MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-238L02
Chromosome	16 (Build37)
Map Location	33,230,469 - 33,322,718
singlet/doublet	doublet
Overlap gene	Osbpl11, Snx4
Upstream gene	Fbxo45, Wdr53, 2310010M20Rik, Rnf168, LOC666966, Ubxd7, Tm4sf19, 0610012D17Rik, Pcyt1a, Osta, Zdhhc19, LOC385820, Tfrc, Tnk2, ENSMUSG00000075265, LOC672302, Muc4, Muc20, 1700021K19Rik, Fyttd1, Lrch3, EG625660, Iqcg, Rpl35a, Lmln, LOC638791
Downstream gene	Zfp148, Slc12a8, 4632417D23Rik, Heg1, Muc13, Itgb5, Umps, Kalrn, LOC100043670
Link	Open Mouse BAC browser

Click to get alignment info.

name	Fbxo45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268882 MGI:2447775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68980 MGI:1916230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310010M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69576 MGI:1916826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 Proteins

name	Rnf168 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70238 MGI:1917488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666966 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 12 Proteins pseudo : _no_value

name	Ubxd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224111 MGI:2146388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 50 ESTs, 1 Protein

name	Tm4sf19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277203 MGI:3645933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	0610012D17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66061 MGI:1913311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcyt1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13026 MGI:88557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106407 MGI:2146634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245308 MGI:2682948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385820 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Tfrc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22042 MGI:98822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51789 MGI:1858308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000075265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:675921 MGI:3642140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC672302 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Muc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140474 MGI:2153525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Muc20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224116 MGI:2385039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700021K19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224118 MGI:1915160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fyttd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69823 MGI:1917955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrch3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70144 MGI:1917394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625660 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625660 MGI:3645568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 14 Proteins

name	Iqcg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69707 MGI:1916957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl35a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57808 MGI:1928894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lmln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239833 MGI:2444736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638791 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 4 Proteins

name	Osbpl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106326 MGI:2146553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69150 MGI:1916400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp148 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22661 MGI:1332234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc12a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171286 MGI:2443672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4632417D23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245843 MGI:3606087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Heg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77446 MGI:1924696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Muc13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17063 MGI:103190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16419 MGI:96614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Umps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22247 MGI:1298388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kalrn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545156 MGI:2685385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 95 ESTs, 13 Proteins

name	LOC100043670 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1433 ESTs, 6 Proteins

name	Fbxo45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56961626 GeneID:268882 MGI:2447775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 45 transcript_id : NM_173439.2

name	Wdr53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037134 GeneID:68980 MGI:1916230
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 53 transcript_id : NM_026898.1

name	2310010M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267324 GeneID:69576 MGI:1916826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 Proteins product : RIKEN cDNA 2310010M20 gene transcript_id : XM_001479637.1

name	Rnf168 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859693 GeneID:70238 MGI:1917488
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring fnger protein 168 transcript_id : NM_027355.1

name	Ubxd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267331 GeneID:224111 MGI:2146388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 50 ESTs, 1 Protein product : UBX domain containing 7 transcript_id : XM_619387.4

name	Tm4sf19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267343 GeneID:277203 MGI:3645933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : transmembrane 4 L six family member 19 transcript_id : XM_205829.7

name	0610012D17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803231 GeneID:66061 MGI:1913311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610012D17 gene transcript_id : NM_025329.2

name	Pcyt1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386747 GeneID:13026 MGI:88557
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphate cytidylyltransferase 1, choline, alpha isoform transcript_id : NM_009981.3

name	Osta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351565 GeneID:106407 MGI:2146634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : organic solute transporter alpha transcript_id : NM_145932.3

name	Zdhhc19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130915 GeneID:245308 MGI:2682948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 19 transcript_id : NM_199309.2

name	Tfrc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328492 GeneID:22042 MGI:98822
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transferrin receptor transcript_id : NM_011638.3

name	Tnk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349964 GeneID:51789 MGI:1858308
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine kinase, non-receptor, 2 transcript_id : NM_016788.2

name	ENSMUSG00000075265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267519 GeneID:675921 MGI:3642140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, ENSMUSG00000075265 transcript_id : XM_001480987.1

name	Muc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378014 GeneID:140474 MGI:2153525
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucin 4 transcript_id : NM_080457.2

name	Muc20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122564 GeneID:224116 MGI:2385039
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucin 20 transcript_id : NM_146071.1

name	1700021K19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366659 GeneID:224118 MGI:1915160
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700021K19 gene transcript_id : NM_172615.2

name	Fyttd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803191 GeneID:69823 MGI:1917955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forty-two-three domain containing 1 transcript_id : NM_027226.3

name	Lrch3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486938 GeneID:70144 MGI:1917394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeats and calponin homology (CH) domain containing 3 transcript_id : NM_001081255.1

name	EG625660 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400143 GeneID:625660 MGI:3645568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 14 Proteins product : predicted gene, EG625660 transcript_id : XM_894394.2

name	Iqcg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341642 GeneID:69707 MGI:1916957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing G transcript_id : NM_178378.2

name	Rpl35a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15042946 GeneID:57808 MGI:1928894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L35a transcript_id : NM_021338.2

name	Lmln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362513 GeneID:239833 MGI:2444736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leishmanolysin-like (metallopeptidase M8 family) transcript_id : NM_172823.2

name	LOC638791 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267359 GeneID:638791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 4 Proteins product : similar to TOM22 protein transcript_id : XM_001479700.1

name	Osbpl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341158 GeneID:106326 MGI:2146553
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 11 transcript_id : NM_176840.2

name	Snx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131100 GeneID:69150 MGI:1916400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 4 transcript_id : NM_080557.2

name	Zfp148 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33186874 GeneID:22661 MGI:1332234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 148 transcript_id : NM_011749.3

name	Slc12a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226222 GeneID:171286 MGI:2443672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 12 (potassium/chloride transporters), member 8 transcript_id : NM_134251.2

name	Slc12a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226247 GeneID:171286 MGI:2443672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 12 (potassium/chloride transporters), member 8 transcript_id : NM_001083902.1

name	4632417D23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373388 GeneID:245843 MGI:3606087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632417D23 gene transcript_id : NM_172934.2

name	Heg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50872130 GeneID:77446 MGI:1924696
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HEG homolog 1 (zebrafish) transcript_id : NM_175256.4

name	Muc13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754575 GeneID:17063 MGI:103190
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucin 13, epithelial transmembrane transcript_id : NM_010739.1

name	Itgb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754379 GeneID:16419 MGI:96614
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 5 transcript_id : NM_010580.1

name	Umps (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374909 GeneID:22247 MGI:1298388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uridine monophosphate synthetase transcript_id : NM_009471.2

name	Kalrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267521 GeneID:545156 MGI:2685385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 62 ESTs, 10 Proteins product : kalirin, RhoGEF kinase transcript_id : XM_001481028.1

name	Kalrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267523 GeneID:545156 MGI:2685385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 61 ESTs, 9 Proteins product : kalirin, RhoGEF kinase transcript_id : XM_001481029.1

name	LOC100043670 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267526 GeneID:100043670
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 mRNAs, 1433 ESTs, 6 Proteins product : similar to ribosomal protein L15 transcript_id : XM_001481037.1

name	Kalrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400144 GeneID:545156 MGI:2685385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 60 ESTs, 2 Proteins product : kalirin, RhoGEF kinase, transcript variant 3 transcript_id : XM_894473.2

name	Kalrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400145 GeneID:545156 MGI:2685385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 2 Proteins product : kalirin, RhoGEF kinase, transcript variant 10 transcript_id : XM_001001845.1

name	Fbxo45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56961627 CCDS:CCDS28117.1 GeneID:268882 MGI:2447775
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0045202 - synapse [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box protein 45 protein_id : NP_775615.2

name	Wdr53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037135 CCDS:CCDS28118.1 GeneID:68980 MGI:1916230
definition	codon_start : 1 product : WD repeat domain 53 protein_id : NP_081174.1

name	2310010M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267325 GeneID:69576 MGI:1916826
definition	codon_start : 1 product : hypothetical protein LOC69576 protein_id : XP_001479687.1

name	Rnf168 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859694 GeneID:70238 MGI:1917488
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ring fnger protein 168 protein_id : NP_081631.1

name	Ubxd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267332 GeneID:224111 MGI:2146388
definition	codon_start : 1 product : UBX domain containing 7 protein_id : XP_619387.3

name	Tm4sf19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267344 GeneID:277203 MGI:3645933
definition	codon_start : 1 product : similar to EF-hand Ca2+ binding protein p22 protein_id : XP_205829.5

name	0610012D17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426853 GeneID:66061 MGI:1913311
definition	codon_start : 1 product : hypothetical protein LOC66061 protein_id : NP_079605.1

name	Pcyt1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753552 CCDS:CCDS28120.1 GeneID:13026 MGI:88557
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0042587 - glycogen granule [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004105 - choline-phosphate cytidylyltransferase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0006656 - phosphatidylcholine biosynthesis [Evidence IMP] [Evidence IDA]; GO:0008654 - phospholipid biosynthesis [Evidence IEA]; GO:0009628 - response to abiotic stimulus [Evidence IDA] codon_start : 1 note : CTP phosphocholine cytidylyl transferase; CTP:phosphocholine cytidylyltransferase alpha product : phosphate cytidylyltransferase 1, choline, alpha isoform protein_id : NP_034111.1

name	Osta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122353 CCDS:CCDS28121.1 GeneID:106407 MGI:2146634
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005215 - transporter activity [Evidence IPI] GO_process : GO:0006810 - transport [Evidence IPI] codon_start : 1 product : organic solute transporter alpha protein_id : NP_666044.1

name	Zdhhc19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556290 CCDS:CCDS28122.1 GeneID:245308 MGI:2682948
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, DHHC domain containing 19 protein_id : NP_955013.1

name	Tfrc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11596855 CCDS:CCDS28123.1 GeneID:22042 MGI:98822
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence ISS]; GO:0005768 - endosome [Evidence IDA] [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005381 - iron ion transporter activity [Evidence TAS]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004998 - transferrin receptor activity [Evidence TAS] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006879 - iron ion homeostasis [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : mammary tumor virus receptor 1 product : transferrin receptor protein_id : NP_035768.1

name	Tnk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7948995 GeneID:51789 MGI:1858308
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043025 - cell soma [Evidence IDA]; GO:0030425 - dendrite [Evidence IDA]; GO:0030426 - growth cone [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : P21cdc42Hs kinase; activated p21cdc42Hs kinase; Cdc42 GTPase-inhibiting protein; non-receptor protein tyrosine kinase ACK product : tyrosine kinase, non-receptor, 2 protein_id : NP_058068.1

name	ENSMUSG00000075265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267520 GeneID:675921 MGI:3642140
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481037.1

name	Muc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378015 GeneID:140474 MGI:2153525
definition	codon_start : 1 product : mucin 4 protein_id : NP_536705.2

name	Muc20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122565 GeneID:224116 MGI:2385039
definition	GO_component : GO:0009925 - basal plasma membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000187 - activation of MAPK activity [Evidence IPI]; GO:0048012 - hepatocyte growth factor receptor signaling pathway [Evidence IDA]; GO:0051260 - protein homooligomerization [Evidence ISS] codon_start : 1 product : mucin 20 protein_id : NP_666183.1

name	1700021K19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369878 CCDS:CCDS28124.1 GeneID:224118 MGI:1915160
definition	codon_start : 1 product : hypothetical protein LOC224118 protein_id : NP_766203.1

name	Fyttd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541947 CCDS:CCDS28125.1 GeneID:69823 MGI:1917955
definition	codon_start : 1 product : forty-two-three domain containing 1 protein_id : NP_081502.2

name	Lrch3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486939 GeneID:70144 MGI:1917394
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine-rich repeats and calponin homology (CH) domain containing 3 protein_id : NP_001074724.1

name	EG625660 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82959184 GeneID:625660 MGI:3645568
definition	codon_start : 1 product : similar to SUMO-1-specific protease protein_id : XP_899487.1

name	Iqcg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410018 GeneID:69707 MGI:1916957
definition	codon_start : 1 product : IQ motif containing G protein_id : NP_848465.1

name	Rpl35a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15042947 CCDS:CCDS28126.1 GeneID:57808 MGI:1928894
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : ribosomal protein L35a protein_id : NP_067313.2

name	Lmln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370232 CCDS:CCDS28127.1 GeneID:239833 MGI:2444736
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : leishmanolysin-like (metallopeptidase M8 family) protein_id : NP_766411.1

name	LOC638791 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267360 GeneID:638791
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479750.1

name	Osbpl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849889 CCDS:CCDS28128.1 GeneID:106326 MGI:2146553
definition	GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : oxysterol binding protein-like 11 protein_id : NP_789810.1

name	Snx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18017596 CCDS:CCDS28129.1 GeneID:69150 MGI:1916400
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sorting nexin 4 protein_id : NP_542124.1

name	Zfp148 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756049 CCDS:CCDS28130.1 GeneID:22661 MGI:1332234
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007276 - gametogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : beta enolase repressor factor 1 product : zinc finger protein 148 protein_id : NP_035879.1

name	Slc12a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226223 GeneID:171286 MGI:2443672
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; cation-chloride cotransporter 9 product : solute carrier family 12, member 8 isoform 1 protein_id : NP_599012.2

name	Slc12a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226248 GeneID:171286 MGI:2443672
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; cation-chloride cotransporter 9 product : solute carrier family 12, member 8 isoform 2 protein_id : NP_001077371.1

name	4632417D23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370442 CCDS:CCDS28132.1 GeneID:245843 MGI:3606087
definition	codon_start : 1 product : hypothetical protein LOC245843 protein_id : NP_766522.1

name	Heg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50872131 CCDS:CCDS28133.1 GeneID:77446 MGI:1924696
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : HEG homolog 1 protein_id : NP_780465.3

name	Muc13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754576 CCDS:CCDS28134.1 GeneID:17063 MGI:103190
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : lymphocyte antigen 64 product : mucin 13, epithelial transmembrane protein_id : NP_034869.1

name	Itgb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754380 CCDS:CCDS28135.1 GeneID:16419 MGI:96614
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005178 - integrin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : integrin beta 5 protein_id : NP_034710.1

name	Umps (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859498 CCDS:CCDS28136.1 GeneID:22247 MGI:1298388
definition	GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004588 - orotate phosphoribosyltransferase activity [Evidence IEA]; GO:0004590 - orotidine-5'-phosphate decarboxylase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006207 - 'de novo' pyrimidine base biosynthesis [Evidence IEA]; GO:0009116 - nucleoside metabolism [Evidence IEA]; GO:0006221 - pyrimidine nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : uridine monophosphate synthetase protein_id : NP_033497.1

name	Kalrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267522 GeneID:545156 MGI:2685385
definition	codon_start : 1 product : kalirin, RhoGEF kinase protein_id : XP_001481078.1

name	Kalrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267524 GeneID:545156 MGI:2685385
definition	codon_start : 1 product : kalirin, RhoGEF kinase protein_id : XP_001481079.1

name	LOC100043670 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267527 GeneID:100043670
definition	codon_start : 1 product : similar to ribosomal protein L15 protein_id : XP_001481087.1

name	Kalrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82959198 GeneID:545156 MGI:2685385
definition	codon_start : 1 product : kalirin, RhoGEF kinase isoform 3 protein_id : XP_899566.1

name	Kalrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400146 GeneID:545156 MGI:2685385
definition	codon_start : 1 product : kalirin, RhoGEF kinase isoform 10 protein_id : XP_001001845.1

name	LOC385820 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385820
definition	number : 2 pseudo : _no_value

name	LOC385820 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385820
definition	number : 1 pseudo : _no_value

name	LOC672302 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672302
definition	number : 1 pseudo : _no_value

name	LOC666966 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267518 GeneID:666966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 12 Proteins product : similar to translocase of inner mitochondrial membrane 17 homolog B (yeast) pseudo : _no_value transcript_id : XR_034937.1

clone name	MSMg01-366D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-267O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372D20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-356N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075E24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-238L02.b	B6Ng01-238L02.g
ACC	GA049321	GA049322
length	658	885
definition	B6Ng01-238L02.b	B6Ng01-238L02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(33,322,061 - 33,322,718)	(33,230,469 - 33,231,342)
sequence	gaattcaagaactgacaatgatgttttcagtttctgtgctaagaagagta tgtgttgataaggagccatgtggccagagtggccagaaagcctaatctga aaaagtgacatcaactttgagatcaggaaatcaagagtcaggctaagtca ggtgaaaggatggggaagagggaacatcacgttcaaaggcccggccatgg caccccaagatcaaagcagcttcgtggacgctcacaaaagacttctcctc tgagggctagaagggctaaactatttttacccgtgatgtaaaagaagaac tctagagttcaatgcctgttggattggagcccatcgcaattagtacagag accatttaggaagctgttcatctgctcaggcaaggccagtggacgagcag agggtgctgacagtgaggtgcagcttctgtttaggagatgccatttcatg ttgtgtgaggcttaggggaccgggatcaaagctggtcctctcctttctga cctgagcagccagtggcaccacagagcacacataagacaaagattcatga attagctgagtgatgtccaaagaccctacaaaatccccagctgggaacgt tcgctatatggagctgggactctgcaggtacaggggttgcgggtgagggg gtgggggg	gaattcctaagccttttgcctcttcctaagcactggtctcacacgtatgt gccaccacactctgagtgatgcagtcctgagaaccgaacttaggctttct acatacaggggactgaggtaccttcctcagccccactgtatatctattga tactgtgagttaggccaagaaatcttttcttttgctttcaaaacaaatct tgtatttgaaatgaagccactgtgttctgaaagcctgcttgaattgtgga gatgtagaccttgctattatttttaccgcttgaatcagggtctctggcgt tcatgccaggcctgtcctgagcccagggtcctaactgaaacgctgaggtt acaagtacaccaccatgtctgctgaatgttgatctgcatcagtatctgca tgatactgttcagtttttaaaagtatttatattttatgtgcattggtgtt ttgcctgcatatatgtctgtgtgaaggtgtcagttacagatggttgtgaa ccactgtgttggtgctggaaatggaacccagttcctctggaagagcagcc agtgtgcttaactgttgagccagctctctagctccgaggcaaacactttt gagtttttatagatgtatttgtcttaagttgggataactgtttttatgta ggatagttaactattttggggatgttttttattgtctagacttactgtgt atgttttacctccgtgtatgaatgtgcaccacatgtgtgcctggtttcca agaagaatgaatgcatcaagttctctggaactggaattacaggtggttat tgagtcctcatgtgttgtgctgaacccaggtcttcttggaaaaactgcac gagctcttacctcttaagggattactcattcaggg
quality values	Open. Hide. 41 22 19 26 58 35 32 29 58 54 58 54 54 62 38 42 27 62 62 62 47 32 35 62 62 62 62 39 37 62 62 62 56 56 44 37 56 62 62 47 51 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 56 49 62 62 62 62 62 62 59 59 62 62 62 59 59 62 59 59 62 62 62 62 59 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 49 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 53 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 45 62 62 62 49 35 62 62 62 62 47 62 58 52 58 58 54 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 54 58 58 58 37 58 58 58 54 54 58 58 54 58 58 52 58 58 58 58 58 46 58 58 50 58 58 58 58 54 58 58 54 58 58 54 58 42 58 51 58 49 40 58 58 58 51 42 58 58 51 58 58 58 58 58 58 51 51 58 58 58 58 50 58 58 58 39 58 58 58 53 39 58 58 54 51 44 58 58 46 51 49 51 58 58 58 51 58 58 58 50 51 49 58 46 58 58 51 58 50 50 51 51 58 51 51 54 54 52 53 52 53 58 49 58 41 54 53 51 43 43 31 25 51 50 58 49 39 52 35 54 45 41 52 45 53 54 54 54 54 54 54 54 51 54 54 49 54 50 13 54 54 54 54 53 51 49 36 33 28 7	Open. Hide. 58 47 38 38 62 62 62 62 62 62 62 38 43 38 24 27 30 18 26 41 50 62 62 62 62 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 59 62 49 49 62 59 59 46 43 49 35 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 43 62 59 59 62 59 49 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 62 62 56 47 62 56 62 62 62 62 62 62 62 62 47 47 47 43 47 47 49 62 62 62 56 62 47 62 62 56 62 56 62 56 56 56 56 62 56 62 62 62 43 62 46 23 62 42 46 52 43 62 62 52 62 62 54 43 62 62 62 54 52 47 47 62 62 62 62 62 62 42 62 47 43 54 62 54 52 62 48 48 49 52 62 62 48 62 43 62 23 46 47 52 58 58 52 42 54 58 58 58 58 52 54 47 58 58 58 58 54 52 42 52 52 52 41 58 36 52 52 54 36 38 54 51 52 32 39 29 34 54 42 34 52 39 47 39 47 26 46 54 58 27 58 58 58 49 46 52 53 39 35 20 38 52 27 50 47 42 42 46 58 52 52 28 39 54 58 52 32 58 58 32 34 34 54 22 58 58 58 50 49 9 8 6 6 6 11 11 14 21 34 31 49 34 34 42 52 58 40 51 26 38 30 32 17 51 54 32 14 42 49 47 40 58 38 34 49 38 29 33 32 44 31 41 51 32 32 46 46 58 41 34 32 37 32 58 46 42 42 40 34 28 32 37 28 29 44 36 50 46 26 30 9 44 40 23 51 31 40 32 31 33 40 28 21 30 46 30 35 25 26 28 49 49 39 42 38 39 31 53 39 29 39 31 44 25 19 32 25 26 41 31 15 27 16 25 33 38 17 31 15 13 21 31 8 37 32 25 35 29 30 42 44 31 18 11 13 13 19 33 32 29 31 53 45 32 49 32 14 7 32 12 16 42 42 29 8 11 37 24 37 53 39 32 19 13 23 20 17 17 21 11 45 10 37 33 31 30 31 33 37 33 16 17 32 32 33 30 22 40 9 12 6 12 6 11 30 21 24 25 11 9 28 8 18 36

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_33322061_33322718
seq2: B6Ng01-238L02.b_44_701 (reverse)

seq1  CCCCCCACCCCCTCACCCGCAACCCCTGTACCTGCAGAGTCCCAGCTCCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCCACCCCCTCACCCGCAACCCCTGTACCTGCAGAGTCCCAGCTCCA  50

seq1  TATAGCGAACGTTCCCAGCTGGGGATTTTGTAGGGTCTTTGGACATCACT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGCGAACGTTCCCAGCTGGGGATTTTGTAGGGTCTTTGGACATCACT  100

seq1  CAGCTAATTCATGAATCTTTGTCTTATGTGTGCTCTGTGGTGCCACTGGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTAATTCATGAATCTTTGTCTTATGTGTGCTCTGTGGTGCCACTGGC  150

seq1  TGCTCAGGTCAGAAAGGAGAGGACCAGCTTTGATCCCGGTCCCCTAAGCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCAGGTCAGAAAGGAGAGGACCAGCTTTGATCCCGGTCCCCTAAGCC  200

seq1  TCACACAACATGAAATGGCATCTCCTAAACAGAAGCTGCACCTCACTGTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACACAACATGAAATGGCATCTCCTAAACAGAAGCTGCACCTCACTGTC  250

seq1  AGCACCCTCTGCTCGTCCACTGGCCTTGCCTGAGCAGATGAACAGCTTCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACCCTCTGCTCGTCCACTGGCCTTGCCTGAGCAGATGAACAGCTTCC  300

seq1  TAAATGGTCTCTGTACTAATTGCGATGGGCTCCAATCCAACAGGCATTGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATGGTCTCTGTACTAATTGCGATGGGCTCCAATCCAACAGGCATTGA  350

seq1  ACTCTAGAGTTCTTCTTTTACATCACGGGTAAAAATAGTTTAGCCCTTCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTAGAGTTCTTCTTTTACATCACGGGTAAAAATAGTTTAGCCCTTCT  400

seq1  AGCCCTCAGAGGAGAAGTCTTTTGTGAGCGTCCACGAAGCTGCTTTGATC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCTCAGAGGAGAAGTCTTTTGTGAGCGTCCACGAAGCTGCTTTGATC  450

seq1  TTGGGGTGCCATGGCCGGGCCTTTGAACGTGATGTTCCCTCTTCCCCATC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGGTGCCATGGCCGGGCCTTTGAACGTGATGTTCCCTCTTCCCCATC  500

seq1  CTTTCACCTGACTTAGCCTGACTCTTGATTTCCTGATCTCAAAGTTGATG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCACCTGACTTAGCCTGACTCTTGATTTCCTGATCTCAAAGTTGATG  550

seq1  TCACTTTTTCAGATTAGGCTTTCTGGCCACTCTGGCCACATGGCTCCTTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTTTTTCAGATTAGGCTTTCTGGCCACTCTGGCCACATGGCTCCTTA  600

seq1  TCAACACATACTCTTCTTAGCACAGAAACTGAAAACATCATTGTCAGTTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAACACATACTCTTCTTAGCACAGAAACTGAAAACATCATTGTCAGTTC  650

seq1  TTGAATTC  658
      ||||||||
seq2  TTGAATTC  658

seq1: chr16_33230469_33231342
seq2: B6Ng01-238L02.g_68_952

seq1  GAATTCCTAAGCCTTTTGCCTCTTCCTAAGCACTGGTCTCACACGTATGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTAAGCCTTTTGCCTCTTCCTAAGCACTGGTCTCACACGTATGT  50

seq1  GCCACCACACTCTGAGTGATGCAGTCCTGAGAACCGAACTTAGGCTTTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACCACACTCTGAGTGATGCAGTCCTGAGAACCGAACTTAGGCTTTCT  100

seq1  ACATACAGGGGACTGAGGTACCTTCCTCAGCCCCACTGTATATCTATTGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATACAGGGGACTGAGGTACCTTCCTCAGCCCCACTGTATATCTATTGA  150

seq1  TACTGTGAGTTAGGCCAAGAAATCTTTTCTTTTGCTTTCAAAACAAATCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGTGAGTTAGGCCAAGAAATCTTTTCTTTTGCTTTCAAAACAAATCT  200

seq1  TGTATTTGAAATGAAGCCACTGTGTTCTGAAAGCCTGCTTGAATTGTGGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTTGAAATGAAGCCACTGTGTTCTGAAAGCCTGCTTGAATTGTGGA  250

seq1  GATGTAGACCTTGCTATTATTTTTACCGCTTGAATCAGGGTCTCTGGCGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTAGACCTTGCTATTATTTTTACCGCTTGAATCAGGGTCTCTGGCGT  300

seq1  TCATGCCAGGCCTGTCCTGAGCCCAGGGTCCTAACTGAAACGCTGAGGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGCCAGGCCTGTCCTGAGCCCAGGGTCCTAACTGAAACGCTGAGGTT  350

seq1  ACAAGTACACCACCATGTCTGCTGAATGTTGATCTGCATCAGTATCTGCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTACACCACCATGTCTGCTGAATGTTGATCTGCATCAGTATCTGCA  400

seq1  TGATACTGTTCAGTTTTTAAAAGTATTTATATTTTATGTGCATTGGTGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATACTGTTCAGTTTTTAAAAGTATTTATATTTTATGTGCATTGGTGTT  450

seq1  TTGCCTGCATATATGTCTGTGTGAAGGTGTCAGTTACAGATGGTTGTGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCTGCATATATGTCTGTGTGAAGGTGTCAGTTACAGATGGTTGTGAA  500

seq1  CCACTGTGTTGGTGCTGGAAATGGAACCCAGTTCCTCTGGAAGAGCAGCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTGTGTTGGTGCTGGAAATGGAACCCAGTTCCTCTGGAAGAGCAGCC  550

seq1  AGTGTGCTTAACTGTTGAGCCAGCTCTCTAGCTCCGAGGCAAACACTTTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTGCTTAACTGTTGAGCCAGCTCTCTAGCTCCGAGGCAAACACTTTT  600

seq1  GAGTTTTTATAGATGTATTTGTCTTAAGTTGGGATAACTG-TTTTATGTA  649
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  GAGTTTTTATAGATGTATTTGTCTTAAGTTGGGATAACTGTTTTTATGTA  650

seq1  GGATAGTTAACTATTT--GGGATGTTTTT--ATCTCTAGACTTACTGTGT  695
      ||||||||||||||||  |||||||||||   | ||||||||||||||||
seq2  GGATAGTTAACTATTTTGGGGATGTTTTTTATTGTCTAGACTTACTGTGT  700

seq1  ATGTTTTACCTCCGTGTATGAATGTGCACCACATGTGTGCCTGGTTTCCA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTTTACCTCCGTGTATGAATGTGCACCACATGTGTGCCTGGTTTCCA  750

seq1  AGAAGAATGAATGCATCAAGTTCTCTGGAACTGGAATTACAGGTGGTTA-  794
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  AGAAGAATGAATGCATCAAGTTCTCTGGAACTGGAATTACAGGTGGTTAT  800

seq1  TGAGTCCTCATGTG-TGTGCTGAACCCAGGTCTTC-TGGAAAAACTGCAC  842
      |||||||||||||| |||||||||||||||||||| ||||||||||||||
seq2  TGAGTCCTCATGTGTTGTGCTGAACCCAGGTCTTCTTGGAAAAACTGCAC  850

seq1  GAGCTCTTACCTCTTAAGG--ATACTCA-TCAGGG  874
      |||||||||||||||||||   |||||| ||||||
seq2  GAGCTCTTACCTCTTAAGGGATTACTCATTCAGGG  885

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information