MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-200A15
Chromosome	16 (Build37)
Map Location	97,990,793 - 98,111,721
singlet/doublet	doublet
Overlap gene	Prdm15, 5830404H04Rik
Upstream gene	Dscam, Bace2, Mx1, ORF9, EG668559, LOC100041436, Mx2, Tmprss2, Ripk4
Downstream gene	Zfp295, LOC100041502, A630089N07Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dscr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56088 MGI:1860263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brwd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93871 MGI:1890651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Hmgn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15312 MGI:96120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wrb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71446 MGI:2136882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921526F01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385668 MGI:3041157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3bgr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50795 MGI:1354740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3galt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93961 MGI:2136878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jam4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72058 MGI:1919308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16415 MGI:1277979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18546 MGI:97509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dscam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13508 MGI:1196281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bace2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56175 MGI:1860440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17857 MGI:97243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ORF9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52793 MGI:1270150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668559 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668559 MGI:3645172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 319 ESTs, 40 Proteins

name	LOC100041436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Mx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17858 MGI:97244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50528 MGI:1354381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ripk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72388 MGI:1919638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prdm15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114604 MGI:1930121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 67 ESTs, 1 Protein

name	5830404H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207781 MGI:1922009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp295 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114565 MGI:1927240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100041502 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 17 ESTs

name	A630089N07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320586 MGI:2444323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	Dscr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801717 GeneID:56088 MGI:1860263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Down syndrome critical region homolog 2 (human) transcript_id : NM_019537.2

name	Brwd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388946 GeneID:93871 MGI:1890651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain and WD repeat domain containing 1 transcript_id : NM_145125.2

name	LOC100041318 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268210 GeneID:100041318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041318 transcript_id : XM_001476558.1

name	Hmgn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41406073 GeneID:15312 MGI:96120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group nucleosomal binding domain 1 transcript_id : NM_008251.3

name	Wrb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130672 GeneID:71446 MGI:2136882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptophan rich basic protein transcript_id : NM_207301.2

name	4921526F01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517723 GeneID:385668 MGI:3041157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921526F01 gene transcript_id : NM_001001492.2

name	Sh3bgr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490366 GeneID:50795 MGI:1354740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-binding domain glutamic acid-rich protein transcript_id : NM_015825.2

name	B3galt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254130 GeneID:93961 MGI:2136878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 transcript_id : NM_033149.2

name	Jam4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348330 GeneID:72058 MGI:1919308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junction adhesion molecule 4 transcript_id : NM_028078.2

name	Itgb2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802263 GeneID:16415 MGI:1277979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 2-like transcript_id : NM_008405.3

name	Pcp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52694684 GeneID:18546 MGI:97509
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Purkinje cell protein 4 transcript_id : NM_008791.2

name	Dscam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130729 GeneID:13508 MGI:1196281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Down syndrome cell adhesion molecule transcript_id : NM_031174.3

name	Bace2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803015 GeneID:56175 MGI:1860440
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-site APP-cleaving enzyme 2 transcript_id : NM_019517.3

name	Mx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268088 GeneID:17857 MGI:97243
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myxovirus (influenza virus) resistance 1 transcript_id : XR_035486.1

name	ORF9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383579 GeneID:52793 MGI:1270150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 9 transcript_id : NM_020622.2

name	EG668559 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268212 GeneID:668559 MGI:3645172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 319 ESTs, 35 Proteins product : predicted gene, EG668559, transcript variant 4 transcript_id : XM_001004765.2

name	EG668559 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268213 GeneID:668559 MGI:3645172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 295 ESTs, 21 Proteins product : predicted gene, EG668559, transcript variant 3 transcript_id : XM_001004764.2

name	EG668559 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268215 GeneID:668559 MGI:3645172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 269 ESTs, 22 Proteins product : predicted gene, EG668559, transcript variant 1 transcript_id : XM_001004760.2

name	LOC100041436 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268217 GeneID:100041436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041436 transcript_id : XM_001477021.1

name	Mx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268089 GeneID:17858 MGI:97244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myxovirus (influenza virus) resistance 2 transcript_id : XR_035745.1

name	Tmprss2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328225 GeneID:50528 MGI:1354381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 2 transcript_id : NM_015775.2

name	Ripk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353027 GeneID:72388 MGI:1919638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor-interacting serine-threonine kinase 4 transcript_id : NM_023663.4

name	Prdm15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268219 GeneID:114604 MGI:1930121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 67 ESTs, 1 Protein product : PR domain containing 15 transcript_id : XM_622716.4

name	5830404H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30424670 GeneID:207781 MGI:1922009
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830404H04 gene transcript_id : NM_174847.1

name	Zfp295 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157491 GeneID:114565 MGI:1927240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 295 transcript_id : NM_001081684.1

name	Zfp295 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157481 GeneID:114565 MGI:1927240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 295 transcript_id : NM_001081685.1

name	Zfp295 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157509 GeneID:114565 MGI:1927240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 295 transcript_id : NM_175428.3

name	LOC100041502 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268221 GeneID:100041502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 17 ESTs product : hypothetical protein LOC100041502 transcript_id : XM_001477208.1

name	A630089N07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268223 GeneID:320586 MGI:2444323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : RIKEN cDNA A630089N07 gene transcript_id : XM_983340.2

name	Dscr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506555 CCDS:CCDS28352.1 GeneID:56088 MGI:1860263
definition	codon_start : 1 product : Down syndrome critical region protein 2 protein_id : NP_062410.1

name	Brwd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553077 GeneID:93871 MGI:1890651
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IDA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : WD repeat domain 9 product : bromodomain and WD repeat domain containing 1 protein_id : NP_660107.1

name	LOC100041318 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268211 GeneID:100041318
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476608.1

name	Hmgn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41406074 CCDS:CCDS28353.1 GeneID:15312 MGI:96120
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006325 - establishment and/or maintenance of chromatin architecture [Evidence IMP]; GO:0000720 - pyrimidine dimer repair via nucleotide-excision repair [Evidence IMP]; GO:0010224 - response to UV-B [Evidence IMP]; GO:0010225 - response to UV-C [Evidence IDA]; GO:0006283 - transcription-coupled nucleotide-excision repair [Evidence IMP] codon_start : 1 note : high mobility group protein 14 product : high mobility group nucleosomal binding domain 1 protein_id : NP_032277.3

name	Wrb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46409250 CCDS:CCDS28354.1 GeneID:71446 MGI:2136882
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : tryptophan rich basic protein protein_id : NP_997184.1

name	4921526F01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517724 GeneID:385668 MGI:3041157
definition	codon_start : 1 product : hypothetical protein LOC385668 protein_id : NP_001001492.2

name	Sh3bgr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657558 CCDS:CCDS28355.1 GeneID:50795 MGI:1354740
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : SH3 domain-binding glutamic acid-rich protein product : SH3-binding domain glutamic acid-rich protein protein_id : NP_056640.1

name	B3galt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011870 CCDS:CCDS28356.1 GeneID:93961 MGI:2136878
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 protein_id : NP_149161.1

name	Jam4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312488 CCDS:CCDS28357.1 GeneID:72058 MGI:1919308
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0030165 - PDZ domain binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016337 - cell-cell adhesion [Evidence IDA] codon_start : 1 note : immunoglobulin superfamily, member 5 product : cell adhesion molecule JCAM protein_id : NP_082354.1

name	Itgb2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114796622 CCDS:CCDS28358.1 GeneID:16415 MGI:1277979
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : integrin beta 2-like protein_id : NP_032431.2

name	Pcp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679227 GeneID:18546 MGI:97509
definition	codon_start : 1 product : Purkinje cell protein 4 protein_id : NP_032817.1

name	Dscam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13626028 GeneID:13508 MGI:1196281
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : Down syndrome cell adhesion molecule protein_id : NP_112451.1

name	Bace2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542215 CCDS:CCDS28359.1 GeneID:56175 MGI:1860440
definition	GO_function : GO:0009049 - aspartic-type signal peptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : beta-site APP-cleaving enzyme 2 protein_id : NP_062390.2

name	ORF9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22296880 GeneID:52793 MGI:1270150
definition	GO_component : GO:0005576 - extracellular region [Evidence NAS]; GO:0005641 - nuclear envelope lumen [Evidence ISS] GO_function : GO:0005125 - cytokine activity [Evidence NAS] [Evidence IEA] GO_process : GO:0030073 - insulin secretion [Evidence IDA] codon_start : 1 product : cytokine-like protein 2-21 protein_id : NP_065647.1

name	EG668559 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400765 GeneID:668559 MGI:3645172
definition	codon_start : 1 product : similar to heterogeneous nuclear ribonucleoprotein A3, isoform 4 protein_id : XP_001004765.1

name	EG668559 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268214 GeneID:668559 MGI:3645172
definition	codon_start : 1 product : similar to heterogeneous nuclear ribonucleoprotein A3, isoform 3 protein_id : XP_001004764.2

name	EG668559 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268216 GeneID:668559 MGI:3645172
definition	codon_start : 1 product : similar to heterogeneous nuclear ribonucleoprotein A3, isoform 1 protein_id : XP_001004760.2

name	LOC100041436 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268218 GeneID:100041436
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477071.1

name	Tmprss2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328226 GeneID:50528 MGI:1354381
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : epitheliasin product : transmembrane protease, serine 2 protein_id : NP_056590.2

name	Ripk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18129624 CCDS:CCDS28360.1 GeneID:72388 MGI:1919638
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : ankyrin repeat domain 3 product : receptor-interacting serine-threonine kinase 4 protein_id : NP_076152.2

name	Prdm15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268220 GeneID:114604 MGI:1930121
definition	codon_start : 1 product : PR domain containing 15 protein_id : XP_622716.4

name	5830404H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424671 CCDS:CCDS28361.1 GeneID:207781 MGI:1922009
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC207781 protein_id : NP_777272.1

name	Zfp295 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157482 GeneID:114565 MGI:1927240
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : zinc finger protein 295 isoform 3 protein_id : NP_001075154.1

name	Zfp295 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157510 GeneID:114565 MGI:1927240
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 295 isoform 1 protein_id : NP_780637.2

name	Zfp295 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157492 GeneID:114565 MGI:1927240
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 295 isoform 2 protein_id : NP_001075153.1

name	LOC100041502 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268222 GeneID:100041502
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477258.1

name	A630089N07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268224 GeneID:320586 MGI:2444323
definition	codon_start : 1 product : hypothetical protein LOC320586 protein_id : XP_988434.2

clone name	MSMg01-412G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P07
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-327N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277I12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-200A15.b	B6Ng01-200A15.g
ACC	GA021211	GA021212
length	1,210	1,093
definition	B6Ng01-200A15.b	B6Ng01-200A15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(97,990,793 - 97,992,018)	(98,110,638 - 98,111,721)
sequence	gaattcattaatactgcccggcatggtgtgacatgcctgcaatcctgtat cctagcgctcagaagatggaagaggaagatcagacagggcaaccaggcaa gaccctcatcttcaaaaccaaataaatatacaaacaaacccaaaccaaac aagaaattatctcaacctaaagttgaagcgccaagttcatatgtttctaa cagacttaattggctccctccaaaatttgagctatcacactgccttatgt gaattctctgtgctgcccttcccacaagcctaggctgtcctcttctgcct ggatggctctgtttactgccaatgcttacatgtttctttaaacaccaatt gcctgccccagtttttccttcctctcttgtttatttgctatcaacttttc ctttcaagtgactttgtaaatactggtcagttacttcccaaagaatcaca cctctggatggctttcttgaacatacagatcccactttcactggggcagc agagggcagaccctgatacccacctccacacatgtcacatggatgcttag ggcccattcagggaactgagcctagattttccagaataggaacacaaacc atggaggctggaatatggttccaaagacagacagacagacagacagacag acagacagacatgagccacatagaacatcagtgaaaggatggagaatgcc ctaggaacctcaacccagtgtgtatgataccaagatagctgaagaaaaat taaacaggccttcaacatcagctgctgttactctgagagaagaagaaagg ggaacaggaaggattagggggtgacaatagctaatgagattgatgttcta ccttcatgtgagaggaatcaaagcaagactatgcaagggtaaatgtgatg atgcccccccccccaatttataggagtaccctaaaagcacctttctttct aggaagccaccctggatactggagatgagtttgatgctgtcatgaaaggt gtccttagtgtcaagaaaggtctgtagtcctatcttcagctgtaaaagtc cagcacagggttcaaaacttattccagtggcagcagtgtgcattgcagac tttaggcaagcttacgaggcagtcactgggtcagagtctttggaggtggt tcaggaacctgttcttacataggtggattaggcctgaacaggtctaagtt tctctgagaa	gaattccacatggaagagaagagagaggacatacaaatcaggtggtcttt cacccacgtcccagaaacagccatcaagatccagccccaggccccagggg aggtcagtccgtaagtttttatcattctttcactggtttgaggatgcatg tgtggctagggcatgtctcgaattggattgctggaaagtgggtggcccct gctactctcctcattctgacttaggccacaagtgacagggctctgtgggg acagctttgatagagaggacagttgcctttccgctttctgggaccttagg gtataaggacagaagctgggctgcagtgagtgtgtgaaaattatcccggt gtaactttcctttgttgcacaagggaattctttctgtggcttttacaaaa tttccttgtagttctgcttcatttcaaccaggtcagccactgaagcctca ccacagtagagagctgtgggctttgcagggtatttgcacaaagatacttt cccttttatcctttcatctcacttttatctcttctctctcttcacttttc ctctggagttgagactggaacttagggcctttgacatgctaaacaagtgc tctgcctcagtcctgccactatctcagccttcatacttagatgtgtgtaa tgtgagtgtttgtttggtttggctttggtttggtttgagctggtaaattt cacacacatacacaaatactggctgaggaaaattaactaatctgagattg gtaacacagctactcggggagcggggagggataaggactcttgaacacag attggtccccttctcagcagaagagattgaacatgtcaggacttgtctgt atggacagcaggcctggacaactgacatttttgtcttagagaagcaaaca gcaaaaggaaaggagaaagggagaatgaattggggttggggccttccttc ttcctactgcttcttgcattctctcgaaatatgaacatttatttgtctag ggcctgctgtctactaaggcaagtctcagcaacgtggaggtttctatggt gcaaagagaatttcttatgggaatattcacagtccttgtgatt
quality values	Open. Hide. 58 33 52 35 58 25 17 58 54 58 58 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 42 22 21 32 32 38 38 38 29 38 44 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 43 62 62 62 62 62 62 62 62 62 59 46 54 54 62 43 34 54 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 54 47 62 54 62 62 62 54 43 62 62 62 62 47 53 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 58 58 42 54 58 58 58 58 58 58 58 54 54 58 58 54 58 58 54 52 54 58 58 58 58 54 58 58 58 54 58 58 58 58 54 54 47 58 58 58 54 41 39 52 58 52 54 58 54 58 58 48 52 52 58 54 58 52 58 38 42 54 58 58 58 33 58 52 54 58 58 58 47 39 54 42 58 54 49 53 51 54 24 49 58 58 58 48 50 58 51 51 40 53 58 48 50 50 49 58 46 53 42 58 29 53 49 51 40 58 58 52 40 58 48 50 50 53 53 50 39 58 53 58 32 51 51 40 52 40 49 46 32 49 47 50 46 47 49 40 50 46 54 50 58 50 42 58 40 31 58 39 48 40 36 33 32 34 18 44 41 46 50 24 50 29 32 33 32 49 49 42 23 42 41 41 37 52 58 58 50 58 53 29 35 54 53 39 39 41 39 27 40 46 58 52 52 50 51 51 39 54 32 17 54 54 54 46 19 39 33 35 54 44 40 30 41 53 24 44 29 32 31 25 32 40 29 53 42 31 31 45 52 41 25 42 35 26 41 28 33 53 37 53 39 51 19 53 33 49 37 28 51 34 19 54 54 41 37 54 54 45 30 28 34 27 20 46 38 53 33 42 20 14 45 37 16 53 53 52 35 27 27 29 18 31 31 32 37 31 32 32 28 53 27 37 35 24 32 31 32 26 28 18 33 28 21 33 22 26 28 21 17 12 13 18 34 42 32 32 39 21 35 17 30 31 31 25 32 25 51 34 22 31 31 32 31 32 26 33 29 31 32 33 33 22 27 47 30 26 28 46 34 31 42 29 32 34 20 30 27 20 31 32 37 37 37 43 30 40 36 37 35 33 25 30 28 32 38 16 15 18 11 23 43 19 22 20 28 31 16 28 43 41 41 7 7 9 9 17 21 30 46 31 32 31 48 30 22 9 9 24 26 27 30 29 30 6 9 31 38 20 14 21 25 21 17 16 29 13 31 31 37 8 43 15 24 24 23 30 48 21 14 27 16 19 25 31 31 22 34 24 35 26 16 48 24 26 6 7 11 15 18 23 25 22 32 11 19 31 19 18 7 9 9 29 48 25 18 29 16 24 32 32 18 24 27 34 19 22 12 7 15 18 31 10 8 7 6 7 6 8 5 24 28 40 20 19 7 11 21 24 19 7 7 6 13 9 34 27 13 13 12 9 40 40 21 10 21 28 10 9 14 15 16 4 7 11 9 24 5 31 8 14 4 5 5 7 20 5 11 7 7 5 4 14 13 12 27 13 14 28 19 17 9 18 13 14 19 16 20 6 13 13 6 5 14 6 10 7 15 16 2 6 4 6 4 10 23 18 6 13 4 5 4 7 4 9 4 12 10 12 7 8 4 5 8 8 6 4 9 6 9 8 10 6 14 7 5 12 3 3 3 6 8 4 1 2 1 5 9 12 6 3 1 1 1 1 4 20 6 6 6 6 6 6 14 4 5 4 9 11 6 21 9 25 23 7 4 4 4 5 4 4 11 11 16 9 5 22	Open. Hide. 62 35 51 47 62 62 47 32 62 47 56 56 32 20 21 20 34 27 33 32 27 62 59 62 62 62 62 62 59 34 62 62 62 62 59 62 62 62 59 59 59 62 59 62 62 59 62 62 62 54 59 51 62 62 59 62 62 59 59 62 62 62 62 46 59 62 62 62 62 62 62 59 62 62 62 59 56 56 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 49 49 62 62 62 62 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 40 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 41 45 41 58 58 58 58 58 52 58 58 52 51 58 58 58 58 58 58 58 58 45 49 52 58 58 58 54 51 58 58 58 47 58 58 54 58 54 58 58 58 58 54 58 54 46 47 46 52 58 58 58 58 54 54 49 58 54 54 58 58 53 53 50 47 58 49 51 58 51 41 51 45 51 58 41 54 50 46 37 51 46 51 47 58 38 31 58 46 58 46 51 58 49 50 58 51 58 58 58 33 49 44 58 58 40 58 52 58 51 53 54 58 52 58 51 58 58 50 58 51 46 58 41 32 53 31 51 53 51 58 39 40 58 37 35 33 36 52 50 41 30 41 40 50 31 51 39 51 37 52 32 51 40 40 40 53 39 58 47 42 53 52 51 9 33 24 58 58 28 25 53 31 41 52 40 29 35 41 54 39 33 53 39 42 17 32 50 44 40 49 31 31 32 52 42 39 40 53 32 39 52 52 38 49 46 25 13 14 52 32 54 54 42 49 15 54 51 28 22 22 18 12 51 37 32 38 52 45 33 38 31 35 26 28 37 31 31 32 31 31 42 25 16 41 52 53 35 25 29 23 9 29 20 35 31 32 10 10 14 23 47 19 34 30 11 25 8 18 29 22 35 42 31 33 11 22 13 31 30 28 31 51 24 31 33 42 29 36 26 31 33 20 29 31 31 28 40 21 18 28 28 31 41 31 36 21 33 31 32 36 31 41 33 31 31 48 48 48 20 16 18 31 33 33 36 6 35 19 27 44 16 41 30 46 29 29 29 29 32 7 29 11 7 7 18 8 46 13 25 6 8 11 28 41 31 21 31 14 14 17 36 11 10 13 5 10 21 35 26 38 28 23 9 7 25 41 21 26 8 15 14 10 14 25 21 25 31 7 11 37 25 16 6 8 5 12 24 12 8 17 19 9 19 14 5 7 6 8 6 18 13 21 8 25 39 11 7 7 7 15 9 15 7 5 10 36 14 13 23 43 18 30 20 19 9 17 9 31 7 32 33 21 18 14 13 13 10 17 19 28 7 4 8 5 7 11 13 30 10 5 4 6 9 6 23 16 21 6 13 5 3 3 6 10 16 6 11 13 6 6 4 15 8 8 8 5 7 20 5 21 38 8 3 5 4 10 24 13 28 22 16 13 7 16 11 13 24 7 3 5 7 17 4 5 4 6 6 2 5 11 11 6 22 18 12 4 7 14 17 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_97990793_97992018
seq2: B6Ng01-200A15.b_45_1254

seq1  GAATTCATTAATACTGCCCGGCATGGTGTGACATGCCTGCAATCCTGTAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTAATACTGCCCGGCATGGTGTGACATGCCTGCAATCCTGTAT  50

seq1  CCTAGCGCTCAGAAGATGGAAGAGGAAGATCAGACAGGGCAACCAGGCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGCGCTCAGAAGATGGAAGAGGAAGATCAGACAGGGCAACCAGGCAA  100

seq1  GACCCTCATCTTCAAAACCAAATAAATATACAAACAAACCCAAACCAAAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCCTCATCTTCAAAACCAAATAAATATACAAACAAACCCAAACCAAAC  150

seq1  AAGAAATTATCTCAACCTAAAGTTGAAGCGCCAAGTTCATATGTTTCTAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAATTATCTCAACCTAAAGTTGAAGCGCCAAGTTCATATGTTTCTAA  200

seq1  CAGACTTAATTGGCTCCCTCCAAAATTTGAGCTATCACACTGCCTTATGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACTTAATTGGCTCCCTCCAAAATTTGAGCTATCACACTGCCTTATGT  250

seq1  GAATTCTCTGTGCTGCCCTTCCCACAAGCCTAGGCTGTCCTCTTCTGCCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTGTGCTGCCCTTCCCACAAGCCTAGGCTGTCCTCTTCTGCCT  300

seq1  GGATGGCTCTGTTTACTGCCAATGCTTACATGTTTCTTTAAACACCAATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGGCTCTGTTTACTGCCAATGCTTACATGTTTCTTTAAACACCAATT  350

seq1  GCCTGCCCCAGTTTTTCCTTCCTCTCTTGTTTATTTGCTATCAACTTTTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGCCCCAGTTTTTCCTTCCTCTCTTGTTTATTTGCTATCAACTTTTC  400

seq1  CTTTCAAGTGACTTTGTAAATACTGGTCAGTTACTTCCCAAAGAATCACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCAAGTGACTTTGTAAATACTGGTCAGTTACTTCCCAAAGAATCACA  450

seq1  CCTCTGGATGGCTTTCTTGAACATACAGATCCCACTTTCACTGGGGCAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGGATGGCTTTCTTGAACATACAGATCCCACTTTCACTGGGGCAGC  500

seq1  AGAGGGCAGACCCTGATACCCACCTCCACACATGTCACATGGATGCTTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGGCAGACCCTGATACCCACCTCCACACATGTCACATGGATGCTTAG  550

seq1  GGCCCATTCAGGGAACTGAGCCTAGATTTTCCAGAATAGGAACACAAACC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCATTCAGGGAACTGAGCCTAGATTTTCCAGAATAGGAACACAAACC  600

seq1  ATGGAGGCTGGAATATGGTTCCAAAGACAGACAGACAGACAGACAGACAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAGGCTGGAATATGGTTCCAAAGACAGACAGACAGACAGACAGACAG  650

seq1  ACAGACAGACATGAGCCACATAGAACATCAGTGAAAGGATGGAGAATGCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGACAGACATGAGCCACATAGAACATCAGTGAAAGGATGGAGAATGCC  700

seq1  CTAGGAACCTCAACCCAGTGTGTATGATACCAAGATAGCTGAAGAAAAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGGAACCTCAACCCAGTGTGTATGATACCAAGATAGCTGAAGAAAAAT  750

seq1  TAAACAGGCCTTCAACATCAGCTGCTGTTACTCTGAGAGAAGAAGAAAGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACAGGCCTTCAACATCAGCTGCTGTTACTCTGAGAGAAGAAGAAAGG  800

seq1  GGAACAGGAAGGATTAGGGGGTGACAATAGCTAATGAGATTGATGTTCTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAACAGGAAGGATTAGGGGGTGACAATAGCTAATGAGATTGATGTTCTA  850

seq1  CCTTCATGTGAGAGGAATCAAAGCAAGACTATGCAAGGGTAAATGTGATG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCATGTGAGAGGAATCAAAGCAAGACTATGCAAGGGTAAATGTGATG  900

seq1  ATGCCCCCCCCCCCAATTTATAGGAGTACCCTAAAAGCCACCTTTCTTTC  950
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  ATGCCCCCCCCCCCAATTTATAGGAGTACCCTAAAAG-CACCTTTCTTTC  949

seq1  TAGGAAGCCACCCTGGATACTGGAGAATGAGTTTGATGCTGTCATGAAAG  1000
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  TAGGAAGCCACCCTGGATACTGGAG-ATGAGTTTGATGCTGTCATGAAAG  998

seq1  GTGTCCTTAGTGTCCAAGAAAGGTCTGTAGTCCTATCTTCAGCTGTAAAA  1050
      ||||||||||||| |||||||||||||||||||||||||||||||| |||
seq2  GTGTCCTTAGTGT-CAAGAAAGGTCTGTAGTCCTATCTTCAGCTGT-AAA  1046

seq1  AGTCCAGCACAGGGTCCAAAACTTATCCCAGTGGGCAAGCCAGTGTTGCA  1100
      ||||||||||||||| |||||||||| ||||| ||||   ||||| ||||
seq2  AGTCCAGCACAGGGTTCAAAACTTATTCCAGT-GGCA--GCAGTG-TGCA  1092

seq1  -TGCAGACTTTAGGCAAGCTACAGAGGGCAGGTCCACTGGGTC-CAGTCT  1148
       |||||||||||||||||||   || |||||   |||||||||  |||||
seq2  TTGCAGACTTTAGGCAAGCTTACGA-GGCAG--TCACTGGGTCAGAGTCT  1139

seq1  T--GA-GTGGTTCAGGAAACTTGGTTTCTTTTCAC-TAGTGTAGAGTCCT  1194
      |  || |||||||||||| ||    |||||   || ||| || ||    |
seq2  TTGGAGGTGGTTCAGGAACCT---GTTCTT---ACATAG-GTGGA----T  1178

seq1  AAGGCCTGAACAGGTCAAATGTTCTCTGAGAA  1226
       ||||||||||||||| ||  |||||||||||
seq2  TAGGCCTGAACAGGTCTAAGTTTCTCTGAGAA  1210

seq1: chr16_98110638_98111721
seq2: B6Ng01-200A15.g_66_1158 (reverse)

seq1  AATCACAAAGACTGGTGATTTTCCCATAAGAAATTCTCCTTTCCACATAA  50
      |||||||| |||||   || |||||||||||||||||| || |  |||| 
seq2  AATCACAAGGACTGTGAATATTCCCATAAGAAATTCTCTTTGCACCATAG  50

seq1  GAAACT-CACGTTGCTGAG-CTTGCCTATGTAGACAGCAGG-CCTAGACA  97
       || || |||||||||||| |||||||  |||||||||||| ||||||||
seq2  AAACCTCCACGTTGCTGAGACTTGCCTTAGTAGACAGCAGGCCCTAGACA  100

seq1  AAT-AATG-TCATATTTCGAGAGAA-GCAAGAAGCAGGAGG-AGAAGGAA  143
      ||| |||| |||||||||||||||| ||||||||||| ||| ||||||||
seq2  AATAAATGTTCATATTTCGAGAGAATGCAAGAAGCAGTAGGAAGAAGGAA  150

seq1  GGCCCC-ACCCCAATTCATTCTCCCTTTCTCC-TTCCTTTTGCTGTTTGC  191
      |||||| ||||||||||||||||||||||||| |||||||||||||||||
seq2  GGCCCCAACCCCAATTCATTCTCCCTTTCTCCTTTCCTTTTGCTGTTTGC  200

seq1  TTCTCTAAGACAAAAATGTCAGTTGTCCAGGCCTGCTGTCCATACAGACA  241
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCTAAGACAAAAATGTCAGTTGTCCAGGCCTGCTGTCCATACAGACA  250

seq1  AGTCCTGACATGTTCAATCTCTTCTGCTGAGAAGGGGACCAATCTGTGTT  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCTGACATGTTCAATCTCTTCTGCTGAGAAGGGGACCAATCTGTGTT  300

seq1  CAAGAGTCCTTATCCCTCCCCGCTCCCCGAGTAGCTGTGTTACCAATCTC  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAGTCCTTATCCCTCCCCGCTCCCCGAGTAGCTGTGTTACCAATCTC  350

seq1  AGATTAGTTAATTTTCCTCAGCCAGTATTTGTGTATGTGTGTGAAATTTA  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATTAGTTAATTTTCCTCAGCCAGTATTTGTGTATGTGTGTGAAATTTA  400

seq1  CCAGCTCAAACCAAACCAAAGCCAAACCAAACAAACACTCACATTACACA  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCTCAAACCAAACCAAAGCCAAACCAAACAAACACTCACATTACACA  450

seq1  CATCTAAGTATGAAGGCTGAGATAGTGGCAGGACTGAGGCAGAGCACTTG  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTAAGTATGAAGGCTGAGATAGTGGCAGGACTGAGGCAGAGCACTTG  500

seq1  TTTAGCATGTCAAAGGCCCTAAGTTCCAGTCTCAACTCCAGAGGAAAAGT  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGCATGTCAAAGGCCCTAAGTTCCAGTCTCAACTCCAGAGGAAAAGT  550

seq1  GAAGAGAGAGAAGAGATAAAAGTGAGATGAAAGGATAAAAGGGAAAGTAT  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAGAGAGAAGAGATAAAAGTGAGATGAAAGGATAAAAGGGAAAGTAT  600

seq1  CTTTGTGCAAATACCCTGCAAAGCCCACAGCTCTCTACTGTGGTGAGGCT  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGTGCAAATACCCTGCAAAGCCCACAGCTCTCTACTGTGGTGAGGCT  650

seq1  TCAGTGGCTGACCTGGTTGAAATGAAGCAGAACTACAAGGAAATTTTGTA  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTGGCTGACCTGGTTGAAATGAAGCAGAACTACAAGGAAATTTTGTA  700

seq1  AAAGCCACAGAAAGAATTCCCTTGTGCAACAAAGGAAAGTTACACCGGGA  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCCACAGAAAGAATTCCCTTGTGCAACAAAGGAAAGTTACACCGGGA  750

seq1  TAATTTTCACACACTCACTGCAGCCCAGCTTCTGTCCTTATACCCTAAGG  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTTCACACACTCACTGCAGCCCAGCTTCTGTCCTTATACCCTAAGG  800

seq1  TCCCAGAAAGCGGAAAGGCAACTGTCCTCTCTATCAAAGCTGTCCCCACA  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGAAAGCGGAAAGGCAACTGTCCTCTCTATCAAAGCTGTCCCCACA  850

seq1  GAGCCCTGTCACTTGTGGCCTAAGTCAGAATGAGGAGAGTAGCAGGGGCC  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCCTGTCACTTGTGGCCTAAGTCAGAATGAGGAGAGTAGCAGGGGCC  900

seq1  ACCCACTTTCCAGCAATCCAATTCGAGACATGCCCTAGCCACACATGCAT  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCACTTTCCAGCAATCCAATTCGAGACATGCCCTAGCCACACATGCAT  950

seq1  CCTCAAACCAGTGAAAGAATGATAAAAACTTACGGACTGACCTCCCCTGG  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCAAACCAGTGAAAGAATGATAAAAACTTACGGACTGACCTCCCCTGG  1000

seq1  GGCCTGGGGCTGGATCTTGATGGCTGTTTCTGGGACGTGGGTGAAAGACC  1041
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTGGGGCTGGATCTTGATGGCTGTTTCTGGGACGTGGGTGAAAGACC  1050

seq1  ACCTGATTTGTATGTCCTCTCTCTTCTCTTCCATGTGGAATTC  1084
      |||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGATTTGTATGTCCTCTCTCTTCTCTTCCATGTGGAATTC  1093

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information