MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-201E16
Chromosome	16 (Build37)
Map Location	16,984,293 - 16,985,452
singlet/doublet	singlet
Overlap gene	Mapk1
Upstream gene	2310008H04Rik, LOC100043266, LOC224010, D16Ertd727e, Pkp2, EG433003, Yars2, Dnm1l, LOC665743, Fgd4, Olfr19, 4933404G15Rik, Spag6, EG665562, EG436405, Vpreb1, Top3b, Ppm1f, LOC100042783, EG623519
Downstream gene	Ypel1, Ppil2, 2610318N02Rik, Sdf2l1, LOC623568, Ccdc116, 1810015A11Rik, Ube2l3, Gm603, Hic2, D16Bwg1494e, Pik4ca, Serpind1, Snap29, Crkl, Aifm3, Lztr1, Thap7, 4930451C15Rik, P2rxl1, Slc7a4, Smpd4, Pcqap, EG433050, Map1lc3-ps8, EG665892, LOC100042830, Klhl22, Scarf2, Car15, Dgcr2, Tssk1, Tssk2, Es2el, Gscl, Slc25a1, Vpreb2
Link	Open Mouse BAC browser

Click to get alignment info.

name	2310008H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224008 MGI:1924834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043266 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 310 ESTs, 10 Proteins

name	LOC224010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:224010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	D16Ertd727e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623331 MGI:1289219
definition	note : DNA segment, Chr 16, ERATO Doi 727, expressed pseudo : _no_value

name	Pkp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67451 MGI:1914701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433003 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433003 MGI:3648103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 302 ESTs, 7 Proteins

name	Yars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70120 MGI:1917370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnm1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74006 MGI:1921256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC665743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Fgd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224014 MGI:2183747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Olfr19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18316 MGI:109316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933404G15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74066 MGI:1921316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Spag6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50525 MGI:1354388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665562 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665562 MGI:3645866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 661 ESTs, 7 Proteins

name	EG436405 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436405 MGI:3647546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Vpreb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22362 MGI:98936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Top3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21976 MGI:1333803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppm1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68606 MGI:1918464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042783 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042783
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG623519 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623519 MGI:3647845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins

name	Mapk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26413 MGI:1346858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ypel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106369 MGI:1913303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppil2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66053 MGI:2447857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610318N02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70458 MGI:1917708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdf2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64136 MGI:2149842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein

name	Ccdc116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76872 MGI:1924122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810015A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69101 MGI:1916351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22195 MGI:109240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm603 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239731 MGI:2685449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hic2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58180 MGI:1929869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D16Bwg1494e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224019 MGI:107238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 1 Protein

name	Pik4ca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224020 MGI:2448506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpind1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15160 MGI:96051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snap29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67474 MGI:1914724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12929 MGI:104686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aifm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72168 MGI:1919418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lztr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66863 MGI:1914113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thap7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69009 MGI:1916259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930451C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74685 MGI:1921935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rxl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18440 MGI:1337113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224022 MGI:2146512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77626 MGI:1924876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcqap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94112 MGI:2137379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG433050 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433050 MGI:3644695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 71 ESTs, 9 Proteins

name	Map1lc3-ps8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606511
definition	note : microtubule-associated protein 1 light chain 3 pseudogene copy 8 pseudo : _no_value

name	EG665892 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665892 MGI:3646992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins pseudo : _no_value

name	LOC100042830 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Klhl22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224023 MGI:1337995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scarf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224024 MGI:1858430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80733 MGI:1931324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgcr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13356 MGI:892866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22114 MGI:1347557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22115 MGI:1347559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Es2el (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27886 MGI:107854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gscl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195333 MGI:892006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 Proteins

name	Slc25a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13358 MGI:1345283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vpreb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22363 MGI:98937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310008H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801762 GeneID:224008 MGI:1924834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310008H04 gene transcript_id : NM_146068.3

name	LOC100043266 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267400 GeneID:100043266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 310 ESTs, 10 Proteins product : similar to cytochrome c transcript_id : XM_001480401.1

name	Pkp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349260 GeneID:67451 MGI:1914701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plakophilin 2 transcript_id : NM_026163.2

name	EG433003 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267402 GeneID:433003 MGI:3648103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 302 ESTs, 7 Proteins product : predicted gene, EG433003 transcript_id : XM_484529.5

name	Yars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930578 GeneID:70120 MGI:1917370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosyl-tRNA synthetase 2 (mitochondrial) transcript_id : NM_198246.1

name	Dnm1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061454 GeneID:74006 MGI:1921256
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin 1-like transcript_id : NM_001025947.1

name	Dnm1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061457 GeneID:74006 MGI:1921256
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynamin 1-like transcript_id : NM_152816.2

name	Fgd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367762 GeneID:224014 MGI:2183747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 4 transcript_id : NM_139232.2

name	Fgd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22296594 GeneID:224014 MGI:2183747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 4 transcript_id : NM_139233.1

name	Fgd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226238 GeneID:224014 MGI:2183747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 4 transcript_id : NM_139234.2

name	Olfr19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380644 GeneID:18316 MGI:109316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 19 transcript_id : NM_146335.1

name	Spag6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657606 GeneID:50525 MGI:1354388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 6 transcript_id : NM_015773.1

name	EG665562 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400069 GeneID:665562 MGI:3645866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 661 ESTs, 7 Proteins product : predicted gene, EG665562 transcript_id : XM_983910.1

name	Vpreb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850237 GeneID:22362 MGI:98936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B lymphocyte gene 1 transcript_id : NM_016982.1

name	Top3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981463 GeneID:21976 MGI:1333803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : topoisomerase (DNA) III beta transcript_id : NM_011624.2

name	Ppm1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802638 GeneID:68606 MGI:1918464
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1F (PP2C domain containing) transcript_id : NM_176833.3

name	EG623519 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400085 GeneID:623519 MGI:3647845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : predicted gene, EG623519 transcript_id : XM_979469.1

name	Mapk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579911 GeneID:26413 MGI:1346858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 1 transcript_id : NM_011949.3

name	Mapk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579908 GeneID:26413 MGI:1346858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 1 transcript_id : NM_001038663.1

name	Ypel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803381 GeneID:106369 MGI:1913303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yippee-like 1 (Drosophila) transcript_id : NM_023249.3

name	Ppil2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131059 GeneID:66053 MGI:2447857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase (cyclophilin)-like 2 transcript_id : NM_144954.2

name	2610318N02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274187 GeneID:70458 MGI:1917708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610318N02 gene transcript_id : NM_183287.2

name	Sdf2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982679 GeneID:64136 MGI:2149842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal cell-derived factor 2-like 1 transcript_id : NM_022324.2

name	LOC623568 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267406 GeneID:623568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein product : similar to ribosomal protein S20 transcript_id : XM_001480472.1

name	Ccdc116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037470 GeneID:76872 MGI:1924122
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 116 transcript_id : NM_029779.1

name	1810015A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356917 GeneID:69101 MGI:1916351
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810015A11 gene transcript_id : NM_026940.2

name	Ube2l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892277 GeneID:22195 MGI:109240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2L 3 transcript_id : NM_009456.2

name	Gm603 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345436 GeneID:239731 MGI:2685449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 603, (NCBI) transcript_id : NM_001033338.2

name	Hic2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887766 GeneID:58180 MGI:1929869
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypermethylated in cancer 2 transcript_id : NM_178922.3

name	D16Bwg1494e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267414 GeneID:224019 MGI:107238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 1 Protein product : DNA segment, Chr 16, Brigham & Women's Genetics 1494 expressed transcript_id : XM_358773.6

name	Pik4ca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233837 GeneID:224020 MGI:2448506
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 4-kinase, catalytic, alpha polypeptide transcript_id : NM_001001983.1

name	Serpind1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59709438 GeneID:15160 MGI:96051
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade D, member 1 transcript_id : NM_008223.2

name	Snap29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948567 GeneID:67474 MGI:1914724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptosomal-associated protein transcript_id : NM_023348.4

name	Crkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384797 GeneID:12929 MGI:104686
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-crk sarcoma virus CT10 oncogene homolog (avian)-like transcript_id : NM_007764.3

name	Aifm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778908 GeneID:72168 MGI:1919418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 3 transcript_id : NM_175178.3

name	Lztr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385564 GeneID:66863 MGI:1914113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-zipper-like transcriptional regulator, 1 transcript_id : NM_025808.3

name	Thap7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130285 GeneID:69009 MGI:1916259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THAP domain containing 7 transcript_id : NM_026909.2

name	4930451C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354867 GeneID:74685 MGI:1921935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930451C15 gene transcript_id : NM_029053.2

name	P2rxl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754965 GeneID:18440 MGI:1337113
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X-like 1, orphan receptor transcript_id : NM_011028.1

name	Slc7a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371084 GeneID:224022 MGI:2146512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 transcript_id : NM_144852.3

name	Smpd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376053 GeneID:77626 MGI:1924876
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase 4 transcript_id : NM_029945.2

name	Pcqap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817038 GeneID:94112 MGI:2137379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : positive cofactor 2, multiprotein complex, glutamine/Q-rich-associated protein transcript_id : NM_001040683.1

name	Pcqap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100816769 GeneID:94112 MGI:2137379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : positive cofactor 2, multiprotein complex, glutamine/Q-rich-associated protein transcript_id : NM_033609.2

name	EG433050 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400083 GeneID:433050 MGI:3644695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 71 ESTs, 9 Proteins product : predicted gene, EG433050 transcript_id : XM_484573.4

name	LOC100042830 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267284 GeneID:100042830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100042830 transcript_id : XM_001478907.1

name	Klhl22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802617 GeneID:224023 MGI:1337995
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 22 (Drosophila) transcript_id : NM_145479.3

name	Scarf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803416 GeneID:224024 MGI:1858430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scavenger receptor class F, member 2 transcript_id : NM_153790.2

name	Car15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981403 GeneID:80733 MGI:1931324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 15 transcript_id : NM_030558.2

name	Dgcr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816900 GeneID:13356 MGI:892866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DiGeorge syndrome critical region gene 2 transcript_id : NM_010048.2

name	Tssk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734850 GeneID:22114 MGI:1347557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 1 transcript_id : NM_009435.2

name	Tssk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734842 GeneID:22115 MGI:1347559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 2 transcript_id : NM_009436.2

name	Es2el (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362980 GeneID:27886 MGI:107854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence 2 embryonic lethal transcript_id : NM_001081633.1

name	Es2el (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362978 GeneID:27886 MGI:107854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence 2 embryonic lethal transcript_id : NM_022408.2

name	Gscl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267418 GeneID:195333 MGI:892006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 Proteins product : goosecoid-like transcript_id : XM_001480613.1

name	Slc25a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943837 GeneID:13358 MGI:1345283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 transcript_id : NM_153150.1

name	Vpreb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850239 GeneID:22363 MGI:98937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B lymphocyte gene 2 transcript_id : NM_016983.1

name	2310008H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541868 CCDS:CCDS27980.1 GeneID:224008 MGI:1924834
definition	codon_start : 1 product : hypothetical protein LOC224008 protein_id : NP_666180.2

name	LOC100043266 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267401 GeneID:100043266
definition	codon_start : 1 product : similar to cytochrome c protein_id : XP_001480451.1

name	Pkp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312960 CCDS:CCDS27981.1 GeneID:67451 MGI:1914701
definition	GO_component : GO:0005912 - adherens junction [Evidence IMP] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0007507 - heart development [Evidence IMP] codon_start : 1 product : plakophilin 2 protein_id : NP_080439.1

name	EG433003 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51829956 GeneID:433003 MGI:3648103
definition	codon_start : 1 product : similar to ribosomal protein L30 protein_id : XP_484529.1

name	Yars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930579 CCDS:CCDS27983.1 GeneID:70120 MGI:1917370
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004831 - tyrosine-tRNA ligase activity [Evidence ISS] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 product : tyrosyl-tRNA synthetase 2 (mitochondrial) protein_id : NP_937889.1

name	Dnm1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71061455 CCDS:CCDS27984.1 GeneID:74006 MGI:1921256
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : dynamin 1-like isoform b protein_id : NP_001021118.1

name	Dnm1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71061458 CCDS:CCDS27985.1 GeneID:74006 MGI:1921256
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : dynamin 1-like isoform a protein_id : NP_690029.2

name	Fgd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336047 CCDS:CCDS27986.1 GeneID:224014 MGI:2183747
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007257 - activation of JNK activity [Evidence ISS]; GO:0030032 - lamellipodium biogenesis [Evidence IDA]; GO:0030035 - microspike biogenesis [Evidence IDA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : isoform alpha is encoded by transcript variant alpha; frabin; Fgd1-related F-actin-binding protein product : FYVE, RhoGEF and PH domain containing 4 isoform alpha protein_id : NP_631978.1

name	Fgd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22296595 GeneID:224014 MGI:2183747
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007257 - activation of JNK activity [Evidence ISS]; GO:0030032 - lamellipodium biogenesis [Evidence IDA]; GO:0030035 - microspike biogenesis [Evidence IDA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : isoform beta is encoded by transcript variant beta; frabin; Fgd1-related F-actin-binding protein product : FYVE, RhoGEF and PH domain containing 4 isoform beta protein_id : NP_631979.1

name	Fgd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22296599 GeneID:224014 MGI:2183747
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence ISS] [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007257 - activation of JNK activity [Evidence ISS]; GO:0030032 - lamellipodium biogenesis [Evidence IDA]; GO:0030035 - microspike biogenesis [Evidence IDA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : isoform gamma is encoded by transcript variant gamma; frabin; Fgd1-related F-actin-binding protein product : FYVE, RhoGEF and PH domain containing 4 isoform gamma protein_id : NP_631980.1

name	Olfr19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380645 CCDS:CCDS27987.1 GeneID:18316 MGI:109316
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR140-1; GA_x54KRFPKG5P-13123979-13123050 product : olfactory receptor 19 protein_id : NP_666447.1

name	Spag6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657607 CCDS:CCDS27988.1 GeneID:50525 MGI:1354388
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0019861 - flagellum [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0030317 - sperm motility [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : axoneme protein; sperm-associated antigen 6 product : sperm associated antigen 6 protein_id : NP_056588.1

name	EG665562 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267404 GeneID:665562 MGI:3645866
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989004.2

name	Vpreb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850238 CCDS:CCDS27989.1 GeneID:22362 MGI:98936
definition	GO_component : GO:0005886 - plasma membrane [Evidence IPI] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IPI] GO_process : GO:0030097 - hemopoiesis [Evidence IMP]; GO:0006955 - immune response [Evidence IPI] codon_start : 1 product : pre-B lymphocyte gene 1 protein_id : NP_058678.1

name	Top3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755851 CCDS:CCDS27990.1 GeneID:21976 MGI:1333803
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000793 - condensed chromosome [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003916 - DNA topoisomerase activity [Evidence IEA]; GO:0003917 - DNA topoisomerase type I activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0007059 - chromosome segregation [Evidence IMP]; GO:0006304 - DNA modification [Evidence IEA]; GO:0006265 - DNA topological change [Evidence IEA]; GO:0006268 - DNA unwinding during replication [Evidence IEA] codon_start : 1 note : Topo III beta product : topoisomerase (DNA) III beta protein_id : NP_035754.1

name	Ppm1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849881 CCDS:CCDS27991.1 GeneID:68606 MGI:1918464
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : calcium/calmodulin-dependent protein kinase phosphatase; partner of PIX2 product : protein phosphatase 1F (PP2C domain containing) protein_id : NP_789803.1

name	EG623519 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400086 GeneID:623519 MGI:3647845
definition	codon_start : 1 product : similar to Ribosomal protein S27a protein_id : XP_984563.1

name	Mapk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579909 CCDS:CCDS27992.1 GeneID:26413 MGI:1346858
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0004707 - MAP kinase activity [Evidence IDA] [Evidence IMP] [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0001784 - phosphotyrosine binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0019858 - cytosine metabolism [Evidence IDA]; GO:0000165 - MAPKKK cascade [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0018105 - peptidyl-serine phosphorylation [Evidence ISS]; GO:0016310 - phosphorylation [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IDA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 product : mitogen activated protein kinase 1 protein_id : NP_001033752.1

name	Mapk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754632 CCDS:CCDS27992.1 GeneID:26413 MGI:1346858
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0004707 - MAP kinase activity [Evidence IDA] [Evidence IMP] [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0001784 - phosphotyrosine binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0019858 - cytosine metabolism [Evidence IDA]; GO:0000165 - MAPKKK cascade [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0018105 - peptidyl-serine phosphorylation [Evidence ISS]; GO:0016310 - phosphorylation [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IDA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 product : mitogen activated protein kinase 1 protein_id : NP_036079.1

name	Ypel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17865319 GeneID:106369 MGI:1913303
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : cardiac Abnormality/abnormal facies (CATCH22), microdeletion syndrome product : yippee-like 1 protein_id : NP_075738.1

name	Ppil2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30025020 CCDS:CCDS27993.1 GeneID:66053 MGI:2447857
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence IEA] codon_start : 1 product : peptidylprolyl isomerase-like 2 protein_id : NP_659203.1

name	2610318N02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274188 GeneID:70458 MGI:1917708
definition	codon_start : 1 product : hypothetical protein LOC70458 protein_id : NP_899110.2

name	Sdf2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612505 GeneID:64136 MGI:2149842
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : stromal cell-derived factor 2-like 1 protein_id : NP_071719.1

name	LOC623568 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267407 GeneID:623568
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480522.1

name	Ccdc116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037471 CCDS:CCDS27995.1 GeneID:76872 MGI:1924122
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 116 protein_id : NP_084055.1

name	1810015A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63003923 CCDS:CCDS27996.1 GeneID:69101 MGI:1916351
definition	codon_start : 1 product : hypothetical protein LOC69101 protein_id : NP_081216.1

name	Ube2l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678481 CCDS:CCDS27997.1 GeneID:22195 MGI:109240
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0019899 - enzyme binding [Evidence ISS]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence ISS] [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence ISS] [Evidence IEA] codon_start : 1 note : ubiquitin-conjugating enzyme 7 product : ubiquitin-conjugating enzyme E2L 3 protein_id : NP_033482.1

name	Gm603 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701828 CCDS:CCDS27998.1 GeneID:239731 MGI:2685449
definition	codon_start : 1 product : hypothetical protein LOC239731 protein_id : NP_001028510.1

name	Hic2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887767 CCDS:CCDS27999.1 GeneID:58180 MGI:1929869
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hypermethylated in cancer 2 protein_id : NP_849253.2

name	D16Bwg1494e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267415 GeneID:224019 MGI:107238
definition	codon_start : 1 product : hypothetical protein LOC224019 protein_id : XP_358773.3

name	Pik4ca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50233838 GeneID:224020 MGI:2448506
definition	GO_function : GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphatidylinositol 4-kinase, catalytic, alpha polypeptide protein_id : NP_001001983.1

name	Serpind1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59709439 CCDS:CCDS28000.1 GeneID:15160 MGI:96051
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : heparin cofactor II; HC II; serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1 product : serine (or cysteine) proteinase inhibitor, clade D, member 1 protein_id : NP_032249.2

name	Snap29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948568 CCDS:CCDS28001.1 GeneID:67474 MGI:1914724
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_function : GO:0019905 - syntaxin binding [Evidence ISS] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : GS32 protein protein_id : NP_075837.3

name	Crkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542421 CCDS:CCDS28002.1 GeneID:12929 MGI:104686
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : v-crk avian sarcoma virus CT10 oncogene homolog-like product : v-crk sarcoma virus CT10 oncogene homolog (avian)-like protein_id : NP_031790.2

name	Aifm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778909 CCDS:CCDS28003.1 GeneID:72168 MGI:1919418
definition	codon_start : 1 product : apoptosis-inducing factor like protein_id : NP_780387.2

name	Lztr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229001 GeneID:66863 MGI:1914113
definition	codon_start : 1 product : leucine-zipper-like transcription regulator 1 protein_id : NP_080084.2

name	Thap7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076919 CCDS:CCDS28004.1 GeneID:69009 MGI:1916259
definition	GO_component : GO:0005694 - chromosome [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : THAP domain containing 7 protein_id : NP_081185.1

name	4930451C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625989 CCDS:CCDS28006.1 GeneID:74685 MGI:1921935
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74685 protein_id : NP_083329.1

name	P2rxl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754966 CCDS:CCDS28007.1 GeneID:18440 MGI:1337113
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004931 - ATP-gated cation channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : purinergic receptor P2X-like 1, orphan receptor protein_id : NP_035158.1

name	Slc7a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67845995 CCDS:CCDS28008.1 GeneID:224022 MGI:2146512
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 protein_id : NP_659101.2

name	Smpd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229251 CCDS:CCDS28009.1 GeneID:77626 MGI:1924876
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : neutral membrane (neutral sphingomyelinase-3) product : sphingomyelin phosphodiesterase 4 protein_id : NP_084221.1

name	Pcqap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817039 GeneID:94112 MGI:2137379
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : positive cofactor 2, glutamine/Q-rich-associated protein isoform b protein_id : NP_001035773.1

name	Pcqap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100816770 GeneID:94112 MGI:2137379
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : positive cofactor 2, glutamine/Q-rich-associated protein isoform a protein_id : NP_291087.2

name	EG433050 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82958980 GeneID:433050 MGI:3644695
definition	codon_start : 1 product : similar to ribosomal protein L26 protein_id : XP_484573.2

name	LOC100042830 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267285 GeneID:100042830
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478957.1

name	Klhl22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981790 GeneID:224023 MGI:1337995
definition	codon_start : 1 exception : mismatches in translation note : kelch-like product : kelch-like 22 protein_id : NP_663454.2

name	Scarf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418901 CCDS:CCDS28010.1 GeneID:224024 MGI:1858430
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence IDA] codon_start : 1 note : scavenger receptor type F; scavenger receptor expressed by endothelial cells 2 (acetyl LDL receptor like); scavenger receptor class F, member 1 product : scavenger receptor class F, member 2 protein_id : NP_722485.1

name	Car15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385334 GeneID:80733 MGI:1931324
definition	GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : carbonic anhydrase-like sequence 2 product : carbonic anhydrase 15 protein_id : NP_085035.1

name	Dgcr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816901 GeneID:13356 MGI:892866
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : DiGeorge syndrome gene c product : DiGeorge syndrome protein C protein_id : NP_034178.2

name	Tssk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734851 CCDS:CCDS28011.1 GeneID:22114 MGI:1347557
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : testis-specific serine/threonine kinase; serine/threonine kinase 22A (spermiogenesis associated) product : testis-specific serine kinase 1 protein_id : NP_033461.2

name	Tssk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734843 CCDS:CCDS28012.1 GeneID:22115 MGI:1347559
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0007283 - spermatogenesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : testis specific serine/ threonine kinase 2; serine/threonine kinase 22B (spermiogenesis associated) product : testis-specific serine kinase 2 protein_id : NP_033462.2

name	Es2el (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126362981 GeneID:27886 MGI:107854
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007399 - nervous system development [Evidence IEP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DiGeorge syndrome critical region protein 14 isoform 2 protein_id : NP_001075102.1

name	Es2el (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126362979 CCDS:CCDS28013.1 GeneID:27886 MGI:107854
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007399 - nervous system development [Evidence IEP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DiGeorge syndrome critical region protein 14 isoform 1 protein_id : NP_071853.2

name	Gscl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267419 GeneID:195333 MGI:892006
definition	codon_start : 1 product : goosecoid-like protein_id : XP_001480663.1

name	Slc25a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943838 CCDS:CCDS28014.1 GeneID:13358 MGI:1345283
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : DiGeorge syndrome gene j; tricarboxylate transport protein product : solute carrier family 25, member 1 protein_id : NP_694790.1

name	Vpreb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850240 CCDS:CCDS28015.1 GeneID:22363 MGI:98937
definition	codon_start : 1 note : Lambda 5 product : pre-B lymphocyte gene 2 protein_id : NP_058679.1

name	LOC224010 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224010
definition	number : 1 pseudo : _no_value

name	EG436405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436405
definition	number : 1 pseudo : _no_value

name	LOC100042783 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042783
definition	number : 1 pseudo : _no_value

name	LOC100042783 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042783
definition	number : 2 pseudo : _no_value

name	LOC665743 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267283 GeneID:665743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to glyceraldehyde-3-phosphate-dehydrogenase pseudo : _no_value transcript_id : XR_033879.1

name	4933404G15Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149267405 GeneID:74066 MGI:1921316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4933404G15 gene transcript_id : XR_035436.1

name	EG665892 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94400090 GeneID:665892 MGI:3646992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins product : predicted gene, EG665892 pseudo : _no_value transcript_id : XR_001798.1

clone name	MSMg01-121I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089D23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477K13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J08
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-201E16.b	B6Ng01-201E16.g
ACC	GA022109	GA022110
length	949	1,140
definition	B6Ng01-201E16.b	B6Ng01-201E16.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaactgatgaataccaaatgactgagaagcacctgaaaaaatg ttcaacatccttaatcatcaaggaaatgcaaatcaaaacaacctgagatt ccacctcacaccagtcagaatggctaagatcaaaattcaggtgacatcag atgctggtgaggatgtagagaaagaggaacactcctccattgttagtggg attgcaagctggtacaaccactctggaaatcagtctggcggttcctcaga aaattagatctattgctacaggaagatcctgcaatacctctcctgtgcat atacccagaagatatcccaacttgtaatacggacacatactccactatgt tcataacagccttatttataatagccagaagctggaaagaacccagatat ccttcaacagaggattggatacagaaaatgtagtacatttacacagtgga gtactactcagctattaaaaacaatgaatttatgaaattcttaggcaaat ggatggatggatctggaggatattatcctgagtgaggtaacccaatcaca aaagaacacacatgatatgcactcactgataagtggatattagcccagaa acttagaatacctaagatacaatttgcaaaacacatgaaaatcaagaaga aggaagaccaaagtgtggatactttgttccttcttagaatgggaaacaaa atacccatggaaggagttacagagacaaagttcggagaagagcctgaagg aaggaccatccagagactgccccacttggggatccccaccataaactgtg ggaactaaaaggggctggggaaggagtggggagggaggatacctacgttc agccagattcctcctatgctctgggcaggcagatgcaggaggtctgccca gtgggcatcttatgtcactgaccccactcgagggaggggtacaggagca	gaattctgcacagcaagtggaaacttcaaaggtgaatagcaacaggatct aaataatccatcttctcagggtggtggggaatgtgtgagttcaactgaca gatcctaatttttttttgtccctacttaaaataatccccccttaaataaa tgagcctatagtgggtaatcatgagtgtcaataataagtgttactggcat atttaccagcaggtacagggtagtaatacatgcaagacaaatgtgatatg gaaagtactttttctccattcctcttttgacttgcaggtccagttcactt ttatcttcgtaattgtatactatgagacattttgctcataaaaatataac tattcatgagtcttttctttaaaaaaaaaaaaaaagaacgttaattattc tatcttgttagcacacttggtgaaaacacaccttttctggcatttctaaa attatgactattcaaattttaatgcatttctgaatagacttgttcatcag gaaaatatgccgaagtcctgagattattaaatcaaggagaggcctgtgca atagctcaagagctgaagcatttaaaacaggatctttctacagcaaagct tgattctagttcttcgccctgtaaaaggacttcctttcaataccttatct gaaaaaggctgtcttctctttcctcaagatagctaagttaaattaaacta tctcagagaccttcgataaatgaacttgttttagttaaaacaatacactt caacattccacatgcaggaaatcctgcaagtgatcgtgcaaaaactattc ttgaacactgaaacgttatggggaaacgatcacagtaatcgggctaaaac atatggatacattcacactgttaagagagtactcttgagggtaacgacgg gataatttaagtcaattaggactaactccaatacttcctaatattctaga gtgatgctggcttatcctttctgaaacacatcggtatatttaaatccatt ttgaaactcaggatttcaatatgttcacacacgctttgtcattacgttag cccgagcagaaagcatcattaagcgctactagatatttgtgatgctgtca cgttaccagagagaggaaaaatattttgggctcagacaca
quality values	Open. Hide. 58 29 19 32 58 58 58 31 20 44 58 58 62 47 54 62 47 52 62 62 54 39 37 62 62 62 62 49 62 62 62 47 44 47 46 38 56 56 44 43 62 62 59 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 54 51 62 62 54 62 62 62 62 62 54 43 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 49 56 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 56 62 62 62 62 62 62 54 62 62 62 62 62 52 62 62 62 52 62 62 62 62 54 52 62 62 62 62 62 47 42 47 47 45 54 62 62 62 52 62 47 62 54 46 52 58 58 49 52 58 40 52 54 58 58 54 54 58 52 58 52 52 54 54 54 54 58 58 58 54 48 58 58 58 54 54 54 52 58 58 58 58 58 42 53 53 42 54 54 58 54 48 58 54 33 58 58 52 52 54 35 52 52 52 54 52 54 58 42 58 52 42 35 39 50 46 58 58 49 49 50 33 47 42 50 50 52 41 53 39 58 49 40 58 43 42 45 58 51 47 33 58 58 25 38 50 41 48 42 50 50 50 58 51 52 35 58 51 32 50 58 50 52 32 46 51 46 52 41 20 58 50 37 50 40 39 37 58 51 21 54 47 26 53 28 35 50 34 49 50 39 25 58 41 39 26 53 35 17 54 34 50 32 37 23 39 51 16 32 37 39 58 32 54 54 50 35 31 38 35 34 18 36 42 28 24 24 54 52 49 32 52 32 21 38 53 54 45 39 40 53 35 44 54 49 32 32 33 42 39 54 54 39 30 54 47 46 32 42 52 54 54 27 47 46 20 31 31 18 32 40 54 54 33 27 23 54 40 44 22 39 33 32 23 14 40 24 23 30 12 32 32 24 9 6 23 22 10 13 29 6 19 10 18 18 13 15 13 15 28 31 14 15 13 32 34 32 36 31 28 22 26 27 13 16 22 11 24 20 18 9 13 17 24 10 6 10 18 25 23 12 15 13 28 20 30 36 9 12 7 31 20 13 7 23 7 9 13 31 6 7 13 33 31 26 19 19 12 18 14 25 21 8 8 15 13 6 25 7 23 14 17 6 25 7 8 5 6 6 21 9 7	Open. Hide. 62 47 56 47 62 62 54 47 62 59 62 59 43 44 43 36 46 50 62 46 62 56 62 59 62 62 59 56 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 49 49 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 50 62 59 44 62 62 62 56 62 62 62 62 62 62 62 47 62 62 62 62 62 62 56 62 54 56 62 56 62 62 62 62 56 62 56 56 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 52 54 62 62 62 62 52 62 62 49 62 62 52 47 62 62 62 62 47 49 52 62 62 62 62 52 62 58 52 52 54 54 49 54 54 39 42 46 40 54 54 52 52 52 54 58 58 54 46 46 58 54 35 58 48 54 47 58 49 58 52 58 47 54 58 54 54 50 54 54 54 52 54 58 54 54 58 58 58 58 52 52 54 52 54 58 42 52 58 58 58 49 54 54 58 54 46 58 58 58 58 50 50 49 50 53 50 45 45 51 58 37 58 58 50 58 37 42 51 53 46 50 50 52 41 52 47 42 58 40 46 58 58 50 58 46 54 58 51 51 40 58 50 50 50 50 49 50 50 50 50 49 46 50 53 37 51 51 50 58 46 49 52 50 51 49 50 54 58 46 42 54 30 49 51 38 54 53 39 53 53 53 53 58 25 39 58 42 52 28 52 37 54 33 53 50 52 53 41 51 19 53 53 40 58 41 52 50 40 58 39 50 40 32 49 54 45 49 40 34 54 24 28 34 28 16 28 42 33 42 32 38 39 37 40 52 39 38 31 52 54 52 32 54 54 27 32 35 54 38 32 54 54 35 32 42 45 47 40 41 24 40 54 37 37 45 33 37 31 42 47 40 33 27 37 33 42 53 35 37 29 47 53 54 53 31 29 28 33 53 35 28 35 32 31 40 28 24 32 26 31 42 31 32 53 53 53 51 32 34 33 35 32 40 24 33 40 31 21 30 21 31 30 33 34 51 31 31 33 31 33 27 30 51 51 46 26 32 51 32 27 19 31 39 31 21 31 25 32 39 26 30 30 30 25 48 42 31 37 31 46 46 30 28 23 31 28 28 37 30 28 31 16 23 11 22 16 31 24 32 16 31 24 37 26 29 30 27 17 42 14 24 14 27 21 30 38 36 14 32 19 16 13 39 32 27 23 32 22 30 34 25 27 46 14 35 24 10 29 25 41 18 28 19 7 17 42 22 44 25 29 19 25 14 30 29 31 26 33 20 14 21 27 19 5 10 13 18 22 34 14 17 24 8 5 9 23 6 13 34 21 19 19 34 24 21 32 32 17 32 27 31 20 30 27 33 27 27 21 32 29 33 48 17 25 22 19 29 37 15 15 11 25 20 8 20 14 25 7 15 10 9 19 37 28 13 43 14 21 17 20 24 27 29 30 10 6 15 27 22 6 5 3 10 7 9 27 13 40 15 24 22 10 10 6 6 6 4 7 30 10 11 5 5 3 3 8 6 6 6 5 10 16 10 7 8 15 25 11 25 6 6 28 6 22 30 13 11 9 18 6 6 10 25 28 19 13 21 5 10 17 10 16 21 9 8 16 6 3 9 10 7 6 7 5 4 14 5 8 5 28 15 7 8 7 14 7 16 15 16 7 19 7 3 6 8 11 8 9 25 13 4 4 3 2 3 3 12 5 5 13 23 30 22 18 7 4 1 19 25 17 10 17 5 1 3 3 8 4 1 5 9 4 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_16984293_16985452
seq2: B6Ng01-201E16.g_69_1208 (reverse)

seq1  TGTGTGCTGAGCACCAAAATATTTTTCTTCTCTTCTGTGTACGTGAACAG  50
      ||||| |||||| |||||||||||||| |||| ||||   ||||| ||||
seq2  TGTGT-CTGAGC-CCAAAATATTTTTCCTCTC-TCTGGTAACGTG-ACAG  46

seq1  CATTCACAAAATATCTTAAGTAGCGC-TAATGATGCTTTCTGCCTCGGGC  99
      || |||| ||||||||  |||||||| ||||||||||||||| |||||||
seq2  CA-TCAC-AAATATCT--AGTAGCGCTTAATGATGCTTTCTG-CTCGGGC  91

seq1  TTAACCGTTAATGACACAGCGTTGGTTGTGGACATATTGAAATCTTGAAG  149
       ||||   |||||||| |||||    |||| ||||||||||||| || ||
seq2  -TAAC--GTAATGACAAAGCGT---GTGTGAACATATTGAAATCCTG-AG  134

seq1  TTTCAAAATGGATTTAAATATACCGATTGTGTTTCAGAAAGGATAAGCCA  199
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  TTTCAAAATGGATTTAAATATACCGA-TGTGTTTCAGAAAGGATAAGCCA  183

seq1  GCATCACTCTAGAATTATTAAGAAGTATTTGGAGTTAGTCCTAATTTGAC  249
      |||||||||||||| ||||| |||||| |||||||||||||||| |||||
seq2  GCATCACTCTAGAA-TATTAGGAAGTA-TTGGAGTTAGTCCTAA-TTGAC  230

seq1  TTTAAATTATCCCGTCGTTACCCTCAAGAGTACTCTCTTAACAGTGTGAA  299
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  -TTAAATTATCCCGTCGTTACCCTCAAGAGTACTCTCTTAACAGTGTGAA  279

seq1  TGTATCCATATGTTTTAGCCCGATTACTGTGATCGTTTCCCCATAACGTT  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATCCATATGTTTTAGCCCGATTACTGTGATCGTTTCCCCATAACGTT  329

seq1  TCAGTGTTCAAGAATAGTTTTTGCACGATCACTTGCAGGATTTCCTGCAT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTGTTCAAGAATAGTTTTTGCACGATCACTTGCAGGATTTCCTGCAT  379

seq1  GTGGAATGTTGAAGTGTATTGTTTTAACTAAAACAAGTTCATTTATCGAA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAATGTTGAAGTGTATTGTTTTAACTAAAACAAGTTCATTTATCGAA  429

seq1  GGTCTCTGAGATAGTTTAATTTAACTTAGCTATCTTGAGGAAAGAGAAGA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTCTGAGATAGTTTAATTTAACTTAGCTATCTTGAGGAAAGAGAAGA  479

seq1  CAGCCTTTTTCAGATAAGGTATTGAAAGGAAGTCCTTTTACAGGGCGAAG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCTTTTTCAGATAAGGTATTGAAAGGAAGTCCTTTTACAGGGCGAAG  529

seq1  AACTAGAATCAAGCTTTGCTGTAGAAAGATCCTGTTTTAAATGCTTCAGC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTAGAATCAAGCTTTGCTGTAGAAAGATCCTGTTTTAAATGCTTCAGC  579

seq1  TCTTGAGCTATTGCACAGGCCTCTCCTTGATTTAATAATCTCAGGACTTC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGAGCTATTGCACAGGCCTCTCCTTGATTTAATAATCTCAGGACTTC  629

seq1  GGCATATTTTCCTGATGAACAAGTCTATTCAGAAATGCATTAAAATTTGA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATATTTTCCTGATGAACAAGTCTATTCAGAAATGCATTAAAATTTGA  679

seq1  ATAGTCATAATTTTAGAAATGCCAGAAAAGGTGTGTTTTCACCAAGTGTG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTCATAATTTTAGAAATGCCAGAAAAGGTGTGTTTTCACCAAGTGTG  729

seq1  CTAACAAGATAGAATAATTAACGTTCTTTTTTTTTTTTTTTAAAGAAAAG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAACAAGATAGAATAATTAACGTTCTTTTTTTTTTTTTTTAAAGAAAAG  779

seq1  ACTCATGAATAGTTATATTTTTATGAGCAAAATGTCTCATAGTATACAAT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCATGAATAGTTATATTTTTATGAGCAAAATGTCTCATAGTATACAAT  829

seq1  TACGAAGATAAAAGTGAACTGGACCTGCAAGTCAAAAGAGGAATGGAGAA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACGAAGATAAAAGTGAACTGGACCTGCAAGTCAAAAGAGGAATGGAGAA  879

seq1  AAAGTACTTTCCATATCACATTTGTCTTGCATGTATTACTACCCTGTACC  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTACTTTCCATATCACATTTGTCTTGCATGTATTACTACCCTGTACC  929

seq1  TGCTGGTAAATATGCCAGTAACACTTATTATTGACACTCATGATTACCCA  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGGTAAATATGCCAGTAACACTTATTATTGACACTCATGATTACCCA  979

seq1  CTATAGGCTCATTTATTTAAGGGGGGATTATTTTAAGTAGGGACAAAAAA  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATAGGCTCATTTATTTAAGGGGGGATTATTTTAAGTAGGGACAAAAAA  1029

seq1  AAATTAGGATCTGTCAGTTGAACTCACACATTCCCCACCACCCTGAGAAG  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTAGGATCTGTCAGTTGAACTCACACATTCCCCACCACCCTGAGAAG  1079

seq1  ATGGATTATTTAGATCCTGTTGCTATTCACCTTTGAAGTTTCCACTTGCT  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGATTATTTAGATCCTGTTGCTATTCACCTTTGAAGTTTCCACTTGCT  1129

seq1  GTGCAGAATTC  1160
      |||||||||||
seq2  GTGCAGAATTC  1140

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information