MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-228P16
Chromosome	16 (Build37)
Map Location	18,786,162 - 18,787,294
singlet/doublet	singlet
Overlap gene	Cdc45l
Upstream gene	Klhl22, Scarf2, Car15, Dgcr2, Tssk1, Tssk2, Es2el, Gscl, Slc25a1, Vpreb2, Dgcr6, Prodh, Rtn4r, EG665975, Zdhhc8, Ranbp1, Htf9c, Dgcr8, D16H22S680E, LOC100042884, Arvcf, Comt, Txnrd2, Gnb1l, Tbx1, Gp1bb, Sept5, LOC622795, Cldn5
Downstream gene	Ufd1l, 2510002D24Rik, Mrpl40, Hira, Igl, Igl-C1, Igl-J1, Igl-C3, Igl-J3p, Igl-J3, Igl-V1, Igl-C4, Igl-J4, Igl-C2, Igl-J2, Igl-V3, Igl-V2, Olfr164, Olfr165, Olfr166, Olfr167, Olfr168, Olfr169, Olfr170, Olfr171, LOC100043444, Lamp3, B3gnt5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Klhl22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224023 MGI:1337995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scarf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224024 MGI:1858430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80733 MGI:1931324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgcr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13356 MGI:892866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22114 MGI:1347557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22115 MGI:1347559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Es2el (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27886 MGI:107854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gscl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195333 MGI:892006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 Proteins

name	Slc25a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13358 MGI:1345283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vpreb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22363 MGI:98937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgcr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13353 MGI:1202877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prodh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19125 MGI:97770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtn4r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65079 MGI:2136886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665975 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665975 MGI:3647803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Zdhhc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27801 MGI:1338012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ranbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19385 MGI:96269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htf9c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15547 MGI:96270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Dgcr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94223 MGI:2151114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D16H22S680E (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27883 MGI:101825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042884 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Arvcf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11877 MGI:109620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Comt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12846 MGI:88470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnrd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26462 MGI:1347023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnb1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13972 MGI:1338057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tbx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21380 MGI:98493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gp1bb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14724 MGI:107852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sept5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18951 MGI:1195461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622795 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2575 ESTs, 6 Proteins pseudo : _no_value

name	Cldn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12741 MGI:1276112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc45l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12544 MGI:1338073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ufd1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22230 MGI:109353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2510002D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72307 MGI:1919557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18100 MGI:1332635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hira (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15260 MGI:99430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111519 MGI:96526
definition	gene_synonym : Igl-x note : immunoglobulin lambda chain complex

name	Igl-C1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110785 IMGT/GENE-DB:IGLC1 MGI:99546
definition	gene_synonym : Clambda1 note : immunoglobulin lambda chain, constant region 1

name	Igl-J1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:404737 IMGT/GENE-DB:IGLJ1
definition	note : immunoglobulin lambda chain, joining region 1

name	Igl-C3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110787 IMGT/GENE-DB:IGLC3 MGI:99886
definition	note : immunoglobulin lambda chain, constant region 3

name	Igl-J3p (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:404741 IMGT/GENE-DB:IGLJ3P
definition	gene_synonym : IGLJ3P note : immunoglobulin lambda chain, joining region 3 pseudogene pseudo : _no_value

name	Igl-J3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:404740 IMGT/GENE-DB:IGLJ3
definition	gene_synonym : IGLJ3 note : immunoglobulin lambda chain, joining region 3

name	Igl-V1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16142 IMGT/GENE-DB:IGLV1 MGI:96530
definition	gene_synonym : 1810027O01Rik; IgL note : immunoglobulin lambda chain, variable 1

name	Igl-C4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:404736 IMGT/GENE-DB:IGLC4
definition	note : immunoglobulin lambda chain, constant region 4 pseudo : _no_value

name	Igl-J4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:404742 IMGT/GENE-DB:IGLJ4
definition	gene_synonym : IGLJ4 note : immunoglobulin lambda chain, joining region 4 pseudo : _no_value

name	Igl-C2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110786 IMGT/GENE-DB:IGLC2 MGI:99547
definition	gene_synonym : IGLC2 note : immunoglobulin lambda chain, constant region 2

name	Igl-J2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:404739 IMGT/GENE-DB:IGLJ2
definition	gene_synonym : IGLJ2 note : immunoglobulin lambda chain, joining region 2

name	Igl-V3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:404743 IMGT/GENE-DB:IGLV3
definition	gene_synonym : IGLV3 note : immunoglobulin lambda chain, variable 3

name	Igl-V2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110612 IMGT/GENE-DB:IGLV2 MGI:99548
definition	gene_synonym : IGLV2 note : immunoglobulin lambda chain, variable 2

name	Olfr164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258443 MGI:3029998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr165 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258458 MGI:3029999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259071 MGI:3030000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258937 MGI:3030001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr168 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258354 MGI:3030002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr169 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258158 MGI:3030003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr170 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258959 MGI:3030004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr171 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258960 MGI:3030005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043444 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 11 Proteins pseudo : _no_value

name	Lamp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239739 MGI:2441659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108105 MGI:2137302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802617 GeneID:224023 MGI:1337995
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 22 (Drosophila) transcript_id : NM_145479.3

name	Scarf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803416 GeneID:224024 MGI:1858430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scavenger receptor class F, member 2 transcript_id : NM_153790.2

name	Car15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981403 GeneID:80733 MGI:1931324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 15 transcript_id : NM_030558.2

name	Dgcr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816900 GeneID:13356 MGI:892866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DiGeorge syndrome critical region gene 2 transcript_id : NM_010048.2

name	Tssk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734850 GeneID:22114 MGI:1347557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 1 transcript_id : NM_009435.2

name	Tssk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734842 GeneID:22115 MGI:1347559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 2 transcript_id : NM_009436.2

name	Es2el (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362980 GeneID:27886 MGI:107854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence 2 embryonic lethal transcript_id : NM_001081633.1

name	Es2el (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362978 GeneID:27886 MGI:107854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence 2 embryonic lethal transcript_id : NM_022408.2

name	Gscl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267418 GeneID:195333 MGI:892006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 Proteins product : goosecoid-like transcript_id : XM_001480613.1

name	Slc25a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943837 GeneID:13358 MGI:1345283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 transcript_id : NM_153150.1

name	Vpreb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850239 GeneID:22363 MGI:98937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B lymphocyte gene 2 transcript_id : NM_016983.1

name	Dgcr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347980 GeneID:13353 MGI:1202877
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DiGeorge syndrome critical region gene 6 transcript_id : NM_010047.2

name	Prodh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601003 GeneID:19125 MGI:97770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline dehydrogenase transcript_id : NM_011172.2

name	Rtn4r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371844 GeneID:65079 MGI:2136886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 4 receptor transcript_id : NM_022982.2

name	EG665975 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267286 GeneID:665975 MGI:3647803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG665975 transcript_id : XM_980665.2

name	Zdhhc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84619698 GeneID:27801 MGI:1338012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 8 transcript_id : NM_172151.3

name	Ranbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755283 GeneID:19385 MGI:96269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAN binding protein 1 transcript_id : NM_011239.1

name	Htf9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487416 GeneID:15547 MGI:96270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HpaII tiny fragments locus 9c transcript_id : NM_008307.2

name	Htf9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487420 GeneID:15547 MGI:96270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HpaII tiny fragments locus 9c transcript_id : NM_001081000.1

name	Htf9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487422 GeneID:15547 MGI:96270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HpaII tiny fragments locus 9c transcript_id : NM_001080999.1

name	Dgcr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41152098 GeneID:94223 MGI:2151114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DiGeorge syndrome critical region gene 8 transcript_id : NM_033324.2

name	D16H22S680E (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20070387 GeneID:27883 MGI:101825
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 16, human D22S680E, expressed transcript_id : NM_138583.1

name	LOC100042884 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267288 GeneID:100042884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042884 transcript_id : XM_001478994.1

name	Arvcf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254128 GeneID:11877 MGI:109620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat gene deleted in velo-cardio-facial syndrome transcript_id : NM_033474.2

name	Comt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352293 GeneID:12846 MGI:88470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catechol-O-methyltransferase transcript_id : NM_007744.2

name	Txnrd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:102468564 GeneID:26462 MGI:1347023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin reductase 2 transcript_id : NM_013711.2

name	Gnb1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126273551 GeneID:13972 MGI:1338057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), beta polypeptide 1-like transcript_id : NM_001081682.1

name	Gnb1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126273561 GeneID:13972 MGI:1338057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), beta polypeptide 1-like transcript_id : NM_023120.4

name	Tbx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22094108 GeneID:21380 MGI:98493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 1 transcript_id : NM_011532.1

name	Gp1bb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50345974 GeneID:14724 MGI:107852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein Ib, beta polypeptide transcript_id : NM_010327.2

name	Gp1bb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50345975 GeneID:14724 MGI:107852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein Ib, beta polypeptide transcript_id : NM_001001999.1

name	Sept5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47132508 GeneID:18951 MGI:1195461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 5 transcript_id : NM_213614.1

name	Cldn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348145 GeneID:12741 MGI:1276112
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 5 transcript_id : NM_013805.3

name	Cdc45l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753365 GeneID:12544 MGI:1338073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 45 homolog (S. cerevisiae)-like transcript_id : NM_009862.1

name	Ufd1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367932 GeneID:22230 MGI:109353
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin fusion degradation 1 like transcript_id : NM_011672.3

name	2510002D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432561 GeneID:72307 MGI:1919557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510002D24 gene transcript_id : NM_001033164.2

name	Mrpl40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754861 GeneID:18100 MGI:1332635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L40 transcript_id : NM_010922.1

name	Hira (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52426777 GeneID:15260 MGI:99430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cell cycle regulation defective homolog A (S. cerevisiae) transcript_id : NM_010435.2

name	Olfr164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238893 GeneID:258443 MGI:3029998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 164 transcript_id : NM_146451.1

name	Olfr165 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238891 GeneID:258458 MGI:3029999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 165 transcript_id : NM_146466.1

name	Olfr166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128824 GeneID:259071 MGI:3030000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 166 transcript_id : NM_147068.1

name	Olfr167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129036 GeneID:258937 MGI:3030001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 167 transcript_id : NM_146935.1

name	Olfr168 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129588 GeneID:258354 MGI:3030002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 168 transcript_id : NM_146357.1

name	Olfr169 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801467 GeneID:258158 MGI:3030003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 169 transcript_id : NM_001011855.1

name	Olfr170 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129010 GeneID:258959 MGI:3030004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 170 transcript_id : NM_146957.1

name	Olfr171 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129004 GeneID:258960 MGI:3030005
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 171 transcript_id : NM_146958.1

name	Lamp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601014 GeneID:239739 MGI:2441659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated membrane protein 3 transcript_id : NM_177356.3

name	B3gnt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542176 GeneID:108105 MGI:2137302
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 transcript_id : NM_054052.2

name	Klhl22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981790 GeneID:224023 MGI:1337995
definition	codon_start : 1 exception : mismatches in translation note : kelch-like product : kelch-like 22 protein_id : NP_663454.2

name	Scarf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418901 CCDS:CCDS28010.1 GeneID:224024 MGI:1858430
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence IDA] codon_start : 1 note : scavenger receptor type F; scavenger receptor expressed by endothelial cells 2 (acetyl LDL receptor like); scavenger receptor class F, member 1 product : scavenger receptor class F, member 2 protein_id : NP_722485.1

name	Car15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385334 GeneID:80733 MGI:1931324
definition	GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : carbonic anhydrase-like sequence 2 product : carbonic anhydrase 15 protein_id : NP_085035.1

name	Dgcr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816901 GeneID:13356 MGI:892866
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : DiGeorge syndrome gene c product : DiGeorge syndrome protein C protein_id : NP_034178.2

name	Tssk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734851 CCDS:CCDS28011.1 GeneID:22114 MGI:1347557
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : testis-specific serine/threonine kinase; serine/threonine kinase 22A (spermiogenesis associated) product : testis-specific serine kinase 1 protein_id : NP_033461.2

name	Tssk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734843 CCDS:CCDS28012.1 GeneID:22115 MGI:1347559
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0007283 - spermatogenesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : testis specific serine/ threonine kinase 2; serine/threonine kinase 22B (spermiogenesis associated) product : testis-specific serine kinase 2 protein_id : NP_033462.2

name	Es2el (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126362981 GeneID:27886 MGI:107854
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007399 - nervous system development [Evidence IEP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DiGeorge syndrome critical region protein 14 isoform 2 protein_id : NP_001075102.1

name	Es2el (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126362979 CCDS:CCDS28013.1 GeneID:27886 MGI:107854
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007399 - nervous system development [Evidence IEP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DiGeorge syndrome critical region protein 14 isoform 1 protein_id : NP_071853.2

name	Gscl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267419 GeneID:195333 MGI:892006
definition	codon_start : 1 product : goosecoid-like protein_id : XP_001480663.1

name	Slc25a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943838 CCDS:CCDS28014.1 GeneID:13358 MGI:1345283
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : DiGeorge syndrome gene j; tricarboxylate transport protein product : solute carrier family 25, member 1 protein_id : NP_694790.1

name	Vpreb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850240 CCDS:CCDS28015.1 GeneID:22363 MGI:98937
definition	codon_start : 1 note : Lambda 5 product : pre-B lymphocyte gene 2 protein_id : NP_058679.1

name	Dgcr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789014 CCDS:CCDS28016.1 GeneID:13353 MGI:1202877
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : DiGeorge syndrome chromosome region 6; DiGeorge syndrome critical region 6 product : DiGeorge syndrome critical region gene 6 protein_id : NP_034177.1

name	Prodh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601004 GeneID:19125 MGI:97770
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004657 - proline dehydrogenase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006537 - glutamate biosynthesis [Evidence IEA]; GO:0006562 - proline catabolism [Evidence IEA]; GO:0006560 - proline metabolism [Evidence IEA] codon_start : 1 product : proline dehydrogenase protein_id : NP_035302.2

name	Rtn4r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12667794 GeneID:65079 MGI:2136886
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007409 - axonogenesis [Evidence IDA] codon_start : 1 note : Nogo-66 receptor product : nogo receptor protein_id : NP_075358.1

name	EG665975 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267287 GeneID:665975 MGI:3647803
definition	codon_start : 1 product : similar to hCG1732289 protein_id : XP_985759.2

name	Zdhhc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84619699 CCDS:CCDS28017.1 GeneID:27801 MGI:1338012
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007610 - behavior [Evidence IMP] codon_start : 1 exception : mismatches in translation note : DHHC-containing protein 8 product : zinc finger, DHHC domain containing 8 protein_id : NP_742163.3

name	Ranbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755284 GeneID:19385 MGI:96269
definition	GO_component : GO:0005813 - centrosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0046907 - intracellular transport [Evidence IEA]; GO:0046604 - positive regulation of mitotic centrosome separation [Evidence IDA]; GO:0007051 - spindle organization and biogenesis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Htf9-a/RanBP1 product : RAN binding protein 1 protein_id : NP_035369.1

name	Htf9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487423 GeneID:15547 MGI:96270
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : HpaII tiny fragments locus 9c isoform 2 protein_id : NP_001074468.1

name	Htf9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487421 GeneID:15547 MGI:96270
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : HpaII tiny fragments locus 9c isoform 1 protein_id : NP_001074469.1

name	Htf9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487417 GeneID:15547 MGI:96270
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : HpaII tiny fragments locus 9c isoform 3 protein_id : NP_032333.2

name	Dgcr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41152099 CCDS:CCDS28018.1 GeneID:94223 MGI:2151114
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0035198 - miRNA binding [Evidence IC] GO_process : GO:0031053 - primary microRNA processing [Evidence ISS] codon_start : 1 product : DiGeorge syndrome critical region gene 8 protein_id : NP_201581.2

name	D16H22S680E (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070388 CCDS:CCDS28019.1 GeneID:27883 MGI:101825
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC27883 protein_id : NP_613049.1

name	LOC100042884 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267289 GeneID:100042884
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479044.1

name	Arvcf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254129 CCDS:CCDS28020.1 GeneID:11877 MGI:109620
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence TAS]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : armadillo repeat gene deleted in velo-cardio-facial syndrome protein_id : NP_258435.2

name	Comt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680982 CCDS:CCDS28021.1 GeneID:12846 MGI:88470
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016206 - catechol O-methyltransferase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0008171 - O-methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006584 - catecholamine metabolism [Evidence IEA]; GO:0042420 - dopamine catabolism [Evidence IDA]; GO:0042135 - neurotransmitter catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : catechol-O-methyltransferase protein_id : NP_031770.1

name	Txnrd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:102468565 GeneID:26462 MGI:1347023
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEP] [Evidence TAS] [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016654 - oxidoreductase activity, acting on NADH or NADPH, disulfide as acceptor [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008430 - selenium binding [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0000305 - response to oxygen radical [Evidence IMP] [Evidence TAS] codon_start : 1 note : human EST 573010; TR beta product : thioredoxin reductase 2 protein_id : NP_038739.2 transl_except : (pos:18477865..18477867,aa:Sec)

name	Gnb1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126273552 GeneID:13972 MGI:1338057
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0009898 - internal side of plasma membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS] codon_start : 1 product : guanine nucleotide binding protein (G protein), beta polypeptide 1-like protein_id : NP_001075151.1

name	Gnb1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662738 CCDS:CCDS28022.1 GeneID:13972 MGI:1338057
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0009898 - internal side of plasma membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS] codon_start : 1 product : guanine nucleotide binding protein (G protein), beta polypeptide 1-like protein_id : NP_075609.2

name	Tbx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094109 CCDS:CCDS28023.1 GeneID:21380 MGI:98493
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0001708 - cell fate specification [Evidence IMP] [Evidence IGI]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0007507 - heart development [Evidence IGI] [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0042474 - middle ear morphogenesis [Evidence IMP]; GO:0007517 - muscle development [Evidence IMP]; GO:0001755 - neural crest cell migration [Evidence IMP]; GO:0042473 - outer ear morphogenesis [Evidence IMP]; GO:0007389 - pattern specification [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : T-box 1 protein_id : NP_035662.1

name	Gp1bb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754040 GeneID:14724 MGI:107852
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0007599 - hemostasis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : glycoprotein Ib, beta polypeptide isoform 2 protein_id : NP_034457.1

name	Gp1bb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50345976 CCDS:CCDS28025.1 GeneID:14724 MGI:107852
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0007599 - hemostasis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : glycoprotein Ib, beta polypeptide isoform 1 protein_id : NP_001001999.1

name	Sept5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47132509 GeneID:18951 MGI:1195461
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS]; GO:0008021 - synaptic vesicle [Evidence ISS]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0017157 - regulation of exocytosis [Evidence ISS]; GO:0016080 - synaptic vesicle targeting [Evidence ISS] codon_start : 1 note : cell division control related protein 1; peanut-like 1 homolog product : septin 5 protein_id : NP_998779.1

name	Cldn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980735 CCDS:CCDS28026.1 GeneID:12741 MGI:1276112
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS]; GO:0016337 - cell-cell adhesion [Evidence IC] codon_start : 1 note : transmembrane protein deleted in VCFS product : claudin 5 protein_id : NP_038833.2

name	Cdc45l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753366 CCDS:CCDS28027.1 GeneID:12544 MGI:1338073
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006270 - DNA replication initiation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cell division cycle 45-like product : cell division cycle 45 homolog (S. cerevisiae)-like protein_id : NP_033992.1

name	Ufd1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981443 CCDS:CCDS28028.1 GeneID:22230 MGI:109353
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin fusion degradation 1 like protein_id : NP_035802.2

name	2510002D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701660 CCDS:CCDS28029.1 GeneID:72307 MGI:1919557
definition	codon_start : 1 product : hypothetical protein LOC72307 protein_id : NP_001028336.1

name	Mrpl40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754862 CCDS:CCDS28030.1 GeneID:18100 MGI:1332635
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : nuclear localization signal protein absent in velo-cardio-facial patients product : mitochondrial ribosomal protein L40 protein_id : NP_035052.1

name	Hira (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52426778 CCDS:CCDS28031.1 GeneID:15260 MGI:99430
definition	GO_component : GO:0000790 - nuclear chromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007369 - gastrulation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TUP1-like enhancer of split gene 1 product : histone cell cycle regulation defective homolog A protein_id : NP_034565.2

name	Igl-C1 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:110785 IMGT/GENE-DB:IGLC1 MGI:99546
definition	codon_start : 3 exception : rearrangement required for product gene_synonym : Clambda1

name	Igl-J1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:404737 IMGT/GENE-DB:IGLJ1
definition	codon_start : 2 exception : rearrangement required for product

name	Igl-C3 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:110787 IMGT/GENE-DB:IGLC3 MGI:99886
definition	codon_start : 3 exception : rearrangement required for product

name	Igl-J3p (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:404741 IMGT/GENE-DB:IGLJ3P
definition	codon_start : 2 gene_synonym : IGLJ3P pseudo : _no_value

name	Igl-J3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:404740 IMGT/GENE-DB:IGLJ3
definition	codon_start : 2 exception : rearrangement required for product gene_synonym : IGLJ3

name	Igl-V1 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16142 IMGT/GENE-DB:IGLV1 MGI:96530
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : 1810027O01Rik; IgL

name	Igl-C4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:404736 IMGT/GENE-DB:IGLC4
definition	codon_start : 1 pseudo : _no_value

name	Igl-J4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:404742 IMGT/GENE-DB:IGLJ4
definition	codon_start : 1 gene_synonym : IGLJ4 pseudo : _no_value

name	Igl-C2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:110786 IMGT/GENE-DB:IGLC2 MGI:99547
definition	codon_start : 3 exception : rearrangement required for product gene_synonym : IGLC2

name	Igl-J2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:404739 IMGT/GENE-DB:IGLJ2
definition	codon_start : 2 exception : rearrangement required for product gene_synonym : IGLJ2

name	Igl-V3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:404743 IMGT/GENE-DB:IGLV3
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGLV3

name	Igl-V2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:110612 IMGT/GENE-DB:IGLV2 MGI:99548
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGLV2

name	Olfr164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238894 CCDS:CCDS28032.1 GeneID:258443 MGI:3029998
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-15738260-15737319; olfactory receptor MOR279-2 product : olfactory receptor 164 protein_id : NP_666662.1

name	Olfr165 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238892 CCDS:CCDS28033.1 GeneID:258458 MGI:3029999
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-15855164-15854223; olfactory receptor MOR279-1 product : olfactory receptor 165 protein_id : NP_666677.1

name	Olfr166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128825 CCDS:CCDS28034.1 GeneID:259071 MGI:3030000
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-15934912-15935850; olfactory receptor MOR270-1 product : olfactory receptor 166 protein_id : NP_667279.1

name	Olfr167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129037 CCDS:CCDS28035.1 GeneID:258937 MGI:3030001
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-15963726-15962788; olfactory receptor MOR272-1 product : olfactory receptor 167 protein_id : NP_667146.1

name	Olfr168 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129589 CCDS:CCDS28036.1 GeneID:258354 MGI:3030002
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-15979009-15978071; olfactory receptor MOR271-1 product : olfactory receptor 168 protein_id : NP_666469.1

name	Olfr169 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801468 CCDS:CCDS28037.1 GeneID:258158 MGI:3030003
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-16014972-16014031; olfactory receptor MOR273-3P product : olfactory receptor 169 protein_id : NP_001011855.1

name	Olfr170 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129011 CCDS:CCDS28038.1 GeneID:258959 MGI:3030004
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x54KRFPKG5P-16052703-16051765; olfactory receptor MOR273-2 product : olfactory receptor 170 protein_id : NP_667168.1

name	Olfr171 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129005 CCDS:CCDS28039.1 GeneID:258960 MGI:3030005
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x54KRFPKG5P-16071018-16070077; olfactory receptor MOR273-1 product : olfactory receptor 171 protein_id : NP_667169.1

name	Lamp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601015 GeneID:239739 MGI:2441659
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005765 - lysosomal membrane [Evidence IDA]; GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : dendritic cells-lysosome associated membrane glycoprotein product : lysosomal-associated membrane protein 3 protein_id : NP_796330.2

name	B3gnt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542177 CCDS:CCDS28040.1 GeneID:108105 MGI:2137302
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0008457 - beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl- ceramide beta-1,3-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0008917 - lipopolysaccharide N-acetylglucosaminyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0007417 - central nervous system development [Evidence ISS]; GO:0009247 - glycolipid biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence ISS]; GO:0030148 - sphingolipid biosynthesis [Evidence TAS] codon_start : 1 product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 protein_id : NP_473393.2

name	Igl-C1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:110785
definition	gene_synonym : Clambda1 standard_name : Igl-C1

name	Igl-V1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:16142
definition	gene_synonym : 1810027O01Rik; IgL standard_name : Igl-V1

name	Igl-V3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:404743
definition	gene_synonym : IGLV3 standard_name : Igl-V3

name	Igl-V2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:110612
definition	gene_synonym : IGLV2 standard_name : Igl-V2

name	Igl-J1 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:404737
definition	standard_name : Igl-J1

name	Igl-J3p (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:404741
definition	gene_synonym : IGLJ3P pseudo : _no_value standard_name : Igl-J3p

name	Igl-J3 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:404740
definition	gene_synonym : IGLJ3 standard_name : Igl-J3

name	Igl-J4 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:404742
definition	gene_synonym : IGLJ4 pseudo : _no_value standard_name : Igl-J4

name	Igl-J2 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:404739
definition	gene_synonym : IGLJ2 standard_name : Igl-J2

name	Igl-C3 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:110787
definition	standard_name : Igl-C3

name	Igl-C4 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:404736
definition	pseudo : _no_value standard_name : Igl-C4

name	Igl-C2 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:110786
definition	gene_synonym : IGLC2 standard_name : Igl-C2

name	Igl (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : Igl-x note : Region: immunoglobulin lambda enhancer Elambda3-1

name	Igl (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : Igl-x note : Region: immunoglobulin lambda enhancer Elambda2-4

name	LOC622795 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267435 GeneID:622795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2575 ESTs, 6 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_034800.1

name	LOC100043444 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267446 GeneID:100043444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 11 Proteins product : similar to peptidylprolyl isomerase D pseudo : _no_value transcript_id : XR_034814.1

clone name	MSMg01-153B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070G07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-125D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116A12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-088I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405D24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328J01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-073M14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-056O02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-537K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028B17
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-228P16.b	B6Ng01-228P16.g
ACC	GA042250	GA042251
length	1,161	1,098
definition	B6Ng01-228P16.b	B6Ng01-228P16.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctttttggtgctggggatcagatatactgccagggcctcacacat attagtcaaggttccagtactgagctatatagccaatcttcctgagatag ctgtgatcaaagactggctgtctgaggaggcagagcccatggagacagca ttaattatcttcagaatattaacatcattgttttactgatgaaacctgaa taaatttcaacttcctgattctcttcataaacctcatcctgaaatcacca actatcctttctgcatccatgcctgagagaagtcctctagtagctgggtt agggcctgtctaaataccaactgagttagactgtgttctaaaaaaagata ttattagggccacaaacctacagagacattatccaaacctttgttaactc catcttttcttgatttgtcacagatgaccctaagccccagccccacagct ttccagggcccctcctacttatccgagcgacataactagtgagtgctaat tctagagcttgtaggaaactggaaggctcctagaggtgaggtgaggtaaa atatggccccaaatacggagcatacccagcctcatagctgctcaacagtg tgggcaaccctaggccacccctgacacgcgcttagcatgacgcctgtcct cttgtacccatgccgttaccacctcatccgcactccatccaagtgctcac cgagtacacaaaggacttgagcagatgtctgctgagcagactcaaggatg ctggcttggaaaacagggtgacatctggagtgccctggaaaggggaagac agctgatcagaaagggctactagggggtgtggcttggcacttgcccgggt aaggaagtcttaccctccatgagtgagcagtagagaaaaagggccctggg aagtgacgaggttggtacagagacagcttggcgatggtctgttgtgtggc ttggaaggtgcttcttggcgagctctagactaaagtattagcttgttcta ggtttacttccttgaaacaaggcaagaacacagggccttatgttgatgct gttgggtactctttgtcttaaaattgccaagccaaccagaactgccttgt atccttggtttcaagaagggagttttagagagtaaaaatgtatatcttcc ctctcccccat	gaattctcacctgaggaataccgaatggcagagaagcacttgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaacccagagat tccacctcacaccagtcagaatggctaagatcaaaaactcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttggtg ggagtgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaactggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgccccaacaggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacctagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagggcatcatcctgagtgaggtaacacattcacaaa gaaactcacacaatatgtattcactgataagtggatattagccccaaacc taggatacccaagatataagatataatttgctaaacacatgaaactcaag aagaatgaagactgaagtgtggacactatgcccctccttagatttgggaa caaaacacccatggaaggagttacagagacggagtttggagctgagatga aaggatggaccatgtagagactgccatagccagggatccaccccataatc agcatccaaaacgctgacaccattgcatacactagcaagattttattgaa aggacgcagatgttagttgttttcttgtgagactatgcccggggccccag ctaaccacagaagttgatgctcacaggtcagcttaaatggatgggatcat agggctctcccaatgggagggagcctaggagaaatgtagcccaggagcta aagggattctggcaacccttataggtgggaaccaacatttatgaagctta accagtacccggggagctctttgactctagctgcatattattaattaa
quality values	Open. Hide. 41 19 27 37 58 58 58 58 58 58 62 62 47 39 47 62 54 62 62 62 62 24 31 47 47 51 54 42 42 22 13 25 10 19 14 13 11 13 22 23 24 28 32 44 45 62 62 62 59 62 62 62 62 59 56 62 59 59 59 59 62 59 59 62 62 59 62 59 62 59 62 62 62 62 59 49 34 34 27 35 34 23 28 35 46 54 43 49 56 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 56 49 62 62 49 54 62 62 62 62 62 56 62 62 62 43 43 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 56 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 48 52 62 62 62 62 42 62 62 62 62 54 28 28 43 62 62 62 62 62 52 54 62 62 43 62 62 62 62 52 62 62 42 54 54 52 58 54 54 52 54 54 58 41 38 54 54 54 39 52 52 54 54 58 52 58 46 54 58 47 54 54 54 58 48 54 52 58 58 58 58 54 58 54 52 52 58 58 54 58 54 52 54 54 58 58 39 58 54 58 58 58 54 54 58 54 58 58 58 54 40 58 47 54 50 42 47 54 52 52 54 45 46 50 58 52 58 54 58 58 47 41 41 58 33 50 58 49 46 40 49 58 46 51 53 47 58 50 53 58 49 58 53 39 49 58 48 29 51 58 54 54 38 36 34 25 41 37 39 50 54 53 58 52 50 48 58 42 50 52 41 51 58 49 50 53 45 53 37 39 51 35 51 49 37 48 36 39 42 30 48 32 47 40 50 42 53 40 51 51 36 48 37 23 43 50 52 54 25 54 31 26 40 37 53 53 53 50 28 38 51 40 51 21 50 39 21 50 37 53 50 28 35 31 58 39 28 50 41 52 51 40 23 58 39 30 17 53 58 58 40 37 42 18 49 38 24 42 27 24 32 45 53 39 22 44 47 24 40 53 31 49 49 37 53 38 38 50 10 15 49 40 42 39 50 14 34 18 30 40 42 40 42 34 25 32 34 21 25 49 14 25 46 47 40 30 32 33 34 13 6 25 40 37 41 31 37 35 37 41 26 33 46 35 31 26 31 22 13 7 19 11 36 33 29 32 31 21 13 9 9 40 24 33 18 40 15 8 11 33 13 47 33 31 28 52 22 31 32 35 7 14 29 47 15 18 9 11 21 25 5 19 12 25 51 45 51 32 30 46 12 12 45 39 31 30 22 27 31 32 15 27 32 30 31 9 51 24 51 29 32 18 14 9 18 28 18 18 41 15 31 31 17 9 12 10 15 13 46 27 18 38 23 26 25 9 26 13 9 12 46 31 29 31 28 34 31 14 28 31 16 14 15 12 31 26 35 26 31 42 18 10 19 27 27 12 27 11 29 9 31 32 31 30 23 6 16 32 7 16 46 9 8 5 9 6 13 12 9 14 12 21 34 18 11 48 6 8 6 33 13 42 19 20 9 9 17 20 29 25 6 7 24 31 25 10 11 9 15 19 5 5 14 6 8 31 8 6 15 15 20 44 31 9 10 42 21 21 10 11 8 8 7 21 20 27 11 16 11 8 10 16 26 24 7 10 18 13 17 14 32 9 28 6 7 12 10 10 47 36 7 5 6 10 13 20 25 7 16 4 9 31 33 6 13 20 13 27 19 7 10 27 7 10 27 12 27 6 6 9 7 9 4 7 9 21 10 24 16 7 15 8 19 28 25 6 23 13 9 5 23 29 17 6 3 10 7 5 10 8 20 21 22 34 16 21 3 10 9 12 16 11 11 14 13 20 4 3 4 8 6 6 19 24 26 18 14 5 3	Open. Hide. 62 36 43 47 62 62 62 47 56 37 39 10 14 7 6 18 19 16 13 16 20 27 30 40 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 59 62 62 62 59 62 56 62 59 62 43 38 36 38 34 46 43 43 46 48 48 49 46 62 54 54 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 59 62 62 62 54 54 50 54 43 54 59 62 62 59 49 59 62 62 62 59 59 59 62 62 62 59 59 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 54 54 59 56 62 62 62 59 62 62 62 62 59 51 62 62 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 59 59 51 51 59 59 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 56 59 59 56 62 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 51 62 56 48 54 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 56 62 59 59 59 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 46 34 50 50 59 59 59 56 59 62 44 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 59 62 56 62 59 59 56 45 59 62 56 56 62 47 62 62 62 51 56 56 56 56 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 56 62 47 47 62 62 62 62 62 62 62 56 62 47 39 62 62 54 47 62 62 51 62 62 62 62 62 47 62 62 62 62 62 50 47 44 43 56 56 62 62 62 41 41 62 62 62 54 62 62 62 62 54 47 62 41 43 39 56 56 56 56 47 54 62 62 47 42 56 62 62 42 41 62 54 52 54 52 52 52 54 62 54 47 62 43 62 62 51 62 62 54 62 62 62 52 54 42 45 35 47 52 50 54 62 62 53 62 54 52 10 16 13 15 13 18 58 48 39 41 49 47 58 52 54 28 45 54 35 42 48 52 48 30 34 33 37 42 41 32 24 52 28 29 40 52 54 54 42 38 28 52 52 50 52 52 52 21 39 10 14 22 26 54 45 58 42 54 54 53 54 54 42 42 42 40 37 50 54 52 54 52 52 54 54 48 34 23 58 52 33 58 46 42 46 47 51 50 47 27 50 58 47 48 43 40 53 35 38 41 47 50 27 48 50 32 52 51 50 35 39 43 49 50 42 25 38 47 32 50 26 58 37 23 47 30 29 46 35 14 27 32 32 39 50 46 49 48 37 31 51 51 51 22 6 41 44 21 51 34 20 50 13 22 43 31 46 50 21 48 49 26 50 58 16 48 44 58 32 35 49 39 51 32 50 28 23 53 54 31 15 58 35 21 50 53 35 26 41 29 16 32 33 33 27 37 35 24 32 42 53 32 52 39 53 42 34 51 37 19 15 44 54 40 35 18 18 25 15 40 40 16 19 23 10 11 11 13 16 31 33 31 17 19 31 13 49 49 18 35 31 29 21 29 21 13 32 51 37 24 54 22 35 35 15 38 18 29 16 37 39 21 21 31 29 26 23 18 7 54 49 42 24 45 39 38 26 46 8 16 33 30 32 20 37 15 6 32 25 31 12 11 7 6 9 9 16 13 6 5 9 13 32 33 22 13 16 32 21 40 16 30 21 21 11 16 32 15 35 32 32 10 9 31 32 24 27 8 18 9 8 10 6 13 14 27 21 10 33 10 9 16 6 8 8 13 35 31 28 32 20 26 18 7 13 15 13 15 13 18 8 21 17 29 13 15 18 30 21 19 23 46 27 31 31 23 21 28 12 7 40 12 6 14 7 17 10 42 26 13 31 32 32 37 9 25 9 35 21 35 14 16 6 21 8 7 8 17 21 19 31 33 6 8 31 32 27 26 31 12 15 6 15 25 24 16 30 14 20 13 10 32 28 12 20 20 14 19 9 13 29 16 7 13 41 37 14 9 6 13 6 9 10 9 9 23 24 15 31 9 13 16 11 14 9 37 31 14 9 11 15 21 19 18 14 9 13 10 8 13 13 29 11 11 21 21 9 25 5 30 32 11 32 7 19 11 9 13 11 10 18 22 21 20 21 21 28 7 8 14 12 10 10 7 5 5 9 17 12 11 10 7 9 7 9 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_18786162_18787294
seq2: B6Ng01-228P16.b_47_1207

seq1  GAATTCTTTTTGGTGCTGGGGATCAGATATACTGCCAGGGCCTCACACAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTTTGGTGCTGGGGATCAGATATACTGCCAGGGCCTCACACAT  50

seq1  ATTAGTCAAGGTTCCAGTACTGAGCTATATAGCCAATCTTCCTGAGATAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGTCAAGGTTCCAGTACTGAGCTATATAGCCAATCTTCCTGAGATAG  100

seq1  CTGTGATCAAAGACTGGCTGTCTGAGGAGGCAGAGCCCATGGAGACAGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGATCAAAGACTGGCTGTCTGAGGAGGCAGAGCCCATGGAGACAGCA  150

seq1  TTAATTATCTTCAGAATATTAACATCATTGTTTTACTGATGAAACCTGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATTATCTTCAGAATATTAACATCATTGTTTTACTGATGAAACCTGAA  200

seq1  TAAATTTCAACTTCCTGATTCTCTTCATAAACCTCATCCTGAAATCACCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATTTCAACTTCCTGATTCTCTTCATAAACCTCATCCTGAAATCACCA  250

seq1  ACTATCCTTTCTGCATCCATGCCTGAGAGAAGTCCTCTAGTAGCTGGGTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTATCCTTTCTGCATCCATGCCTGAGAGAAGTCCTCTAGTAGCTGGGTT  300

seq1  AGGGCCTGTCTAAATACCAACTGAGTTAGACTGTGTTCTAAAAAAAGATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCCTGTCTAAATACCAACTGAGTTAGACTGTGTTCTAAAAAAAGATA  350

seq1  TTATTAGGGCCACAAACCTACAGAGACATTATCCAAACCTTTGTTAACTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTAGGGCCACAAACCTACAGAGACATTATCCAAACCTTTGTTAACTC  400

seq1  CATCTTTTCTTGATTTGTCACAGATGACCCTAAGCCCCAGCCCCACAGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTTTTCTTGATTTGTCACAGATGACCCTAAGCCCCAGCCCCACAGCT  450

seq1  TTCCAGGGCCCCTCCTACTTATCCGAGCGACATAACTAGTGAGTGCTAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAGGGCCCCTCCTACTTATCCGAGCGACATAACTAGTGAGTGCTAAT  500

seq1  TCTAGAGCTTGTAGGAAACTGGAAGGCTCCTAGAGGTGAGGTGAGGTAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGAGCTTGTAGGAAACTGGAAGGCTCCTAGAGGTGAGGTGAGGTAAA  550

seq1  ATATGGCCCCAAATACGGAGCATACCCAGCCTCATAGCTGCTCAACAGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGGCCCCAAATACGGAGCATACCCAGCCTCATAGCTGCTCAACAGTG  600

seq1  TGGGCAACCCTAGGCCACCCCTGACACGCGCTTAGCATGACGCCTGTCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCAACCCTAGGCCACCCCTGACACGCGCTTAGCATGACGCCTGTCCT  650

seq1  CTTGTACCCATGCCGTTACCACCTCATCCGCACTCCATCCAAGTGCTCAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTACCCATGCCGTTACCACCTCATCCGCACTCCATCCAAGTGCTCAC  700

seq1  CGAGTACACAAAGGACTTGAGCAGATGTCTGCTGAGCAGACTCAAGGATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGTACACAAAGGACTTGAGCAGATGTCTGCTGAGCAGACTCAAGGATG  750

seq1  CTGGCTTGGAAAACAGGGTGACATCTGGAGTGCCCTGG-AAGGGGAAGAC  799
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  CTGGCTTGGAAAACAGGGTGACATCTGGAGTGCCCTGGAAAGGGGAAGAC  800

seq1  AGCTGATCAGAAGGGGCTACTAGGGGGTGTGGCTTGGCAC-TGCCCGGGT  848
      |||||||||||| ||||||||||||||||||||||||||| |||||||||
seq2  AGCTGATCAGAAAGGGCTACTAGGGGGTGTGGCTTGGCACTTGCCCGGGT  850

seq1  AAGGAAGTC-TAACCTCCATGAGTGAGCAGTAGAG-AAAAGGGCCCTGGG  896
      ||||||||| || |||||||||||||||||||||| ||||||||||||||
seq2  AAGGAAGTCTTACCCTCCATGAGTGAGCAGTAGAGAAAAAGGGCCCTGGG  900

seq1  AAGTGACGAGGTTGGTACAGAGACAGC-TGGCGATGGTCTGTTGTGTGGC  945
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  AAGTGACGAGGTTGGTACAGAGACAGCTTGGCGATGGTCTGTTGTGTGGC  950

seq1  TTGG-AGGTGCTTCTTGGCGAGCTCTAGACCAAGGTA-TAGCTTG-TCCA  992
      |||| ||||||||||||||||||||||||| || ||| ||||||| || |
seq2  TTGGAAGGTGCTTCTTGGCGAGCTCTAGACTAAAGTATTAGCTTGTTCTA  1000

seq1  GG-TTACT--CCTGAAACAGGGCA--GACACAGGG-CTTATG-TGATGCT  1035
      || |||||  | ||||||| ||||   |||||||| |||||| |||||| 
seq2  GGTTTACTTCCTTGAAACAAGGCAAGAACACAGGGCCTTATGTTGATGC-  1049

seq1  TGTTGGGTACTCTTGCT----AAAATGCCAAGGCCAAACAG-ACTG-CTT  1079
      ||||||||||||||  |    ||| |||||| ||||| ||| |||| |||
seq2  TGTTGGGTACTCTTTGTCTTAAAATTGCCAA-GCCAACCAGAACTGCCTT  1098

seq1  GATTCCT--GGTTCAAGAA-GGAG-TTTAG-GAGTAAAAATG--TATCTT  1122
      |  ||||  | |||||||| |||| ||||| |||||||||||  ||||||
seq2  GTATCCTTGGTTTCAAGAAGGGAGTTTTAGAGAGTAAAAATGTATATCTT  1148

seq1  --CTCTCCCCCAT  1133
        |||||||||||
seq2  CCCTCTCCCCCAT  1161

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information