MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-209M10
Chromosome	16 (Build37)
Map Location	23,540,145 - 23,541,243
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Dgkg, LOC666459, Crygs, Tbccd1, Dnajb11, Ahsg, Fetub, Hrg, Kng2, LOC624311, LOC666486, LOC666489, Kng1, LOC666493, Eif4a2, Rfc4, Adipoq, LOC100043541, EG625835, BC106179, St6gal1, Rtp1, Masp1, LOC100043018
Downstream gene	Rtp4, EG625969, LOC100043023, Sst, Rtp2, Bcl6, EG433009, LOC666580, LOC100043564, 1110054M08Rik, Lpp, A730098P11Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dgkg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110197 MGI:105060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666459 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666459
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Crygs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12970 MGI:1298216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbccd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70573 MGI:1917823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 86 ESTs, 3 Proteins

name	Dnajb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67838 MGI:1915088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahsg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11625 MGI:107189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fetub (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59083 MGI:1890221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Hrg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94175 MGI:2146636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385643 MGI:3027157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624311 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 114 ESTs, 10 Proteins pseudo : _no_value

name	LOC666486 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666489 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	Kng1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16644 MGI:1097705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666493 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Eif4a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13682 MGI:106906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106344 MGI:2146571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adipoq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11450 MGI:106675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043541 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG625835 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625835 MGI:3644672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	BC106179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320099 MGI:3702726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	St6gal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20440 MGI:108470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239766 MGI:2685450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Masp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17174 MGI:88492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043018 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rtp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67775 MGI:1915025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625969 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625969 MGI:3646353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	LOC100043023 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Sst (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20604 MGI:98326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224055 MGI:2685451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12053 MGI:107187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433009 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433009 MGI:3648100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC666580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100043564 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs

name	1110054M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68841 MGI:1916091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs

name	Lpp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210126 MGI:2441849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A730098P11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624582 MGI:3612158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1021 ESTs, 3 Proteins

name	Dgkg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149723 GeneID:110197 MGI:105060
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase, gamma transcript_id : NM_138650.1

name	Crygs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753531 GeneID:12970 MGI:1298216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, gamma S transcript_id : NM_009967.1

name	Tbccd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267487 GeneID:70573 MGI:1917823
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 86 ESTs, 3 Proteins product : TBCC domain containing 1 transcript_id : XM_001480852.1

name	Dnajb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376452 GeneID:67838 MGI:1915088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 11 transcript_id : NM_026400.4

name	Ahsg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304874 GeneID:11625 MGI:107189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha-2-HS-glycoprotein transcript_id : NM_013465.1

name	Fetub (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226226 GeneID:59083 MGI:1890221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fetuin beta transcript_id : NM_001083905.1

name	Fetub (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226246 GeneID:59083 MGI:1890221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fetuin beta transcript_id : NM_021564.2

name	Fetub (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226208 GeneID:59083 MGI:1890221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fetuin beta transcript_id : NM_001083904.1

name	Hrg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716460 GeneID:94175 MGI:2146636
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidine-rich glycoprotein transcript_id : NM_053176.1

name	Kng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235783 GeneID:385643 MGI:3027157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kininogen 2 transcript_id : NM_201375.1

name	Kng1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981262 GeneID:16644 MGI:1097705
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kininogen 1 transcript_id : NM_023125.2

name	Eif4a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305018 GeneID:13682 MGI:106906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4A2 transcript_id : NM_013506.1

name	Rfc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703947 GeneID:106344 MGI:2146571
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : replication factor C (activator 1) 4 transcript_id : NM_145480.1

name	Adipoq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87252710 GeneID:11450 MGI:106675
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adiponectin, C1Q and collagen domain containing transcript_id : NM_009605.4

name	LOC100043541 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267496 GeneID:100043541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043541 transcript_id : XM_001480894.1

name	EG625835 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82959201 GeneID:625835 MGI:3644672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG625835 transcript_id : XM_890398.1

name	St6gal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62461607 GeneID:20440 MGI:108470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta galactoside alpha 2,6 sialyltransferase 1 transcript_id : NM_145933.3

name	Rtp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366216 GeneID:239766 MGI:2685450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor transporter protein 1 transcript_id : NM_001004151.2

name	Masp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678809 GeneID:17174 MGI:88492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannan-binding lectin serine peptidase 1 transcript_id : NM_008555.1

name	LOC100043018 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267303 GeneID:100043018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043018 transcript_id : XM_001479344.1

name	Rtp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381067 GeneID:67775 MGI:1915025
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor transporter protein 4 transcript_id : NM_023386.4

name	Sst (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678034 GeneID:20604 MGI:98326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : somatostatin transcript_id : NM_009215.1

name	Rtp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131119 GeneID:224055 MGI:2685451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor transporter protein 2 transcript_id : NM_001008230.3

name	Bcl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360700 GeneID:12053 MGI:107187
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 6 transcript_id : NM_009744.3

name	EG433009 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400126 GeneID:433009 MGI:3648100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG433009 transcript_id : XM_488772.3

name	LOC100043564 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267504 GeneID:100043564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs product : similar to BMP2 inducible kinase transcript_id : XM_001480904.1

name	1110054M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267306 GeneID:68841 MGI:1916091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs product : RIKEN cDNA 1110054M08 gene transcript_id : XM_001479385.1

name	Lpp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382930 GeneID:210126 MGI:2441849
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain containing preferred translocation partner in lipoma transcript_id : NM_178665.4

name	A730098P11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267506 GeneID:624582 MGI:3612158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1021 ESTs, 3 Proteins product : RIKEN cDNA A730098P11 gene, transcript variant 1 transcript_id : XM_893769.3

name	Dgkg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149724 CCDS:CCDS28068.1 GeneID:110197 MGI:105060
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 note : diacylglycerol kinase, gamma 3; diacylglycerol kinase, gamma 90kDa product : diacylglycerol kinase, gamma protein_id : NP_619591.1

name	Crygs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753532 CCDS:CCDS28069.1 GeneID:12970 MGI:1298216
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence IMP] [Evidence IEA] GO_process : GO:0002009 - morphogenesis of an epithelium [Evidence IMP]; GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 note : opacity due to poor secondary fiber cell junction; recessive nuclear cataract product : crystallin, gamma S protein_id : NP_034097.1

name	Tbccd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267488 GeneID:70573 MGI:1917823
definition	codon_start : 1 product : TBCC domain containing 1 protein_id : XP_001480902.1

name	Dnajb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625998 CCDS:CCDS28070.1 GeneID:67838 MGI:1915088
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0051082 - unfolded protein binding [Evidence IDA] GO_process : GO:0006381 - mRNA editing [Evidence ISS] [Evidence IDA] codon_start : 1 product : DnaJ (Hsp40) homolog, subfamily B, member 11 protein_id : NP_080676.3

name	Ahsg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304875 CCDS:CCDS28071.1 GeneID:11625 MGI:107189
definition	GO_component : GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0019210 - kinase inhibitor activity [Evidence ISS] GO_process : GO:0006953 - acute-phase response [Evidence ISS]; GO:0030502 - negative regulation of bone mineralization [Evidence IDA]; GO:0046627 - negative regulation of insulin receptor signaling pathway [Evidence ISS]; GO:0001503 - ossification [Evidence IDA]; GO:0006907 - pinocytosis [Evidence ISS]; GO:0050766 - positive regulation of phagocytosis [Evidence ISS]; GO:0050727 - regulation of inflammatory response [Evidence ISS] codon_start : 1 product : alpha-2-HS-glycoprotein protein_id : NP_038493.1

name	Fetub (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947006 GeneID:59083 MGI:1890221
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : fetuin beta isoform 1 protein_id : NP_067539.1

name	Fetub (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226227 GeneID:59083 MGI:1890221
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : fetuin beta isoform 3 protein_id : NP_001077374.1

name	Fetub (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226209 GeneID:59083 MGI:1890221
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : fetuin beta isoform 2 protein_id : NP_001077373.1

name	Hrg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716461 GeneID:94175 MGI:2146636
definition	codon_start : 1 exception : mismatches in translation product : histidine-rich glycoprotein protein_id : NP_444406.1

name	Kng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235784 CCDS:CCDS28072.1 GeneID:385643 MGI:3027157
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA] codon_start : 1 note : Kininogen-II; kininogen II product : kininogen 2 protein_id : NP_958763.1

name	Kng1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963497 CCDS:CCDS28073.1 GeneID:16644 MGI:1097705
definition	GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0050880 - regulation of blood vessel size [Evidence IEA]; GO:0042311 - vasodilation [Evidence IEA] codon_start : 1 note : H-kininigen; L-kininogen product : kininogen 1 protein_id : NP_075614.1

name	Eif4a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305019 CCDS:CCDS28074.1 GeneID:13682 MGI:106906
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : eukaryotic translation initiation factor 4A2 protein_id : NP_038534.1

name	Rfc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703948 GeneID:106344 MGI:2146571
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] codon_start : 1 product : replication factor C (activator 1) 4 protein_id : NP_663455.1

name	Adipoq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87252711 CCDS:CCDS28075.1 GeneID:11450 MGI:106675
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005179 - hormone activity [Evidence IDA] [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0006635 - fatty acid beta-oxidation [Evidence IMP]; GO:0019395 - fatty acid oxidation [Evidence IDA]; GO:0042593 - glucose homeostasis [Evidence IDA] [Evidence IMP]; GO:0006006 - glucose metabolism [Evidence IDA] [Evidence IMP]; GO:0045721 - negative regulation of gluconeogenesis [Evidence IDA]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0045923 - positive regulation of fatty acid metabolism [Evidence IMP]; GO:0046326 - positive regulation of glucose import [Evidence IDA]; GO:0043123 - positive regulation of I-kappaB kinase/NF-kappaB cascade [Evidence IDA]; GO:0009967 - positive regulation of signal transduction [Evidence IDA]; GO:0051260 - protein homooligomerization [Evidence IDA]; GO:0009749 - response to glucose stimulus [Evidence IMP] [Evidence IDA] codon_start : 1 note : adipocyte, C1Q and collagen domain containing (MGD\|MGI:106675 GB\|NM_009605, evidence: BLASTN, 99%, match=1156); putative; adipocyte complement related protein product : adiponectin, C1Q and collagen domain containing protein_id : NP_033735.3

name	LOC100043541 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267497 GeneID:100043541
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480944.1

name	EG625835 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82959202 GeneID:625835 MGI:3644672
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_895491.1

name	St6gal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122355 CCDS:CCDS28077.1 GeneID:20440 MGI:108470
definition	EC_number : 2.4.99.1 GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003835 - beta-galactoside alpha-2,6-sialyltransferase activity [Evidence IEA]; GO:0008373 - sialyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : beta galactoside alpha 2,6 sialyltransferase 1 protein_id : NP_666045.1

name	Rtp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921305 CCDS:CCDS28078.1 GeneID:239766 MGI:2685450
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : receptor transporting protein 1 protein_id : NP_001004151.1

name	Masp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678810 GeneID:17174 MGI:88492
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : activation of C4 and C2 components of complement; bactericidal product : mannan-binding lectin serine protease 1 protein_id : NP_032581.1

name	LOC100043018 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267304 GeneID:100043018
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479394.1

name	Rtp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981001 CCDS:CCDS28079.1 GeneID:67775 MGI:1915025
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 28kD interferon alpha responsive protein product : receptor transporting protein 4 protein_id : NP_075875.2

name	Sst (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678035 CCDS:CCDS28080.1 GeneID:20604 MGI:98326
definition	GO_process : GO:0030334 - regulation of cell migration [Evidence IDA] codon_start : 1 note : preprosomatostatin product : somatostatin protein_id : NP_033241.1

name	Rtp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606144 CCDS:CCDS28081.1 GeneID:224055 MGI:2685451
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : receptor transporting protein 2 protein_id : NP_001008231.1

name	Bcl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753172 CCDS:CCDS28082.1 GeneID:12053 MGI:107187
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0002467 - germinal center formation [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : B-cell leukemia/lymphoma 5 product : B-cell leukemia/lymphoma 6 protein_id : NP_033874.1

name	EG433009 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51829997 GeneID:433009 MGI:3648100
definition	codon_start : 1 product : hypothetical protein protein_id : XP_488772.1

name	LOC100043564 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267505 GeneID:100043564
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480954.1

name	1110054M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267307 GeneID:68841 MGI:1916091
definition	codon_start : 1 product : hypothetical protein LOC68841 protein_id : XP_001479435.1

name	A730098P11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82959128 GeneID:624582 MGI:3612158
definition	codon_start : 1 product : similar to HSPC008 isoform 1 protein_id : XP_898862.1

name	LOC666459 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666459
definition	number : 1 pseudo : _no_value

name	LOC666486 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666486
definition	number : 1 pseudo : _no_value

name	LOC666493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666493
definition	number : 1 pseudo : _no_value

name	LOC666493 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666493
definition	number : 2 pseudo : _no_value

name	LOC100043023 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043023
definition	number : 1 pseudo : _no_value

name	LOC100043023 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043023
definition	number : 2 pseudo : _no_value

name	LOC100043023 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043023
definition	number : 3 pseudo : _no_value

name	LOC666580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666580
definition	number : 2 pseudo : _no_value

name	LOC666580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666580
definition	number : 1 pseudo : _no_value

name	LOC624311 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267494 GeneID:624311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 114 ESTs, 10 Proteins product : similar to transportin 1 pseudo : _no_value transcript_id : XR_034881.1

name	LOC666489 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267301 GeneID:666489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to ribosomal protein S3 pseudo : _no_value transcript_id : XR_034145.1

name	BC106179 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149267302 GeneID:320099 MGI:3702726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : cDNA sequence BC106179 transcript_id : XR_035414.1

name	EG625969 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94400122 GeneID:625969 MGI:3646353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : predicted gene, EG625969 pseudo : _no_value transcript_id : XR_001887.1

clone name	MSMg01-116M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370P08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-352D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145D18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-185P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344N24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-209M10.b	B6Ng01-209M10.g
ACC	GA028308	GA028309
length	957	1,122
definition	B6Ng01-209M10.b	B6Ng01-209M10.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctttgtttagctctgtaccccattttttttccattttttattagg tatttagctcatttacatttccaatgctataccaaaagtcccccatagcc accaaccccactcccctacccacccactcccctacccacccactcccctt ttttggccctggcgttcccctgtactggggcatataaagtttgcgtgtcc aatgggcctctctttccagggatggccgcctaggccatcttttgatacat atgcagctagagtcaagagctccagggtactggttacttcataatgttgt tccacctatagggttgcagatccctttagcttcttgggtactttctctag ctccttcattgggggccatgtgatccatccaatagccgactgtgagcatc tacttctatgtttgctaggcccaggcatactctgacaagagacagctaca tcagggtcctttcagcataatcttgctagtgtatgcaatggtgtcagcat ttggaagctgattatgggatggatccccggatatggcagtctctacatgg tccatctttttatctcagctccaaactttgtacctccttccaagggtgtt ttgttcccacttctaaggaggggcatagtgtccacacttcagtcttcatt tttcttgagtttcatgtgtttaggaaattgtatcttatatctttggatat cctaggtttggggctaatatccacttatcagtgagtacatattgtgtgag ttcctttgttgaatgtgttacctcactcaggatgatgccctccaggtcca tccatttggctaggaattttcataaatcattcttttaatagctgagtaag tactccatttgtgtagatgtaccacatttttctgtatccattcctctgtt gaggggcattctgggttccttcccagcttcttggcctattataaataagg ctgccta	gaattcagctctaatatttgataataattcaagggaggaactataattta gacttgggacttatcgtaaaaatctataccagtttctacattctgatgtt ccagaaacacttctcaacctttgacagccgactcccaggttccttttggt cctcctgtcttttctgccagaagccctgggactaactaggtgaagacgtc ctccttagaactttgacaagagactcaagatcccaaccccttctggttgt ttagtgggtgcttgacttatcaaaacgtgtgtgcttcggatgactaggca agatccctcccaactctgatacaatctctgccaatacatgcttatgttag acaagagattcggggaaagcagatggtgaggtcttttctcagatgttcta tggacatcacctgagtctgaagagtggtcacagtcctcatccttcagaat aattggagcattttatgtagcttgcctaggtttctttcttaaatctataa taaaggagtttgattagtcctcagcctactatttggcaccgtataaaggt aatggatacttactggtgtcttataagtatcacaggattctacacaaact gtaatcaaaacattttataccaaacaatgaaaaaacaattccaccaaaat aactttttttttataccaacttagagtttggaacagatattattttataa agtaggatttgtttctgagtatgttttggtcttcaattaaattcctttta aactcaggctccatggttacaatagctccaaaattagtaattaataaaac attagttacactggtgggtaatggctttatttaaaataagatgaagtgtt aactcagtgtctcccagggactaagtaaatgtctttacactgctatccag aggccacagccattaactagaactcattagcttgctggctgagataacat agaaacactttacgtttttctgtaggactttccccttgctattatgtctg gagccctcaccatttcctctgaggatcctttgggtatggctcctttactt gtcagaggaaacttaagaatcaaagaacggttgtttggcctttaattccc cagccactctcacaggaaataa
quality values	Open. Hide. 53 42 24 24 54 42 41 46 58 34 54 48 31 27 39 52 62 62 43 49 62 56 54 62 62 47 47 62 62 62 49 56 50 50 38 51 51 20 56 56 62 56 46 35 59 62 62 59 59 59 62 62 59 62 59 59 59 62 54 62 59 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 59 59 59 51 59 59 40 48 59 59 56 56 59 62 62 62 62 62 62 62 56 59 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 54 54 54 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 56 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 59 62 62 62 59 62 62 51 59 59 56 59 51 56 59 59 59 59 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 59 62 62 62 59 62 59 59 62 59 62 59 62 62 62 62 62 62 62 62 59 59 59 56 59 56 59 56 59 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 48 56 50 56 62 62 59 62 62 59 59 56 56 56 62 62 62 62 62 59 59 51 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 59 59 59 62 62 56 56 56 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 51 62 62 59 62 62 62 62 59 62 62 56 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 59 59 62 59 62 62 59 62 62 62 62 62 59 50 34 38 50 50 51 51 62 62 62 62 62 59 62 59 59 59 59 59 44 38 50 44 50 59 43 59 62 62 59 62 59 59 62 62 62 62 62 54 56 38 56 47 56 56 56 56 62 62 62 62 44 62 62 62 62 62 56 56 56 56 44 44 47 51 62 62 56 62 62 62 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 56 62 62 62 56 56 46 32 36 56 38 46 62 62 47 39 56 39 56 56 62 62 56 56 62 56 62 62 56 46 56 47 62 62 62 42 52 54 52 41 52 41 46 54 52 43 34 52 52 62 54 34 62 52 52 42 52 43 52 52 38 43 52 52 52 52 54 52 52 46 52 52 52 54 52 9 23 9 12 13 16 54 40 40 39 38 33 49 54 58 43 58 37 35 41 14 48 49 24 45 52 48 52 47 52 54 36 22 54 42 58 42 46 47 42 52 54 52 50 50 50 52 58 45 32 34 52 40 58 58 58 54 54 52 54 49 54 23 54 54 52 46 42 40 58 42 58 53 52 58 46 52 49 58 47 42 46 47 54 33 42 40 53 51 42 50 41 46 53 42 25 51 13 26 9 48 31 39 42 52 51 32 51 9 39 50 50 39 41 26 41 51 37 52 31 44 32 39 41 50 50 50 46 39 42 51 36 53 40 28 32 41 53 39 39 34 39 27 53 53 30 51 58 37 39 22 52 53 35 44 20 39 53 23 28 41 33 6 7 17 33 42 35 58 17 46 20 50 31 42 58 50 41 32 53 28 31 33 12 42 32 14 40 53 30 21 12 50 41 34 25 39 35 45 38 26 37 37 26 42 36 30 19 53 40 51 38 49 25 30 35 17 53 34 33 19 54 25 19 31 26 27 30 51 30 33 25 29 28 29 25 8 49 45 32 20 16 30 44 31 35 32 29 53 22 26 9 28 22 31 17 19 37 40 53 17 7 45 26 32 13 53 21 34 26 53 35 33 19 14 14 28 26 24 15 15 40 53 52 29 34 31 53 16 32 28 34 33 10 12 44 21 25 17 31 31 45 15 14 20 25 10 51 51 33 13 26 16 11 18 27 24 30 21 21 40 40 32 19 33 32 32 10 12 25 25 15 22 12 7 12 24 31 9 15 9 6 28 18 11 17 31 38 31 38 29 32 27 36 11 33 12 9 17 22 21	Open. Hide. 62 47 56 47 56 47 37 42 47 62 62 56 26 33 38 21 18 27 24 24 28 42 51 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 59 62 62 62 59 62 62 54 62 59 59 62 62 62 62 62 62 62 59 49 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 51 62 62 62 62 62 54 54 62 62 62 62 62 59 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 56 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 62 56 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 56 54 62 62 56 62 56 50 62 56 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 51 62 62 56 62 62 54 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 56 62 62 62 56 62 54 62 56 62 62 62 62 62 62 62 62 62 62 47 42 62 62 62 62 62 42 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 49 62 62 62 62 62 54 53 52 62 58 41 54 44 54 54 58 58 58 58 58 54 49 58 29 18 10 17 17 16 58 58 58 42 32 58 58 58 58 58 45 41 52 54 58 53 54 58 58 58 58 52 58 54 54 52 45 54 50 54 58 54 41 42 52 52 52 46 42 47 54 42 39 58 58 52 58 54 39 58 42 54 52 58 58 49 25 54 58 52 58 32 58 58 58 41 50 38 58 58 49 51 52 39 53 53 30 58 58 51 52 51 54 58 51 54 49 54 58 51 53 51 42 46 48 54 47 46 41 22 15 58 58 58 50 51 50 53 58 58 58 58 58 58 58 58 39 35 52 42 54 50 33 51 50 54 51 32 21 44 42 50 52 52 54 15 48 51 49 50 50 45 34 42 24 51 35 32 50 50 38 53 52 39 52 49 50 29 53 26 58 41 28 32 46 26 27 58 51 58 46 52 58 19 32 50 35 51 24 52 51 26 51 32 29 53 33 32 39 35 49 42 42 53 54 37 38 37 29 40 34 54 49 40 33 52 33 41 35 35 33 26 51 34 41 25 53 40 32 33 44 10 7 14 47 16 27 38 51 26 41 49 53 53 39 54 54 33 51 32 53 41 37 31 18 8 8 33 32 29 33 54 54 49 37 30 52 41 53 31 37 37 22 41 16 45 34 35 37 37 54 36 42 21 37 52 26 39 32 24 32 52 32 20 29 28 14 7 21 32 53 40 32 17 9 32 23 32 28 31 24 33 52 27 32 29 19 25 52 28 20 31 14 19 6 47 23 30 53 32 21 15 45 9 27 28 12 12 27 13 9 12 45 51 31 33 17 37 31 40 11 14 32 20 32 31 42 31 35 25 33 46 19 24 26 46 12 29 23 32 20 37 25 26 33 36 17 27 12 13 11 30 17 10 13 24 32 15 28 24 19 33 33 30 29 33 22 6 22 15 24 27 29 25 37 25 16 8 33 18 17 9 14 19 31 27 30 37 39 6 8 25 30 14 36 37 20 18 9 21 31 41 41 25 30 9 33 14 19 5 8 20 9 31 46 10 9 46 46 28 6 32 31 31 27 33 31 21 27 31 37 27 42 21 32 11 21 10 30 38 10 14 20 16 6 5 13 8 31 14 37 28 16 25 23 31 29 21 11 31 9 16 8 9 22 18 10 41 9 4 4 8 4 4 9 16 15 19 24 31 33 10 4 5 5 31 9 9 11 14 17 5 9 14 32 10 11 6 7 10 34 11 32 33 11 11 5 43 9 8 9 30 22 10 10 48 22 23 22 29 21 9 20 12 7 27 40 7 7 17 6 14 7 27 30 8 9 6 4 9 8 16 15 8 9 10 7 8 8 7 21 8 28 24 10 13 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_23540145_23541243
seq2: B6Ng01-209M10.g_71_1192

seq1  GAATTCAGCTCTAATATTTGATAATAATTCAAGGGAGGAACTATAATTTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGCTCTAATATTTGATAATAATTCAAGGGAGGAACTATAATTTA  50

seq1  GACTTGGGACTTATCGTAAAAATCTATACCAGTTTCTACATTCTGATGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTTGGGACTTATCGTAAAAATCTATACCAGTTTCTACATTCTGATGTT  100

seq1  CCAGAAACACTTCTCAACCTTTGACAGCCGACTCCCAGGTTCCTTTTGGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGAAACACTTCTCAACCTTTGACAGCCGACTCCCAGGTTCCTTTTGGT  150

seq1  CCTCCTGTCTTTTCTGCCAGAAGCCCTGGGACTAACTAGGTGAAGACGTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTGTCTTTTCTGCCAGAAGCCCTGGGACTAACTAGGTGAAGACGTC  200

seq1  CTCCTTAGAACTTTGACAAGAGACTCAAGATCCCAACCCCTTCTGGTTGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTAGAACTTTGACAAGAGACTCAAGATCCCAACCCCTTCTGGTTGT  250

seq1  TTAGTGGGTGCTTGACTTATCAAAACGTGTGTGCTTCGGATGACTAGGCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTGGGTGCTTGACTTATCAAAACGTGTGTGCTTCGGATGACTAGGCA  300

seq1  AGATCCCTCCCAACTCTGATACAATCTCTGCCAATACATGCTTATGTTAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCCCTCCCAACTCTGATACAATCTCTGCCAATACATGCTTATGTTAG  350

seq1  ACAAGAGATTCGGGGAAAGCAGATGGTGAGGTCTTTTCTCAGATGTTCTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGAGATTCGGGGAAAGCAGATGGTGAGGTCTTTTCTCAGATGTTCTA  400

seq1  TGGACATCACCTGAGTCTGAAGAGTGGTCACAGTCCTCATCCTTCAGAAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGACATCACCTGAGTCTGAAGAGTGGTCACAGTCCTCATCCTTCAGAAT  450

seq1  AATTGGAGCATTTTATGTAGCTTGCCTAGGTTTCTTTCTTAAATCTATAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGGAGCATTTTATGTAGCTTGCCTAGGTTTCTTTCTTAAATCTATAA  500

seq1  TAAAGGAGTTTGATTAGTCCTCAGCCTACTATTTGGCACCGTATAAAGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGGAGTTTGATTAGTCCTCAGCCTACTATTTGGCACCGTATAAAGGT  550

seq1  AATGGATACTTACTGGTGTCTTATAAGTATCACAGGATTCTACACAAACT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGATACTTACTGGTGTCTTATAAGTATCACAGGATTCTACACAAACT  600

seq1  GTAATCAAAACATTTTATACCAAACAATGAAAAAACAATTCCACCAAAAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAATCAAAACATTTTATACCAAACAATGAAAAAACAATTCCACCAAAAT  650

seq1  AAC-TTTTTTTTATACCAACTTAGAGTTTGGAACAGATATTA-TTTATAA  698
      ||| |||||||||||||||||||||||||||||||||||||| |||||||
seq2  AACTTTTTTTTTATACCAACTTAGAGTTTGGAACAGATATTATTTTATAA  700

seq1  AGTAGGATTTGTTTCTGAGTATGTTTTGGTCTTCAATTAAATTCCTTTTA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAGGATTTGTTTCTGAGTATGTTTTGGTCTTCAATTAAATTCCTTTTA  750

seq1  AACTCAGGCTCCATGG-TACAATAGCTCCAAAATTAGTAA-TAATAAAAC  796
      |||||||||||||||| ||||||||||||||||||||||| |||||||||
seq2  AACTCAGGCTCCATGGTTACAATAGCTCCAAAATTAGTAATTAATAAAAC  800

seq1  ATTAGTTACACTGGTGGGTAATGGCTTTATTTAAAATAAGATGAAGTGTT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGTTACACTGGTGGGTAATGGCTTTATTTAAAATAAGATGAAGTGTT  850

seq1  AACTCAGTGTCTCCCA-GGACTAAGTAAATGTCTTTACACTGCTATCCAG  895
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  AACTCAGTGTCTCCCAGGGACTAAGTAAATGTCTTTACACTGCTATCCAG  900

seq1  AGGCCACAGCCATT-ACTAGAACTCATTAGCTTGCTGGCTGAGAT-ACAT  943
      |||||||||||||| |||||||||||||||||||||||||||||| ||||
seq2  AGGCCACAGCCATTAACTAGAACTCATTAGCTTGCTGGCTGAGATAACAT  950

seq1  AG-AACACTTTACG-TTTTCTGTAGGACTTTCCCCTTGCTATTATGTCT-  990
      || ||||||||||| |||||||||||||||||||||||||||||||||| 
seq2  AGAAACACTTTACGTTTTTCTGTAGGACTTTCCCCTTGCTATTATGTCTG  1000

seq1  GAG-CCTCA-CAATTCCTCTGAGGATC--TTTGGTATAGCTCCTTTTACT  1036
      ||| ||||| || ||||||||||||||  || ||||| ||||||||   |
seq2  GAGCCCTCACCATTTCCTCTGAGGATCCTTTGGGTATGGCTCCTTTACTT  1050

seq1  GGCAGAGGAA--CTAAGAATCAAAG-ACGTTTGTTTG--CTTTAAAT-CC  1080
      | ||||||||   |||||||||||| ||| |||||||  |||||| | ||
seq2  GTCAGAGGAAACTTAAGAATCAAAGAACGGTTGTTTGGCCTTTAATTCCC  1100

seq1  CAG---CACTCACAGGAAATAA  1099
      |||   | ||||||||||||||
seq2  CAGCCACTCTCACAGGAAATAA  1122

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information