MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-213C18
Chromosome	16 (Build37)
Map Location	44,640,117 - 44,788,807
singlet/doublet	doublet
Overlap gene	BC027231, Gtpbp8, Cd200r1
Upstream gene	LOC100043314, Drd3, Qtrtd1, 2610015P09Rik, Zdhhc23, Gramd1c, Atp6v1a, Nat13, Gm608, Sidt1, Ccdc52, Wdr52, Boc, LOC100043731
Downstream gene	LOC271374, F630003A18Rik, Cd200r4, LOC546665, Cd200r2, Cd200r3, EG433021, Ccdc80, Slc35a5, Atg3, EG547267, Btla, Cd200, LOC385905, Gm609, LOC628681, Slc9a10, Gcet2, BC016579, Tmprss7, Tagln3, Abhd10, Phldb2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043314 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 1 Protein

name	Drd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13490 MGI:94925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qtrtd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106248 MGI:1922194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610015P09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212153 MGI:1922661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 1 Protein

name	Zdhhc23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332175 MGI:2685625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gramd1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207798 MGI:2443024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11964 MGI:1201780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nat13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72117 MGI:1919367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm608 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207806 MGI:2685454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sidt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320007 MGI:2443155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212514 MGI:1196252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212517 MGI:1277238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein

name	Boc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117606 MGI:2151153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043731 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	BC027231 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212547 MGI:2384836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtpbp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66067 MGI:1913317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd200r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57781 MGI:1889024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC271374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:271374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	F630003A18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319823 MGI:2442797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd200r4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239849 MGI:3036289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546665 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Cd200r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271375 MGI:3042847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd200r3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74603 MGI:1921853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433021 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433021 MGI:3647873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ccdc80 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67896 MGI:1915146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74102 MGI:1921352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67841 MGI:1915091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG547267 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547267 MGI:3645112
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 372 ESTs, 7 Proteins

name	Btla (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208154 MGI:2658978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cd200 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17470 MGI:1196990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385905 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385905
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 252 ESTs, 11 Proteins pseudo : _no_value

name	Gm609 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208166 MGI:2685455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Slc9a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208169 MGI:2685456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcet2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14525 MGI:102969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC016579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212998 MGI:2384848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208171 MGI:2686594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tagln3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56370 MGI:1926784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213012 MGI:2442422
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phldb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208177 MGI:2444981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043314 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267408 GeneID:100043314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 1 Protein product : similar to poliovirus receptor-related 4 transcript_id : XM_001479949.1

name	Drd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681220 GeneID:13490 MGI:94925
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dopamine receptor 3 transcript_id : NM_007877.1

name	Qtrtd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54144621 GeneID:106248 MGI:1922194
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : queuine tRNA-ribosyltransferase domain containing 1 transcript_id : NM_029128.2

name	2610015P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267410 GeneID:212153 MGI:1922661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 1 Protein product : RIKEN cDNA 2610015P09 gene transcript_id : XM_990993.2

name	Zdhhc23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55925619 GeneID:332175 MGI:2685625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 23 transcript_id : NM_001007460.1

name	Gramd1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956283 GeneID:207798 MGI:2443024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GRAM domain containing 1C transcript_id : NM_153528.1

name	Atp6v1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343848 GeneID:11964 MGI:1201780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V1 subunit A transcript_id : NM_007508.5

name	Nat13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892288 GeneID:72117 MGI:1919367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetyltransferase 13 transcript_id : NM_028108.3

name	Gm608 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274137 GeneID:207806 MGI:2685454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 608, (NCBI) transcript_id : NM_001029889.1

name	Sidt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51036632 GeneID:320007 MGI:2443155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SID1 transmembrane family, member 1 transcript_id : NM_198034.2

name	Ccdc52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366359 GeneID:212514 MGI:1196252
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 52 transcript_id : NM_144550.3

name	Wdr52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267412 GeneID:212517 MGI:1277238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : WD repeat domain 52 transcript_id : XM_991190.2

name	Boc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344121 GeneID:117606 MGI:2151153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein transcript_id : NM_172506.2

name	BC027231 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801841 GeneID:212547 MGI:2384836
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC027231 transcript_id : NM_145972.2

name	Gtpbp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360315 GeneID:66067 MGI:1913317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP-binding protein 8 (putative) transcript_id : NM_025332.2

name	Cd200r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254537 GeneID:57781 MGI:1889024
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD200 receptor 1 transcript_id : NM_021325.2

name	F630003A18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352179 GeneID:319823 MGI:2442797
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F630003A18 gene transcript_id : NM_177010.3

name	Cd200r4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131039 GeneID:239849 MGI:3036289
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd200 receptor 4 transcript_id : NM_207244.2

name	Cd200r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45504372 GeneID:271375 MGI:3042847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd200 receptor 2 transcript_id : NM_206535.1

name	Cd200r3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369513 GeneID:74603 MGI:1921853
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD200 receptor 3 transcript_id : NM_029018.3

name	EG433021 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400210 GeneID:433021 MGI:3647873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG433021 transcript_id : XM_488779.3

name	Ccdc80 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625751 GeneID:67896 MGI:1915146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 80 transcript_id : NM_026439.2

name	Slc35a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388911 GeneID:74102 MGI:1921352
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member A5 transcript_id : NM_028756.3

name	Atg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373537 GeneID:67841 MGI:1915091
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : autophagy-related 3 (yeast) transcript_id : NM_026402.2

name	EG547267 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267538 GeneID:547267 MGI:3645112
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 372 ESTs, 7 Proteins product : predicted gene, EG547267 transcript_id : XM_001481099.1

name	Btla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83700226 GeneID:208154 MGI:2658978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B and T lymphocyte associated transcript_id : NM_001037719.2

name	Btla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83700228 GeneID:208154 MGI:2658978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B and T lymphocyte associated transcript_id : NM_177584.3

name	Cd200 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955311 GeneID:17470 MGI:1196990
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cd200 antigen transcript_id : NM_010818.3

name	Gm609 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54312053 GeneID:208166 MGI:2685455
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 609, (NCBI) transcript_id : NM_001005854.1

name	Slc9a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345084 GeneID:208169 MGI:2685456
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9, isoform 10 transcript_id : NM_198106.2

name	Gcet2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368277 GeneID:14525 MGI:102969
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germinal center expressed transcript 2 transcript_id : NM_008099.3

name	BC016579 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703777 GeneID:212998 MGI:2384848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence, BC016579 transcript_id : NM_145389.1

name	Tmprss7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168266 GeneID:208171 MGI:2686594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane serine protease 7 transcript_id : NM_172455.2

name	Tagln3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118248 GeneID:56370 MGI:1926784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transgelin 3 transcript_id : NM_019754.3

name	Abhd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542467 GeneID:213012 MGI:2442422
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 10 transcript_id : NM_172511.2

name	Phldb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802479 GeneID:208177 MGI:2444981
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology-like domain, family B, member 2 transcript_id : NM_153412.2

name	LOC100043314 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267409 GeneID:100043314
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479999.1

name	Drd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681221 CCDS:CCDS28179.1 GeneID:13490 MGI:94925
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : D3 receptor product : dopamine receptor 3 protein_id : NP_031903.1

name	Qtrtd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54144622 GeneID:106248 MGI:1922194
definition	GO_function : GO:0008479 - queuine tRNA-ribosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008616 - queuosine biosynthesis [Evidence IEA] codon_start : 1 product : queuine tRNA-ribosyltransferase domain containing 1 protein_id : NP_083404.2

name	2610015P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267411 GeneID:212153 MGI:1922661
definition	codon_start : 1 product : hypothetical protein LOC212153 protein_id : XP_996087.2

name	Zdhhc23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925620 CCDS:CCDS28180.1 GeneID:332175 MGI:2685625
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : nNOS-intereacting DHHC-containing Dem protein-L product : DHHC-containing protein 11 protein_id : NP_001007461.1

name	Gramd1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956284 CCDS:CCDS28181.1 GeneID:207798 MGI:2443024
definition	codon_start : 1 product : GRAM domain containing 1C protein_id : NP_705756.1

name	Atp6v1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560731 CCDS:CCDS28182.1 GeneID:11964 MGI:1201780
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0045261 - proton-transporting ATP synthase complex, catalytic core F(1) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : 70-kDa subunit; lysosomal 70kDa; ATPase, H+ transporting, V1 subunit A1; ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha 70 kDa, isoform 2; ATPase, H+ transporting, lysosomal 70kD, V1 subunit A, isoform 1 product : ATPase, H+ transporting, V1 subunit A, isoform 1 protein_id : NP_031534.2

name	Nat13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312422 CCDS:CCDS28183.1 GeneID:72117 MGI:1919367
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : Mak3 homolog product : Mak3p homolog protein_id : NP_082384.1

name	Gm608 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274138 CCDS:CCDS28184.1 GeneID:207806 MGI:2685454
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004571 - mannosyl-oligosaccharide 1,2-alpha-mannosidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC207806 protein_id : NP_001025060.1

name	Sidt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51036633 CCDS:CCDS28185.1 GeneID:320007 MGI:2443155
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : SID1 transmembrane family, member 1 protein_id : NP_932151.2

name	Ccdc52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559964 GeneID:212514 MGI:1196252
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 52 protein_id : NP_653133.2

name	Wdr52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267413 GeneID:212517 MGI:1277238
definition	codon_start : 1 product : WD repeat domain 52 protein_id : XP_996284.2

name	Boc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777681 CCDS:CCDS28186.1 GeneID:117606 MGI:2151153
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0016202 - regulation of striated muscle development [Evidence ISS]; GO:0007224 - smoothened signaling pathway [Evidence IDA] codon_start : 1 note : Biregional Cdon binding protein product : brother of CDO protein_id : NP_766094.1

name	BC027231 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122411 CCDS:CCDS28187.1 GeneID:212547 MGI:2384836
definition	codon_start : 1 product : hypothetical protein LOC212547 protein_id : NP_666084.1

name	Gtpbp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313623 CCDS:CCDS28188.1 GeneID:66067 MGI:1913317
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : GTP-binding protein 8 protein_id : NP_079608.1

name	Cd200r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946634 CCDS:CCDS28189.1 GeneID:57781 MGI:1889024
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IDA] codon_start : 1 note : Orexin receptor 2; antigen identified by monoclonal antibody MRC OX-2 receptor product : CD200 receptor 1 protein_id : NP_067300.1

name	Cd200r4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402237 GeneID:239849 MGI:3036289
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IDA] codon_start : 1 note : CD200 cell surface glycoprotein receptor product : Cd200 receptor 4 protein_id : NP_997127.1

name	F630003A18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892873 GeneID:319823 MGI:2442797
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : similar to Cd200 receptor protein_id : NP_795984.1

name	Cd200r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45504373 CCDS:CCDS28191.1 GeneID:271375 MGI:3042847
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IDA] codon_start : 1 product : CD200 cell surface glycoprotein receptor protein_id : NP_996258.1

name	Cd200r3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45433592 GeneID:74603 MGI:1921853
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IDA] codon_start : 1 note : CD200 cell surface glycoprotein receptor 3 product : CD200 receptor 3 protein_id : NP_083294.2

name	EG433021 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82959389 GeneID:433021 MGI:3647873
definition	codon_start : 1 product : hypothetical protein protein_id : XP_488779.2

name	Ccdc80 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625752 CCDS:CCDS28192.1 GeneID:67896 MGI:1915146
definition	codon_start : 1 note : steroid sensitive gene 1 product : steroid-sensitive protein 1 protein_id : NP_080715.2

name	Slc35a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229173 CCDS:CCDS28193.1 GeneID:74102 MGI:1921352
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005338 - nucleotide-sugar transporter activity [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA] GO_process : GO:0015780 - nucleotide-sugar transport [Evidence IEA] codon_start : 1 product : solute carrier family 35, member A5 protein_id : NP_083032.2

name	Atg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385890 CCDS:CCDS28194.1 GeneID:67841 MGI:1915091
definition	GO_component : GO:0000153 - cytoplasmic ubiquitin ligase complex [Evidence ISS] GO_function : GO:0008639 - small protein conjugating enzyme activity [Evidence ISS] GO_process : GO:0006914 - autophagy [Evidence IEA]; GO:0006464 - protein modification [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : autophagy-related 3-like; APG3 autophagy 3-like product : autophagy Apg3p/Aut1p-like protein_id : NP_080678.1

name	EG547267 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267539 GeneID:547267 MGI:3645112
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481149.1

name	Btla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83700227 CCDS:CCDS28195.1 GeneID:208154 MGI:2658978
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IGI] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP]; GO:0042130 - negative regulation of T cell proliferation [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; B and T lymphocyte attenuator product : B and T lymphocyte associated isoform 1 protein_id : NP_001032808.2

name	Btla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243938 CCDS:CCDS28196.1 GeneID:208154 MGI:2658978
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IGI] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0030889 - negative regulation of B cell proliferation [Evidence IMP]; GO:0042130 - negative regulation of T cell proliferation [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; B and T lymphocyte attenuator product : B and T lymphocyte associated isoform 2 protein_id : NP_808252.1

name	Cd200 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955312 GeneID:17470 MGI:1196990
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : MRC OX-2; antigen identified by monoclonal antibody MRC OX-2 product : Cd200 antigen protein_id : NP_034948.3

name	Gm609 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54312054 CCDS:CCDS28197.1 GeneID:208166 MGI:2685455
definition	codon_start : 1 product : hypothetical protein LOC208166 protein_id : NP_001005854.1

name	Slc9a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674259 CCDS:CCDS28198.1 GeneID:208169 MGI:2685456
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0015299 - solute:hydrogen antiporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006885 - regulation of pH [Evidence IEA]; GO:0030317 - sperm motility [Evidence IMP] codon_start : 1 exception : mismatches in translation product : sperm-specific sodium proton exchanger protein_id : NP_932774.1

name	Gcet2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542887 CCDS:CCDS28199.1 GeneID:14525 MGI:102969
definition	codon_start : 1 exception : mismatches in translation product : germinal center expressed transcript 2 protein_id : NP_032125.2

name	BC016579 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703778 GeneID:212998 MGI:2384848
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC212998 protein_id : NP_663364.1

name	Tmprss7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168267 GeneID:208171 MGI:2686594
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : matriptase-3 product : transmembrane serine protease 7 protein_id : NP_766043.2

name	Tagln3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790125 CCDS:CCDS28200.1 GeneID:56370 MGI:1926784
definition	codon_start : 1 note : neuronal protein Np25 product : transgelin 3 protein_id : NP_062728.1

name	Abhd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542468 CCDS:CCDS28201.1 GeneID:213012 MGI:2442422
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : abhydrolase domain containing 10 protein_id : NP_766099.2

name	Phldb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510303 CCDS:CCDS28202.1 GeneID:208177 MGI:2444981
definition	codon_start : 1 exception : mismatches in translation product : pleckstrin homology-like domain, family B, member 2 protein_id : NP_700461.1

name	LOC100043731 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043731
definition	number : 1 pseudo : _no_value

name	LOC271374 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:271374
definition	number : 2 pseudo : _no_value

name	LOC271374 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:271374
definition	number : 1 pseudo : _no_value

name	LOC546665 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546665
definition	number : 2 pseudo : _no_value

name	LOC546665 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546665
definition	number : 1 pseudo : _no_value

name	LOC628681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628681
definition	number : 1 pseudo : _no_value

name	LOC385905 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267541 GeneID:385905
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 252 ESTs, 11 Proteins product : similar to proteasome alpha7/C8 subunit pseudo : _no_value transcript_id : XR_034995.1

clone name	MSMg01-357H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518O24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-304K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180P09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-529K15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-537A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-358N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-394L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-091L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288N16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-358M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479E16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-370F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212F17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-213C18.b	B6Ng01-213C18.g
ACC	GA030780	GA030781
length	1,037	1,140
definition	B6Ng01-213C18.b	B6Ng01-213C18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(44,640,117 - 44,641,150)	(44,787,656 - 44,788,807)
sequence	gaattccttccacagcatcccaccacattaccaaaggcctgtgactgcag ttgcttttacacagtacatcttgtctctcaaccaaaaatttacaaggcat gctaaaaagcaaggggcatgcacagctcaatgagacagagaaagtaccag aaaaagctgaagatatggcaagaatgtcagagtcggtagaccagaagttt aaaggagctacagtttctaccctgagggttccagtggaaaaacactaccc ccccccccaaaaaaaaaacaaaaacaaaaaacaaaaaaacaaaagtcaaa attaaagcaaccctgataagttagagacaaattaagttagaatacattca gctaggccttggagcacaggtgggtaaactcaaatggatttgggaggctg aggcaggaagaccacacctgcaaggcctgatgggactacagagttggttc aaggctatcctgggaaaaccaggagtagagcagtccttggtttgataaag aacacctagagagaacccatggatgttgtgttaatgattaaatgagtgaa tataatggggcaggagttcaactcctcagacccacatggtgaaaggagag agaaaaccaactcgagcaaattgtctctgacctccacattcacaccttgg catgtgcatgtgtacatagacacctctctccacatacatatgcaaacaaa cagacaaatgtattaaaaatatccagagggttcctggagcttgttggcca gccagtctagccatttggtgaactcaaattcagtcagggactcttatcaa agaataaggcgaaatgtaattggggaaggaatctgacattcacctcttgc ctccacaaactctcccccacccccttctctttctctctctctccctctct aaagtcatagaggacataagaatcaagactatagaacatatagaaaagaa taagcagtttattgggttgcctgccttggggccaggtgggatgtccaagg tttggacagatctggtcctgtttcttgcagacactgg	gaattcaaggttttatcatcattgatatgtcaacatcttgaaaattgcat aaaaaaaaagaaactaatcagttttttcccattcatgagtaactttattt tgacaaatagtttacagtagccctgccttccttcttccttcttgccaggt cctttgtaggcataccacataagctgacttcattaaactctttcttcaga tgttatcccctaattaaagccatgtgatcctatgcaccctgcacatatat agtagatttgtagcttgatcttcatgcaggtccctcaacaactagagcag agatgtccctgaatgtgttgcctgcctgtggatccaggccccctaactgg gctgccttgtctggcctcagggagggaggatgcacctagtccttcagtga ctgatgtgcaagagttagaggagtgatacccaggggactcttcctcagag aagaaaataagggagtttgggggagaagctgcaagagggagtgactggga tgaaggggctgacattggggtgtaaagagaataaattaattaattaattt taaaaccaaagccatttggtccaataaagaacacttcccacagatggaga aacagagccagccgggcgtggtggcgcacgcctttaatcccagcacttgg gaggcagaggcaggcggatttctgagttcaaggccaacctggtctacaaa gtgagttccaggacagccaggactgtacagagaaaccctgtctcgaaaaa ccaaataaataaataaataaataaataataaataaataaataaaactaaa tgtttaaaaaaagaaaaaaaaagaaacagagccattgtccaaaaactata gaaacagaatcacaaggggttcatcctctctcttccttccagctgctcta ccttgtgactgaacagcagaaatgaagccaagcaaggtaggagaaggatg agagccctttcctctttcctttacttccttgagttctgcagaattgttca cagatgtatggtctgaaacagcatggtgcacagaggaggggaagacagga gatatgatgtcagagcagcttggcatatcgtgtttggtcactggactact tgctataagaaaaagaggccgtcataatccagccttctga
quality values	Open. Hide. 46 31 27 39 62 62 62 62 62 62 31 15 47 37 62 47 62 54 62 62 47 42 62 47 44 59 59 62 59 59 45 43 30 28 28 28 38 34 43 43 62 56 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 42 49 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 56 62 62 62 62 62 54 62 62 62 54 56 59 59 43 59 50 54 59 51 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 56 62 59 59 59 59 59 51 59 48 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 56 62 59 62 59 62 62 62 59 62 62 62 62 62 59 59 44 44 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 56 51 62 51 56 56 62 62 56 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 47 62 62 62 47 62 62 56 62 49 47 54 62 51 62 56 62 62 38 56 56 62 46 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 54 62 62 62 62 62 62 47 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 43 62 62 54 54 52 52 54 41 46 54 54 52 54 50 58 54 58 58 58 54 58 58 58 54 54 58 58 36 58 52 58 52 58 58 54 58 34 54 42 54 54 54 54 52 54 47 54 54 58 58 58 58 58 54 58 58 54 58 58 54 41 58 47 54 54 40 52 52 58 58 54 52 51 51 58 58 58 52 58 58 50 50 58 58 53 54 42 50 49 58 51 58 51 50 49 35 54 53 46 58 53 32 51 58 58 50 58 50 53 41 54 39 42 50 58 40 51 50 58 52 58 58 36 31 54 58 49 32 44 49 49 33 49 41 48 49 58 50 46 53 46 33 41 41 51 39 49 44 33 50 37 51 47 48 42 34 58 30 58 52 50 44 31 25 40 51 40 49 25 43 58 25 51 37 41 58 37 22 33 35 42 49 43 21 39 29 52 32 33 28 46 49 39 39 54 44 51 45 35 49 40 52 32 45 41 33 54 32 51 52 39 41 45 28 39 30 47 54 32 25 16 35 45 27 53 45 42 37 42 51 53 23 51 37 33 33 45 42 44 25 21 44 54 16 30 38 29 35 24 33 34 29 54 54 54 36 33 17 46 35 15 20 40 40 37 40 28 31 53 32 27 9 9 32 40 37 33 25 32 32 26 20 16 28 19 31 28 52 41 31 47 31 42 19 46 46 46 45 30 26 46 46 51 31 12 20 24 31 34 32 47 28 19 21 25 34 31 33 26 31 29 31 25 47 24 27 28 35 35 34 22 48 20 19 26 36 22 31 34 31 32 26 35 27 14 19 42 16 18 21 20 17 28 31 21 21 24 31 24 43 19 32 15 31 30 26 23 18 28 13 39 16 15 33 46 46 31 23 33 32 29 23 11 19 31 18 26 14 47 31 9 6 25 13 25 35 26 31 33 21 14 22 30 16 33 9 16 23 41 36 36 19 41 28 21 25 10 13 36 10 25 17 14 21 18 25 15 12 10 13 5 41 10 22 15 31 25 32 14 14 27 24 23 31 29 23 15 17 9 16 16 43 27 18 11 22 34 27 19 10 27 16 13 26 13 18 36	Open. Hide. 62 49 56 47 62 44 32 47 62 62 24 30 24 22 25 23 22 23 28 24 24 38 43 54 59 62 62 59 62 62 59 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 51 56 56 32 49 43 56 54 49 56 59 62 59 54 59 62 62 62 62 62 62 54 62 62 59 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 54 62 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 47 47 62 62 62 62 49 44 62 62 62 62 62 62 62 62 62 62 54 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 54 49 62 62 58 58 58 47 58 58 58 54 45 37 54 54 52 46 43 50 54 58 58 58 54 54 52 39 29 54 58 49 58 58 52 58 58 52 54 54 58 58 58 58 54 52 52 50 54 45 50 58 58 58 39 58 54 52 54 49 52 58 50 52 47 37 51 51 58 48 58 58 54 58 52 58 54 50 58 45 44 44 49 49 49 50 58 54 58 51 51 50 51 50 52 58 52 40 50 50 49 39 58 50 51 51 54 36 22 58 29 53 39 58 17 46 46 50 46 58 25 32 51 46 39 58 49 46 39 46 58 39 39 39 50 39 36 51 58 37 49 41 32 41 50 52 50 58 50 53 50 40 50 30 58 50 42 41 51 46 33 54 45 34 35 40 53 42 45 31 37 45 52 51 49 41 42 32 21 32 52 37 37 35 28 45 39 32 51 54 32 24 54 47 31 37 46 42 41 33 34 34 53 51 44 37 30 51 28 32 51 51 35 54 46 54 37 42 35 41 19 31 32 51 28 46 27 49 21 47 31 22 22 27 26 26 47 31 47 25 40 31 47 32 47 24 39 28 40 45 33 41 31 26 49 21 29 53 40 52 14 14 51 51 51 51 51 35 24 45 51 51 46 46 51 51 51 37 26 45 51 33 31 30 33 51 31 30 25 23 37 32 29 9 8 29 28 47 47 47 25 34 36 33 43 33 25 42 46 31 28 25 32 34 18 31 35 32 14 22 9 6 42 48 42 26 30 31 22 23 31 31 30 22 22 30 31 31 39 11 17 27 27 35 25 42 12 38 32 31 34 31 31 31 32 25 31 30 22 30 43 32 37 33 26 33 31 14 25 24 34 21 31 31 10 34 44 19 30 31 25 31 15 33 31 22 31 21 21 11 8 31 25 30 22 20 11 38 13 10 22 7 12 18 17 31 21 8 32 20 32 48 17 25 43 18 26 7 9 22 27 48 31 21 15 28 37 20 14 32 20 28 18 18 13 21 34 32 18 33 7 10 11 29 15 13 11 37 37 11 20 19 8 17 17 17 9 5 12 21 19 28 6 18 12 18 18 5 11 27 23 24 28 15 14 8 27 7 20 20 24 15 7 10 11 5 4 7 9 6 6 5 6 8 30 28 14 11 6 4 6 8 13 28 24 16 5 11 4 5 16 24 19 7 14 16 12 5 7 13 5 12 8 5 7 7 5 10 11 6 4 12 8 23 20 5 7 4 2 4 7 7 3 1 3 8 3 2 9 8 20 11 15 7 11 4 6 8 1 3 3 3 4 22 7 7 28 23 30 17 4 4 4 7 18 18 8 21 19 10 16 21 21 23 13 7 10 4 6 6 25 10 16 16 10 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_44640117_44641150
seq2: B6Ng01-213C18.b_47_1083

seq1  GAATTCCTTCCACAGCATCCCACCACATTACCAAAGGCCTGTGACTGCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTCCACAGCATCCCACCACATTACCAAAGGCCTGTGACTGCAG  50

seq1  TTGCTTTTACACAGTACATCTTGTCTCTCAACCAAAAATTTACAAGGCAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTTTTACACAGTACATCTTGTCTCTCAACCAAAAATTTACAAGGCAT  100

seq1  GCTAAAAAGCAAGGGGCATGCACAGCTCAATGAGACAGAGAAAGTACCAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAAAAAGCAAGGGGCATGCACAGCTCAATGAGACAGAGAAAGTACCAG  150

seq1  AAAAAGCTGAAGATATGGCAAGAATGTCAGAGTCGGTAGACCAGAAGTTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGCTGAAGATATGGCAAGAATGTCAGAGTCGGTAGACCAGAAGTTT  200

seq1  AAAGGAGCTACAGTTTCTACCCTGAGGGTTCCAGTGGAAAAACACTACCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGAGCTACAGTTTCTACCCTGAGGGTTCCAGTGGAAAAACACTACCC  250

seq1  CCCCCCCCAAAAAAAAAACAAAAACAAAAAACAAAAAAACAAAAGTCAAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCCCCAAAAAAAAAACAAAAACAAAAAACAAAAAAACAAAAGTCAAA  300

seq1  ATTAAAGCAACCCTGATAAGTTAGAGACAAATTAAGTTAGAATACATTCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAAAGCAACCCTGATAAGTTAGAGACAAATTAAGTTAGAATACATTCA  350

seq1  GCTAGGCCTTGGAGCACAGGTGGGTAAACTCAAATGGATTTGGGAGGCTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAGGCCTTGGAGCACAGGTGGGTAAACTCAAATGGATTTGGGAGGCTG  400

seq1  AGGCAGGAAGACCACACCTGCAAGGCCTGATGGGACTACAGAGTTGGTTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGGAAGACCACACCTGCAAGGCCTGATGGGACTACAGAGTTGGTTC  450

seq1  AAGGCTATCCTGGGAAAACCAGGAGTAGAGCAGTCCTTGGTTTGATAAAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCTATCCTGGGAAAACCAGGAGTAGAGCAGTCCTTGGTTTGATAAAG  500

seq1  AACACCTAGAGAGAACCCATGGATGTTGTGTTAATGATTAAATGAGTGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACCTAGAGAGAACCCATGGATGTTGTGTTAATGATTAAATGAGTGAA  550

seq1  TATAATGGGGCAGGAGTTCAACTCCTCAGACCCACATGGTGAAAGGAGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAATGGGGCAGGAGTTCAACTCCTCAGACCCACATGGTGAAAGGAGAG  600

seq1  AGAAAACCAACTCGAGCAAATTGTCTCTGACCTCCACATTCACACCTTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAACCAACTCGAGCAAATTGTCTCTGACCTCCACATTCACACCTTGG  650

seq1  CATGTGCATGTGTACATAGACACCTCTCTCCACATACATATGCAAACAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTGCATGTGTACATAGACACCTCTCTCCACATACATATGCAAACAAA  700

seq1  CAGACAAATGTATTAAAAATATCCAGAGGGTTCCTGGAGCTTGTTGGCCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACAAATGTATTAAAAATATCCAGAGGGTTCCTGGAGCTTGTTGGCCA  750

seq1  GCCAGTCTAGCCATTTGGTGAACTCAAATTCAGTCAGGGACTCTTATCAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGTCTAGCCATTTGGTGAACTCAAATTCAGTCAGGGACTCTTATCAA  800

seq1  AGAATAAGGCGAAATGTAATTGGGGAAGGAATCTGACATTCACCTCTTGC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATAAGGCGAAATGTAATTGGGGAAGGAATCTGACATTCACCTCTTGC  850

seq1  CTCCACAAACTCTCCCCCACCCCCTTCTCTTTCTCTCTCTCTCCCTCTCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCACAAACTCTCCCCCACCCCCTTCTCTTTCTCTCTCTCTCCCTCTCT  900

seq1  AAAGTCATAGAGGACATAAGAATCAAGACTATAGAACATATAGAAAAGAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTCATAGAGGACATAAGAATCAAGACTATAGAACATATAGAAAAGAA  950

seq1  TAAGCAGTTTATTGGGTTG-CTGCC-TGGGGCCAGGT-GGATGTCCAAGG  997
      ||||||||||||||||||| ||||| ||||||||||| ||||||||||||
seq2  TAAGCAGTTTATTGGGTTGCCTGCCTTGGGGCCAGGTGGGATGTCCAAGG  1000

seq1  GTTGGACAGATCTGGTCCTGTTTCTTGCAGACACTGG  1034
       ||||||||||||||||||||||||||||||||||||
seq2  TTTGGACAGATCTGGTCCTGTTTCTTGCAGACACTGG  1037

seq1: chr16_44787656_44788807
seq2: B6Ng01-213C18.g_68_1207 (reverse)

seq1  TCAGAA-GCT-GATTATGACGG-CTCTTTTTCTTATAAAGCAGTGTAGTC  47
      |||||| ||| ||||||||||| |||||||||||||  ||||  ||||||
seq2  TCAGAAGGCTGGATTATGACGGCCTCTTTTTCTTAT--AGCA-AGTAGTC  47

seq1  CAGGTTGGCCCAAAATTCACGATATGGCCAGCTGCTCTGACATCATAATT  97
      |||    | |||||   ||||||||| | ||||||||||||||||||  |
seq2  CAG---TGACCAAA---CACGATATGCCAAGCTGCTCTGACATCATA--T  89

seq1  CTCCTGTC-TCCCCT-CTCTGTGCAACCATGCCTGGTTTCAGACCATTAC  145
      |||||||| |||||| |||||||| |||||||   ||||||||||| |||
seq2  CTCCTGTCTTCCCCTCCTCTGTGC-ACCATGC--TGTTTCAGACCA-TAC  135

seq1  ATCTGTGAACAATTCTGCAGAACTCAAGGAAGTAAAAGGAAAGAGGAAAG  195
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  ATCTGTGAACAATTCTGCAGAACTCAAGGAAGT-AAAGGAAAGAGGAAAG  184

seq1  GGCTCTCATCCTTCTCCTACCCTGCTTGGCTTCATTTCTGCTGTTCAGTC  245
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GGCTCTCATCCTTCTCCTACCTTGCTTGGCTTCATTTCTGCTGTTCAGTC  234

seq1  ACAAGGTAGAGCAGCTGGAAGGAAGAGAGAGGATGAACCCTTTGTGATTC  295
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  ACAAGGTAGAGCAGCTGGAAGGAAGAGAGAGGATGAACCCCTTGTGATTC  284

seq1  TGTTTCTATAGTTTTTGGACAATGGCTCTGTTTCTTTTTTTTTCTTTTTT  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTCTATAGTTTTTGGACAATGGCTCTGTTTCTTTTTTTTTCTTTTTT  334

seq1  TAAACATTTAGTTTTATTTATTTATTTATTTATTTATTTATTTATTTATT  395
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  TAAACATTTAGTTTTATTTATTTATTTA-TTATTTATTTATTTATTTATT  383

seq1  TATTTGGTTTTTCGAGACAGGGTTTCTCTGTACAGTCCTGGCTGTCCTGG  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTGGTTTTTCGAGACAGGGTTTCTCTGTACAGTCCTGGCTGTCCTGG  433

seq1  AACTCACTTTGTAGACCAGGTTGGCCTTGAACTCAGAAATCCGCCTGCCT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCACTTTGTAGACCAGGTTGGCCTTGAACTCAGAAATCCGCCTGCCT  483

seq1  CTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACGCCCGGCTGG  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACGCCCGGCTGG  533

seq1  CTCTGTTTCTCCATCTGTGGGAAGTGTTCTTTATTGGACCAAATGGCTTT  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTTTCTCCATCTGTGGGAAGTGTTCTTTATTGGACCAAATGGCTTT  583

seq1  GGTTTTAAAATTAATTAATTAATTTATTCTCTTTACACCCCAATGTCAGC  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTTAAAATTAATTAATTAATTTATTCTCTTTACACCCCAATGTCAGC  633

seq1  CCCTTCATCCCAGTCACTCCCTCTTGCAGCTTCTCCCCCAAACTCCCTTA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTCATCCCAGTCACTCCCTCTTGCAGCTTCTCCCCCAAACTCCCTTA  683

seq1  TTTTCTTCTCTGAGGAAGAGTCCCCTGGGTATCACTCCTCTAACTCTTGC  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCTTCTCTGAGGAAGAGTCCCCTGGGTATCACTCCTCTAACTCTTGC  733

seq1  ACATCAGTCACTGAAGGACTAGGTGCATCCTCCCTCCCTGAGGCCAGACA  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCAGTCACTGAAGGACTAGGTGCATCCTCCCTCCCTGAGGCCAGACA  783

seq1  AGGCAGCCCAGTTAGGGGGCCTGGATCCACAGGCAGGCAACACATTCAGG  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGCCCAGTTAGGGGGCCTGGATCCACAGGCAGGCAACACATTCAGG  833

seq1  GACATCTCTGCTCTAGTTGTTGAGGGACCTGCATGAAGATCAAGCTACAA  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATCTCTGCTCTAGTTGTTGAGGGACCTGCATGAAGATCAAGCTACAA  883

seq1  ATCTACTATATATGTGCAGGGTGCATAGGATCACATGGCTTTAATTAGGG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTACTATATATGTGCAGGGTGCATAGGATCACATGGCTTTAATTAGGG  933

seq1  GATAACATCTGAAGAAAGAGTTTAATGAAGTCAGCTTATGTGGTATGCCT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAACATCTGAAGAAAGAGTTTAATGAAGTCAGCTTATGTGGTATGCCT  983

seq1  ACAAAGGACCTGGCAAGAAGGAAGAAGGAAGGCAGGGCTACTGTAAACTA  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAGGACCTGGCAAGAAGGAAGAAGGAAGGCAGGGCTACTGTAAACTA  1033

seq1  TTTGTCAAAATAAAGTTACTCATGAATGGGAAAAAACTGATTAGTTTCTT  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTCAAAATAAAGTTACTCATGAATGGGAAAAAACTGATTAGTTTCTT  1083

seq1  TTTTTTTATGCAATTTTCAAGATGTTGACATATCAATGATGATAAAACCT  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTATGCAATTTTCAAGATGTTGACATATCAATGATGATAAAACCT  1133

seq1  TGAATTC  1152
      |||||||
seq2  TGAATTC  1140

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information