTTGGACTTCCATTCACAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGTGTGAGACTGAGTAACTGCTAGATCCTTGGACTTCCATTCACAGC  600

seq1  TGCGACTGAACCATTATTGGGAATTGGGCTGTCGACTGTAAGTCATCAAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCGACTGAACCATTATTGGGAATTGGGCTGTCGACTGTAAGTCATCAAT  650

seq1  AAATTCTTTTACTATATAGAGACTATCCATGAGTTCTGTGACTCTAGAGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTCTTTTACTATATAGAGACTATCCATGAGTTCTGTGACTCTAGAGA  700

seq1  ACCCTAACTAATACAGAAGTTGGTACCA  728
      |||||||||||||||||| |||||||||
seq2  ACCCTAACTAATACAGAAATTGGTACCA  728

seq1: chr16_3257983_3259127
seq2: B6Ng01-157H13.g_68_1187

seq1  GAATTCCAGAGACCACAGTGGAAACCCAATAGGAAAGTTGCATTCCAGGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGAGACCACAGTGGAAACCCAATAGGAAAGTTGCATTCCAGGT  50

seq1  TGTCCAGAAAATGGTAGAGAAGAAATACTATGCAATAAACTACGATACAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCAGAAAATGGTAGAGAAGAAATACTATGCAATAAACTACGATACAC  100

seq1  CAGAATACAGTCAGAGCTAAGCCAATCTTCAAACCAAGTAAATTCATTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAATACAGTCAGAGCTAAGCCAATCTTCAAACCAAGTAAATTCATTGT  150

seq1  CCAACAACTTGACAGTGTTATGAAATTATAAGTACAGTTATGCATAACTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAACAACTTGACAGTGTTATGAAATTATAAGTACAGTTATGCATAACTA  200

seq1  ATTTTCATTGTGTAAAGCTAAAAAGACAAAGACAAGCAAAACCCTAACTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTCATTGTGTAAAGCTAAAAAGACAAAGACAAGCAAAACCCTAACTC  250

seq1  TTATATACCTCGCTCCCTTGGACCTCAGAAATATTTTAGAGGAACAGCAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATATACCTCGCTCCCTTGGACCTCAGAAATATTTTAGAGGAACAGCAT  300

seq1  GCTATAAGAAAAAATTTAAGTTAGCAAAATTTATGGAATATATACTATGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTATAAGAAAAAATTTAAGTTAGCAAAATTTATGGAATATATACTATGT  350

seq1  GCATATTGTAGACATTATAGATATGACACTGTTCTAGGAATCAGAAATAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATATTGTAGACATTATAGATATGACACTGTTCTAGGAATCAGAAATAT  400

seq1  GGTAGTATAATGTTACAACATTCATAAGAAACAATCCCCTATTCTTGCAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAGTATAATGTTACAACATTCATAAGAAACAATCCCCTATTCTTGCAA  450

seq1  AAGTTTGTGAATGTTTTTCACTTGCTCAAATTGTTTTCCCAACCCCTTAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTTGTGAATGTTTTTCACTTGCTCAAATTGTTTTCCCAACCCCTTAT  500

seq1  TATTCAGAGACTCTGTCCCTAGTTTGCTGTCAACTAACAAAAGCACAGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCAGAGACTCTGTCCCTAGTTTGCTGTCAACTAACAAAAGCACAGGT  550

seq1  CACTTCAGAAGTAACTTTTCTTTTATACAATCTTGATCTGGAATAGTCCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTCAGAAGTAACTTTTCTTTTATACAATCTTGATCTGGAATAGTCCT  600

seq1  CATATCACCCTTTTCTAATATTTCTTCAGACACTTTTCCTGAGCCTATTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATCACCCTTTTCTAATATTTCTTCAGACACTTTTCCTGAGCCTATTA  650

seq1  ATATCATCTTGCTTTTTAGTTCATCAGTGAACAATCGGTGCAGTTTTATA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCATCTTGCTTTTTAGTTCATCAGTGAACAATCGGTGCAGTTTTATA  700

seq1  TCTCTAAAATAAAACATGGTGCTTTTTAGGTGTATTATATAATTACAAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTAAAATAAAACATGGTGCTTTTTAGGTGTATTATATAATTACAAAT  750

seq1  AAGAATGAGTACATGTTGATAGTCTATACATAAATTTGTAATTGGATAAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAATGAGTACATGTTGATAGTCTATACATAAATTTGTAATTGGATAAG  800

seq1  ATAATGATTTTAGTCACACATCTTTAAGTTAGTAGCTTTTATGCAGAAAC  850
      || ||||||||||||||||||||||||| |||||||||||||||||||||
seq2  AT-ATGATTTTAGTCACACATCTTTAAG-TAGTAGCTTTTATGCAGAAAC  848

seq1  AAAATTGACACATATGTCTTAAGTAGATAACCGTTAATCTCTCTTGTAAA  900
       ||||||||||||||||| ||||||||| |||| ||||||||||||||| 
seq2  -AAATTGACACATATGTC-TAAGTAGAT-ACCGGTAATCTCTCTTGTAA-  894

seq1  TTTTAGATGCTGGGAATGGTTTTACAGTGTTCCAATGTAAGAAGAAGCCA  950
       |||||||||||||||||| |||||||||||||||||||   || |||||
seq2  -TTTAGATGCTGGGAATGG-TTTACAGTGTTCCAATGTA--GAGGAGCCA  940

seq1  TAACTATGTGTTCTGTTTCCGAAGGGTGGATTTCATGGTTTACCCTGCTA  1000
      | |||||||||||||||||||| |||| ||||||||||||||||||||||
seq2  T-ACTATGTGTTCTGTTTCCGAGGGGT-GATTTCATGGTTTACCCTGCTA  988

seq1  TGAACTTCTAAGAATGAATCTTGGATGAGTTGCTATCATCTCTTTTATAG  1050
      |||  |||| || ||| |||||||||||| ||||||||||||||||||||
seq2  TGACTTTCT-AGGATG-ATCTTGGATGAG-TGCTATCATCTCTTTTATAG  1035

seq1  TATTTATTTTGTAACAGATTGAGAAGAAAAGATTTTTCCCTTTTGTGAAC  1100
      |||||||||||| || |||||||| |  |||  |||||| ||||||| ||
seq2  TATTTATTTTGT-ACCGATTGAGAGG--AAGGATTTTCCTTTTTGTG-AC  1081

seq1  TATAAAATAAACTGAAGCTCCAAGAACAGTTCCAAGTATTGCATC  1145
      |||||   |  ||||||||||| |||| ||| |||||| ||||||
seq2  TATAA---ATGCTGAAGCTCCAGGAAC-GTT-CAAGTA-TGCATC  1120

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information