MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-256G09
Chromosome	16 (Build37)
Map Location	17,856,558 - 18,026,909
singlet/doublet	doublet
Overlap gene	Dgcr2, Tssk1, Tssk2, Es2el, Gscl, Slc25a1, Vpreb2
Upstream gene	Vpreb1, Top3b, Ppm1f, LOC100042783, EG623519, Mapk1, Ypel1, Ppil2, 2610318N02Rik, Sdf2l1, LOC623568, Ccdc116, 1810015A11Rik, Ube2l3, Gm603, Hic2, D16Bwg1494e, Pik4ca, Serpind1, Snap29, Crkl, Aifm3, Lztr1, Thap7, 4930451C15Rik, P2rxl1, Slc7a4, Smpd4, Pcqap, EG433050, Map1lc3-ps8, EG665892, LOC100042830, Klhl22, Scarf2, Car15
Downstream gene	Dgcr6, Prodh, Rtn4r, EG665975, Zdhhc8, Ranbp1, Htf9c, Dgcr8, D16H22S680E, LOC100042884, Arvcf, Comt, Txnrd2, Gnb1l, Tbx1, Gp1bb, Sept5, LOC622795, Cldn5, Cdc45l, Ufd1l, 2510002D24Rik, Mrpl40, Hira
Link	Open Mouse BAC browser

Click to get alignment info.

name	Vpreb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22362 MGI:98936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Top3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21976 MGI:1333803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppm1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68606 MGI:1918464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042783 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042783
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG623519 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623519 MGI:3647845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins

name	Mapk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26413 MGI:1346858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ypel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106369 MGI:1913303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppil2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66053 MGI:2447857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610318N02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70458 MGI:1917708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdf2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64136 MGI:2149842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein

name	Ccdc116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76872 MGI:1924122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810015A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69101 MGI:1916351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22195 MGI:109240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm603 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239731 MGI:2685449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hic2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58180 MGI:1929869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D16Bwg1494e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224019 MGI:107238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 1 Protein

name	Pik4ca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224020 MGI:2448506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpind1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15160 MGI:96051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snap29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67474 MGI:1914724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12929 MGI:104686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aifm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72168 MGI:1919418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lztr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66863 MGI:1914113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thap7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69009 MGI:1916259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930451C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74685 MGI:1921935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rxl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18440 MGI:1337113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224022 MGI:2146512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77626 MGI:1924876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcqap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94112 MGI:2137379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG433050 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433050 MGI:3644695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 71 ESTs, 9 Proteins

name	Map1lc3-ps8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606511
definition	note : microtubule-associated protein 1 light chain 3 pseudogene copy 8 pseudo : _no_value

name	EG665892 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665892 MGI:3646992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins pseudo : _no_value

name	LOC100042830 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Klhl22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224023 MGI:1337995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scarf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224024 MGI:1858430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80733 MGI:1931324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgcr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13356 MGI:892866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22114 MGI:1347557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tssk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22115 MGI:1347559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Es2el (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27886 MGI:107854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gscl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195333 MGI:892006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 Proteins

name	Slc25a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13358 MGI:1345283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vpreb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22363 MGI:98937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgcr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13353 MGI:1202877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prodh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19125 MGI:97770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtn4r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65079 MGI:2136886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665975 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665975 MGI:3647803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Zdhhc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27801 MGI:1338012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ranbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19385 MGI:96269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htf9c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15547 MGI:96270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Dgcr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94223 MGI:2151114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D16H22S680E (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27883 MGI:101825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042884 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Arvcf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11877 MGI:109620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Comt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12846 MGI:88470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnrd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26462 MGI:1347023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnb1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13972 MGI:1338057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tbx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21380 MGI:98493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gp1bb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14724 MGI:107852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sept5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18951 MGI:1195461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622795 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2575 ESTs, 6 Proteins pseudo : _no_value

name	Cldn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12741 MGI:1276112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc45l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12544 MGI:1338073
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ufd1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22230 MGI:109353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2510002D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72307 MGI:1919557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18100 MGI:1332635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hira (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15260 MGI:99430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vpreb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850237 GeneID:22362 MGI:98936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B lymphocyte gene 1 transcript_id : NM_016982.1

name	Top3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981463 GeneID:21976 MGI:1333803
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : topoisomerase (DNA) III beta transcript_id : NM_011624.2

name	Ppm1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802638 GeneID:68606 MGI:1918464
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1F (PP2C domain containing) transcript_id : NM_176833.3

name	EG623519 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400085 GeneID:623519 MGI:3647845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : predicted gene, EG623519 transcript_id : XM_979469.1

name	Mapk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579911 GeneID:26413 MGI:1346858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 1 transcript_id : NM_011949.3

name	Mapk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579908 GeneID:26413 MGI:1346858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 1 transcript_id : NM_001038663.1

name	Ypel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803381 GeneID:106369 MGI:1913303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yippee-like 1 (Drosophila) transcript_id : NM_023249.3

name	Ppil2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131059 GeneID:66053 MGI:2447857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase (cyclophilin)-like 2 transcript_id : NM_144954.2

name	2610318N02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274187 GeneID:70458 MGI:1917708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610318N02 gene transcript_id : NM_183287.2

name	Sdf2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982679 GeneID:64136 MGI:2149842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal cell-derived factor 2-like 1 transcript_id : NM_022324.2

name	LOC623568 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267406 GeneID:623568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein product : similar to ribosomal protein S20 transcript_id : XM_001480472.1

name	Ccdc116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037470 GeneID:76872 MGI:1924122
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 116 transcript_id : NM_029779.1

name	1810015A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356917 GeneID:69101 MGI:1916351
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810015A11 gene transcript_id : NM_026940.2

name	Ube2l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892277 GeneID:22195 MGI:109240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2L 3 transcript_id : NM_009456.2

name	Gm603 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345436 GeneID:239731 MGI:2685449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 603, (NCBI) transcript_id : NM_001033338.2

name	Hic2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70887766 GeneID:58180 MGI:1929869
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypermethylated in cancer 2 transcript_id : NM_178922.3

name	D16Bwg1494e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267414 GeneID:224019 MGI:107238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 1 Protein product : DNA segment, Chr 16, Brigham & Women's Genetics 1494 expressed transcript_id : XM_358773.6

name	Pik4ca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233837 GeneID:224020 MGI:2448506
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 4-kinase, catalytic, alpha polypeptide transcript_id : NM_001001983.1

name	Serpind1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59709438 GeneID:15160 MGI:96051
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade D, member 1 transcript_id : NM_008223.2

name	Snap29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948567 GeneID:67474 MGI:1914724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptosomal-associated protein transcript_id : NM_023348.4

name	Crkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384797 GeneID:12929 MGI:104686
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-crk sarcoma virus CT10 oncogene homolog (avian)-like transcript_id : NM_007764.3

name	Aifm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778908 GeneID:72168 MGI:1919418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 3 transcript_id : NM_175178.3

name	Lztr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385564 GeneID:66863 MGI:1914113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-zipper-like transcriptional regulator, 1 transcript_id : NM_025808.3

name	Thap7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130285 GeneID:69009 MGI:1916259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THAP domain containing 7 transcript_id : NM_026909.2

name	4930451C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354867 GeneID:74685 MGI:1921935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930451C15 gene transcript_id : NM_029053.2

name	P2rxl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754965 GeneID:18440 MGI:1337113
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X-like 1, orphan receptor transcript_id : NM_011028.1

name	Slc7a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371084 GeneID:224022 MGI:2146512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 transcript_id : NM_144852.3

name	Smpd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376053 GeneID:77626 MGI:1924876
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase 4 transcript_id : NM_029945.2

name	Pcqap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817038 GeneID:94112 MGI:2137379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : positive cofactor 2, multiprotein complex, glutamine/Q-rich-associated protein transcript_id : NM_001040683.1

name	Pcqap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100816769 GeneID:94112 MGI:2137379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : positive cofactor 2, multiprotein complex, glutamine/Q-rich-associated protein transcript_id : NM_033609.2

name	EG433050 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400083 GeneID:433050 MGI:3644695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 71 ESTs, 9 Proteins product : predicted gene, EG433050 transcript_id : XM_484573.4

name	LOC100042830 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267284 GeneID:100042830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100042830 transcript_id : XM_001478907.1

name	Klhl22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802617 GeneID:224023 MGI:1337995
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 22 (Drosophila) transcript_id : NM_145479.3

name	Scarf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803416 GeneID:224024 MGI:1858430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : scavenger receptor class F, member 2 transcript_id : NM_153790.2

name	Car15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981403 GeneID:80733 MGI:1931324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 15 transcript_id : NM_030558.2

name	Dgcr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816900 GeneID:13356 MGI:892866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DiGeorge syndrome critical region gene 2 transcript_id : NM_010048.2

name	Tssk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734850 GeneID:22114 MGI:1347557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 1 transcript_id : NM_009435.2

name	Tssk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734842 GeneID:22115 MGI:1347559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis-specific serine kinase 2 transcript_id : NM_009436.2

name	Es2el (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362980 GeneID:27886 MGI:107854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence 2 embryonic lethal transcript_id : NM_001081633.1

name	Es2el (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126362978 GeneID:27886 MGI:107854
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence 2 embryonic lethal transcript_id : NM_022408.2

name	Gscl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267418 GeneID:195333 MGI:892006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 27 Proteins product : goosecoid-like transcript_id : XM_001480613.1

name	Slc25a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943837 GeneID:13358 MGI:1345283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 transcript_id : NM_153150.1

name	Vpreb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850239 GeneID:22363 MGI:98937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre-B lymphocyte gene 2 transcript_id : NM_016983.1

name	Dgcr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347980 GeneID:13353 MGI:1202877
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DiGeorge syndrome critical region gene 6 transcript_id : NM_010047.2

name	Prodh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601003 GeneID:19125 MGI:97770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline dehydrogenase transcript_id : NM_011172.2

name	Rtn4r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371844 GeneID:65079 MGI:2136886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 4 receptor transcript_id : NM_022982.2

name	EG665975 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267286 GeneID:665975 MGI:3647803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG665975 transcript_id : XM_980665.2

name	Zdhhc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84619698 GeneID:27801 MGI:1338012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 8 transcript_id : NM_172151.3

name	Ranbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755283 GeneID:19385 MGI:96269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAN binding protein 1 transcript_id : NM_011239.1

name	Htf9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487416 GeneID:15547 MGI:96270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HpaII tiny fragments locus 9c transcript_id : NM_008307.2

name	Htf9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487420 GeneID:15547 MGI:96270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HpaII tiny fragments locus 9c transcript_id : NM_001081000.1

name	Htf9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487422 GeneID:15547 MGI:96270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HpaII tiny fragments locus 9c transcript_id : NM_001080999.1

name	Dgcr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41152098 GeneID:94223 MGI:2151114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DiGeorge syndrome critical region gene 8 transcript_id : NM_033324.2

name	D16H22S680E (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20070387 GeneID:27883 MGI:101825
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 16, human D22S680E, expressed transcript_id : NM_138583.1

name	LOC100042884 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267288 GeneID:100042884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042884 transcript_id : XM_001478994.1

name	Arvcf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254128 GeneID:11877 MGI:109620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat gene deleted in velo-cardio-facial syndrome transcript_id : NM_033474.2

name	Comt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352293 GeneID:12846 MGI:88470
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catechol-O-methyltransferase transcript_id : NM_007744.2

name	Txnrd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:102468564 GeneID:26462 MGI:1347023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin reductase 2 transcript_id : NM_013711.2

name	Gnb1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126273551 GeneID:13972 MGI:1338057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), beta polypeptide 1-like transcript_id : NM_001081682.1

name	Gnb1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126273561 GeneID:13972 MGI:1338057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), beta polypeptide 1-like transcript_id : NM_023120.4

name	Tbx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22094108 GeneID:21380 MGI:98493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 1 transcript_id : NM_011532.1

name	Gp1bb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50345974 GeneID:14724 MGI:107852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein Ib, beta polypeptide transcript_id : NM_010327.2

name	Gp1bb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50345975 GeneID:14724 MGI:107852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein Ib, beta polypeptide transcript_id : NM_001001999.1

name	Sept5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47132508 GeneID:18951 MGI:1195461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 5 transcript_id : NM_213614.1

name	Cldn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348145 GeneID:12741 MGI:1276112
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 5 transcript_id : NM_013805.3

name	Cdc45l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753365 GeneID:12544 MGI:1338073
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 45 homolog (S. cerevisiae)-like transcript_id : NM_009862.1

name	Ufd1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367932 GeneID:22230 MGI:109353
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin fusion degradation 1 like transcript_id : NM_011672.3

name	2510002D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432561 GeneID:72307 MGI:1919557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510002D24 gene transcript_id : NM_001033164.2

name	Mrpl40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754861 GeneID:18100 MGI:1332635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L40 transcript_id : NM_010922.1

name	Hira (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52426777 GeneID:15260 MGI:99430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone cell cycle regulation defective homolog A (S. cerevisiae) transcript_id : NM_010435.2

name	Vpreb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850238 CCDS:CCDS27989.1 GeneID:22362 MGI:98936
definition	GO_component : GO:0005886 - plasma membrane [Evidence IPI] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IPI] GO_process : GO:0030097 - hemopoiesis [Evidence IMP]; GO:0006955 - immune response [Evidence IPI] codon_start : 1 product : pre-B lymphocyte gene 1 protein_id : NP_058678.1

name	Top3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755851 CCDS:CCDS27990.1 GeneID:21976 MGI:1333803
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000793 - condensed chromosome [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003916 - DNA topoisomerase activity [Evidence IEA]; GO:0003917 - DNA topoisomerase type I activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0007059 - chromosome segregation [Evidence IMP]; GO:0006304 - DNA modification [Evidence IEA]; GO:0006265 - DNA topological change [Evidence IEA]; GO:0006268 - DNA unwinding during replication [Evidence IEA] codon_start : 1 note : Topo III beta product : topoisomerase (DNA) III beta protein_id : NP_035754.1

name	Ppm1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849881 CCDS:CCDS27991.1 GeneID:68606 MGI:1918464
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : calcium/calmodulin-dependent protein kinase phosphatase; partner of PIX2 product : protein phosphatase 1F (PP2C domain containing) protein_id : NP_789803.1

name	EG623519 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400086 GeneID:623519 MGI:3647845
definition	codon_start : 1 product : similar to Ribosomal protein S27a protein_id : XP_984563.1

name	Mapk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579909 CCDS:CCDS27992.1 GeneID:26413 MGI:1346858
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0004707 - MAP kinase activity [Evidence IDA] [Evidence IMP] [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0001784 - phosphotyrosine binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0019858 - cytosine metabolism [Evidence IDA]; GO:0000165 - MAPKKK cascade [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0018105 - peptidyl-serine phosphorylation [Evidence ISS]; GO:0016310 - phosphorylation [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IDA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 product : mitogen activated protein kinase 1 protein_id : NP_001033752.1

name	Mapk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754632 CCDS:CCDS27992.1 GeneID:26413 MGI:1346858
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0004707 - MAP kinase activity [Evidence IDA] [Evidence IMP] [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0001784 - phosphotyrosine binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0019858 - cytosine metabolism [Evidence IDA]; GO:0000165 - MAPKKK cascade [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0018105 - peptidyl-serine phosphorylation [Evidence ISS]; GO:0016310 - phosphorylation [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IDA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 product : mitogen activated protein kinase 1 protein_id : NP_036079.1

name	Ypel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17865319 GeneID:106369 MGI:1913303
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : cardiac Abnormality/abnormal facies (CATCH22), microdeletion syndrome product : yippee-like 1 protein_id : NP_075738.1

name	Ppil2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30025020 CCDS:CCDS27993.1 GeneID:66053 MGI:2447857
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence IEA] codon_start : 1 product : peptidylprolyl isomerase-like 2 protein_id : NP_659203.1

name	2610318N02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274188 GeneID:70458 MGI:1917708
definition	codon_start : 1 product : hypothetical protein LOC70458 protein_id : NP_899110.2

name	Sdf2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612505 GeneID:64136 MGI:2149842
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : stromal cell-derived factor 2-like 1 protein_id : NP_071719.1

name	LOC623568 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267407 GeneID:623568
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480522.1

name	Ccdc116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037471 CCDS:CCDS27995.1 GeneID:76872 MGI:1924122
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 116 protein_id : NP_084055.1

name	1810015A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63003923 CCDS:CCDS27996.1 GeneID:69101 MGI:1916351
definition	codon_start : 1 product : hypothetical protein LOC69101 protein_id : NP_081216.1

name	Ube2l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678481 CCDS:CCDS27997.1 GeneID:22195 MGI:109240
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0019899 - enzyme binding [Evidence ISS]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence ISS] [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence ISS] [Evidence IEA] codon_start : 1 note : ubiquitin-conjugating enzyme 7 product : ubiquitin-conjugating enzyme E2L 3 protein_id : NP_033482.1

name	Gm603 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701828 CCDS:CCDS27998.1 GeneID:239731 MGI:2685449
definition	codon_start : 1 product : hypothetical protein LOC239731 protein_id : NP_001028510.1

name	Hic2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887767 CCDS:CCDS27999.1 GeneID:58180 MGI:1929869
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hypermethylated in cancer 2 protein_id : NP_849253.2

name	D16Bwg1494e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267415 GeneID:224019 MGI:107238
definition	codon_start : 1 product : hypothetical protein LOC224019 protein_id : XP_358773.3

name	Pik4ca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50233838 GeneID:224020 MGI:2448506
definition	GO_function : GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphatidylinositol 4-kinase, catalytic, alpha polypeptide protein_id : NP_001001983.1

name	Serpind1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59709439 CCDS:CCDS28000.1 GeneID:15160 MGI:96051
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : heparin cofactor II; HC II; serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1 product : serine (or cysteine) proteinase inhibitor, clade D, member 1 protein_id : NP_032249.2

name	Snap29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948568 CCDS:CCDS28001.1 GeneID:67474 MGI:1914724
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_function : GO:0019905 - syntaxin binding [Evidence ISS] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : GS32 protein protein_id : NP_075837.3

name	Crkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542421 CCDS:CCDS28002.1 GeneID:12929 MGI:104686
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : v-crk avian sarcoma virus CT10 oncogene homolog-like product : v-crk sarcoma virus CT10 oncogene homolog (avian)-like protein_id : NP_031790.2

name	Aifm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778909 CCDS:CCDS28003.1 GeneID:72168 MGI:1919418
definition	codon_start : 1 product : apoptosis-inducing factor like protein_id : NP_780387.2

name	Lztr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229001 GeneID:66863 MGI:1914113
definition	codon_start : 1 product : leucine-zipper-like transcription regulator 1 protein_id : NP_080084.2

name	Thap7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076919 CCDS:CCDS28004.1 GeneID:69009 MGI:1916259
definition	GO_component : GO:0005694 - chromosome [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : THAP domain containing 7 protein_id : NP_081185.1

name	4930451C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625989 CCDS:CCDS28006.1 GeneID:74685 MGI:1921935
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74685 protein_id : NP_083329.1

name	P2rxl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754966 CCDS:CCDS28007.1 GeneID:18440 MGI:1337113
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004931 - ATP-gated cation channel activity [Evidence TAS]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : purinergic receptor P2X-like 1, orphan receptor protein_id : NP_035158.1

name	Slc7a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67845995 CCDS:CCDS28008.1 GeneID:224022 MGI:2146512
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 protein_id : NP_659101.2

name	Smpd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229251 CCDS:CCDS28009.1 GeneID:77626 MGI:1924876
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : neutral membrane (neutral sphingomyelinase-3) product : sphingomyelin phosphodiesterase 4 protein_id : NP_084221.1

name	Pcqap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817039 GeneID:94112 MGI:2137379
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : positive cofactor 2, glutamine/Q-rich-associated protein isoform b protein_id : NP_001035773.1

name	Pcqap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100816770 GeneID:94112 MGI:2137379
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : positive cofactor 2, glutamine/Q-rich-associated protein isoform a protein_id : NP_291087.2

name	EG433050 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82958980 GeneID:433050 MGI:3644695
definition	codon_start : 1 product : similar to ribosomal protein L26 protein_id : XP_484573.2

name	LOC100042830 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267285 GeneID:100042830
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478957.1

name	Klhl22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981790 GeneID:224023 MGI:1337995
definition	codon_start : 1 exception : mismatches in translation note : kelch-like product : kelch-like 22 protein_id : NP_663454.2

name	Scarf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418901 CCDS:CCDS28010.1 GeneID:224024 MGI:1858430
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence IDA] codon_start : 1 note : scavenger receptor type F; scavenger receptor expressed by endothelial cells 2 (acetyl LDL receptor like); scavenger receptor class F, member 1 product : scavenger receptor class F, member 2 protein_id : NP_722485.1

name	Car15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385334 GeneID:80733 MGI:1931324
definition	GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : carbonic anhydrase-like sequence 2 product : carbonic anhydrase 15 protein_id : NP_085035.1

name	Dgcr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816901 GeneID:13356 MGI:892866
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : DiGeorge syndrome gene c product : DiGeorge syndrome protein C protein_id : NP_034178.2

name	Tssk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734851 CCDS:CCDS28011.1 GeneID:22114 MGI:1347557
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : testis-specific serine/threonine kinase; serine/threonine kinase 22A (spermiogenesis associated) product : testis-specific serine kinase 1 protein_id : NP_033461.2

name	Tssk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734843 CCDS:CCDS28012.1 GeneID:22115 MGI:1347559
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0007283 - spermatogenesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : testis specific serine/ threonine kinase 2; serine/threonine kinase 22B (spermiogenesis associated) product : testis-specific serine kinase 2 protein_id : NP_033462.2

name	Es2el (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126362981 GeneID:27886 MGI:107854
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007399 - nervous system development [Evidence IEP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DiGeorge syndrome critical region protein 14 isoform 2 protein_id : NP_001075102.1

name	Es2el (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126362979 CCDS:CCDS28013.1 GeneID:27886 MGI:107854
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007399 - nervous system development [Evidence IEP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DiGeorge syndrome critical region protein 14 isoform 1 protein_id : NP_071853.2

name	Gscl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267419 GeneID:195333 MGI:892006
definition	codon_start : 1 product : goosecoid-like protein_id : XP_001480663.1

name	Slc25a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943838 CCDS:CCDS28014.1 GeneID:13358 MGI:1345283
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : DiGeorge syndrome gene j; tricarboxylate transport protein product : solute carrier family 25, member 1 protein_id : NP_694790.1

name	Vpreb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850240 CCDS:CCDS28015.1 GeneID:22363 MGI:98937
definition	codon_start : 1 note : Lambda 5 product : pre-B lymphocyte gene 2 protein_id : NP_058679.1

name	Dgcr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789014 CCDS:CCDS28016.1 GeneID:13353 MGI:1202877
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : DiGeorge syndrome chromosome region 6; DiGeorge syndrome critical region 6 product : DiGeorge syndrome critical region gene 6 protein_id : NP_034177.1

name	Prodh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601004 GeneID:19125 MGI:97770
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004657 - proline dehydrogenase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006537 - glutamate biosynthesis [Evidence IEA]; GO:0006562 - proline catabolism [Evidence IEA]; GO:0006560 - proline metabolism [Evidence IEA] codon_start : 1 product : proline dehydrogenase protein_id : NP_035302.2

name	Rtn4r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12667794 GeneID:65079 MGI:2136886
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007409 - axonogenesis [Evidence IDA] codon_start : 1 note : Nogo-66 receptor product : nogo receptor protein_id : NP_075358.1

name	EG665975 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267287 GeneID:665975 MGI:3647803
definition	codon_start : 1 product : similar to hCG1732289 protein_id : XP_985759.2

name	Zdhhc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84619699 CCDS:CCDS28017.1 GeneID:27801 MGI:1338012
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007610 - behavior [Evidence IMP] codon_start : 1 exception : mismatches in translation note : DHHC-containing protein 8 product : zinc finger, DHHC domain containing 8 protein_id : NP_742163.3

name	Ranbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755284 GeneID:19385 MGI:96269
definition	GO_component : GO:0005813 - centrosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0046907 - intracellular transport [Evidence IEA]; GO:0046604 - positive regulation of mitotic centrosome separation [Evidence IDA]; GO:0007051 - spindle organization and biogenesis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Htf9-a/RanBP1 product : RAN binding protein 1 protein_id : NP_035369.1

name	Htf9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487423 GeneID:15547 MGI:96270
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : HpaII tiny fragments locus 9c isoform 2 protein_id : NP_001074468.1

name	Htf9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487421 GeneID:15547 MGI:96270
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : HpaII tiny fragments locus 9c isoform 1 protein_id : NP_001074469.1

name	Htf9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487417 GeneID:15547 MGI:96270
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : HpaII tiny fragments locus 9c isoform 3 protein_id : NP_032333.2

name	Dgcr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41152099 CCDS:CCDS28018.1 GeneID:94223 MGI:2151114
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0035198 - miRNA binding [Evidence IC] GO_process : GO:0031053 - primary microRNA processing [Evidence ISS] codon_start : 1 product : DiGeorge syndrome critical region gene 8 protein_id : NP_201581.2

name	D16H22S680E (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070388 CCDS:CCDS28019.1 GeneID:27883 MGI:101825
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC27883 protein_id : NP_613049.1

name	LOC100042884 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267289 GeneID:100042884
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479044.1

name	Arvcf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254129 CCDS:CCDS28020.1 GeneID:11877 MGI:109620
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence TAS]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : armadillo repeat gene deleted in velo-cardio-facial syndrome protein_id : NP_258435.2

name	Comt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680982 CCDS:CCDS28021.1 GeneID:12846 MGI:88470
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016206 - catechol O-methyltransferase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0008171 - O-methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006584 - catecholamine metabolism [Evidence IEA]; GO:0042420 - dopamine catabolism [Evidence IDA]; GO:0042135 - neurotransmitter catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : catechol-O-methyltransferase protein_id : NP_031770.1

name	Txnrd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:102468565 GeneID:26462 MGI:1347023
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEP] [Evidence TAS] [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016654 - oxidoreductase activity, acting on NADH or NADPH, disulfide as acceptor [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008430 - selenium binding [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0000305 - response to oxygen radical [Evidence IMP] [Evidence TAS] codon_start : 1 note : human EST 573010; TR beta product : thioredoxin reductase 2 protein_id : NP_038739.2 transl_except : (pos:18477865..18477867,aa:Sec)

name	Gnb1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126273552 GeneID:13972 MGI:1338057
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0009898 - internal side of plasma membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS] codon_start : 1 product : guanine nucleotide binding protein (G protein), beta polypeptide 1-like protein_id : NP_001075151.1

name	Gnb1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662738 CCDS:CCDS28022.1 GeneID:13972 MGI:1338057
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0009898 - internal side of plasma membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS] codon_start : 1 product : guanine nucleotide binding protein (G protein), beta polypeptide 1-like protein_id : NP_075609.2

name	Tbx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094109 CCDS:CCDS28023.1 GeneID:21380 MGI:98493
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0001708 - cell fate specification [Evidence IMP] [Evidence IGI]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0007507 - heart development [Evidence IGI] [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0042474 - middle ear morphogenesis [Evidence IMP]; GO:0007517 - muscle development [Evidence IMP]; GO:0001755 - neural crest cell migration [Evidence IMP]; GO:0042473 - outer ear morphogenesis [Evidence IMP]; GO:0007389 - pattern specification [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : T-box 1 protein_id : NP_035662.1

name	Gp1bb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754040 GeneID:14724 MGI:107852
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0007599 - hemostasis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : glycoprotein Ib, beta polypeptide isoform 2 protein_id : NP_034457.1

name	Gp1bb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50345976 CCDS:CCDS28025.1 GeneID:14724 MGI:107852
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0007599 - hemostasis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : glycoprotein Ib, beta polypeptide isoform 1 protein_id : NP_001001999.1

name	Sept5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47132509 GeneID:18951 MGI:1195461
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS]; GO:0008021 - synaptic vesicle [Evidence ISS]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000910 - cytokinesis [Evidence ISS]; GO:0017157 - regulation of exocytosis [Evidence ISS]; GO:0016080 - synaptic vesicle targeting [Evidence ISS] codon_start : 1 note : cell division control related protein 1; peanut-like 1 homolog product : septin 5 protein_id : NP_998779.1

name	Cldn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980735 CCDS:CCDS28026.1 GeneID:12741 MGI:1276112
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS]; GO:0016337 - cell-cell adhesion [Evidence IC] codon_start : 1 note : transmembrane protein deleted in VCFS product : claudin 5 protein_id : NP_038833.2

name	Cdc45l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753366 CCDS:CCDS28027.1 GeneID:12544 MGI:1338073
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006270 - DNA replication initiation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cell division cycle 45-like product : cell division cycle 45 homolog (S. cerevisiae)-like protein_id : NP_033992.1

name	Ufd1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981443 CCDS:CCDS28028.1 GeneID:22230 MGI:109353
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin fusion degradation 1 like protein_id : NP_035802.2

name	2510002D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701660 CCDS:CCDS28029.1 GeneID:72307 MGI:1919557
definition	codon_start : 1 product : hypothetical protein LOC72307 protein_id : NP_001028336.1

name	Mrpl40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754862 CCDS:CCDS28030.1 GeneID:18100 MGI:1332635
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : nuclear localization signal protein absent in velo-cardio-facial patients product : mitochondrial ribosomal protein L40 protein_id : NP_035052.1

name	Hira (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52426778 CCDS:CCDS28031.1 GeneID:15260 MGI:99430
definition	GO_component : GO:0000790 - nuclear chromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007369 - gastrulation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TUP1-like enhancer of split gene 1 product : histone cell cycle regulation defective homolog A protein_id : NP_034565.2

name	LOC100042783 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042783
definition	number : 1 pseudo : _no_value

name	LOC100042783 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042783
definition	number : 2 pseudo : _no_value

name	EG665892 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94400090 GeneID:665892 MGI:3646992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins product : predicted gene, EG665892 pseudo : _no_value transcript_id : XR_001798.1

name	LOC622795 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267435 GeneID:622795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2575 ESTs, 6 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_034800.1

clone name	MSMg01-401E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070G07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-125D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116A12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-088I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405D24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402L04
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-318D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225B03
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-256G09.b	B6Ng01-256G09.g
ACC	GA062368	GA062369
length	1,134	1,125
definition	B6Ng01-256G09.b	B6Ng01-256G09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(18,025,788 - 18,026,909)	(17,856,558 - 17,857,684)
sequence	gaattcagatgcagctccctggcatgaaggatgctttgtcgaaaaacgct cctttctattgttttaattgatgcttattattacacagtatgactgcatt tggaatattggtccctataaattcatatgcctgatgctgacaccacatca gcataatggtctggctcaatcataatggcagcctcctgtgggtagaatag gaatctctaacttgaaaggctatgagagagaagtgagttaggatgtgtgc attctgagcacaaatggctatggtagtgtgctctcacaagaggctgagtc tgatgttccccaggttgtcttctgtggagggtgagatgccaagggaaact tggcaggcgttgtgcttacaaagttcactaaggtctacattgtgtgggct gcttgtccctacatatgctttgagatcttttatatatatatatatatata tatatatataaatatataatatacatgtatcatatatatatatcatatat acatatatatcaacagtagatacaactggtttaaggtcaaaaccagcaat tttaaaaaggaaatgtattctgaaactagttctaagtctatattcagtta aaaagtggacaacataaccttatcctggtaaggatggctcttgtcctctg atctcaggcttgatctgaatgtctgtctggggatctcaggtcactgctcc cctgtgtgccactctgagcatctatagtgtctggggacacagaaatgagg gagcaagggcaccttgtggggaagctatctaggactacaggcctttcctg ccctggagtgtgtcctcaagctccaaggccagccttcttttctccccaag gaggacacagtgggctacaaacagttaataatgtagaaaaataccattta aaccagacaaacccaagtatgtacacttatatcaccacaaaaaatgaaag gaacatagtaactcatgatcctgcccctcagagtaagttaagcccgagcc ctcgcgtttactgtgaattttattttttaattttgccctgtaccttggtt ggtcatgaccacaattgaaaagttcctacagaacctcagtagcctccaga accatggtgtctcccctcagagccacatcagggc	gaattcactcaaagcaggcagccaagaggaactaagttactaacccagct caacagttactaaggccctagacaatgcagaggtgccacaggcttttcaa gtccccaggtcattgttctcactcaatgtcttgaaaacactgaagccata aagcaagaatttcccctagcaggggaaagggaaccaggggtcaagaactc ctctatggctgcctgggccacagagctagaggtaaggtgggtgcttcaaa gcaccatgaggttggcgcctactggaggctgactcacttcttttacacag aaacgaagacttctcagagcagctctcggcgtgccagctgtggaggtcat ggtgcctcagggtaggaaagtggaaacactggagctgggcgcagaacacg ttgtcattctcagacatggcagaggcgaagatgggatctgggggcaggaa cacttctggggagcctgtaagggagactaaaggtgaggccagacatgcca agactttagcagattgtcacaaacagtcctccaggaggtcctagtgtcaa taggacaccaatcacagggctggaggactaccaaaagttagaggctgctg cagctctagagaaggccccggaaacacaggacctgaccacaaggcagcat gctggcccagggggccttctctgtaactcctccccacttccatgtgcctt gtcccactaggtgaaaggaggcagggagactccaacagtatcttctgaat cagggcagttccctgttttaaacttaacacccacaatacttacctttgaa tgccacttcccagcgaccttctaaggaatggttccggccagtaatgacat actgataaccaacccagagcctgcagaagacataaggaaaagcccttagt acctaggtaaacagccactgatgacctcatgtgtacacatgtacgtaatt tagaggactgaggacgtttgccttttcctggtcccaggggttcagttgca agcagtactctactcccgcaccacaaccgagttctccctttcgggggtac actagaatggagctttaactctactgggccccagccccatagaactggct tgccatacatgacttacctgaagtt
quality values	Open. Hide. 58 33 22 22 58 28 20 42 39 28 54 62 35 62 62 62 62 62 62 62 62 49 47 56 47 62 54 62 56 62 37 24 45 56 56 41 41 50 38 39 59 62 62 59 62 62 59 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 52 47 38 43 40 43 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 52 50 52 52 54 58 58 58 58 54 54 52 54 52 52 52 52 48 54 47 54 52 52 52 52 47 48 31 32 41 44 54 58 43 45 46 42 37 47 52 54 48 48 40 29 42 50 52 54 54 54 54 46 54 54 54 54 40 47 52 42 42 41 47 52 41 38 48 52 54 52 54 52 54 52 52 48 34 52 52 52 52 50 50 33 47 52 51 50 58 49 45 50 46 46 35 50 53 40 58 58 47 47 48 49 58 46 49 37 50 50 46 52 53 51 50 48 45 51 53 50 49 47 48 50 51 39 39 51 51 32 49 31 34 50 46 26 49 52 49 48 51 52 50 50 50 50 51 53 41 39 46 50 50 41 25 39 39 50 46 50 41 46 50 49 50 52 53 39 51 50 40 47 53 50 41 40 42 49 19 41 13 28 50 50 45 37 10 43 41 50 52 41 50 54 51 52 51 50 49 49 50 58 50 58 52 50 40 42 30 46 54 51 54 53 51 18 38 42 50 53 47 38 45 37 30 39 52 52 49 46 38 54 54 42 33 25 30 31 32 13 44 44 30 31 53 53 18 33 40 53 28 28 19 39 27 54 39 29 37 33 40 45 51 38 37 53 53 51 47 52 37 20 32 35 32 32 32 35 31 26 32 23 15 23 27 45 18 9 28 19 32 21 47 51 24 28 32 33 25 34 40 21 10 9 32 17 31 43 39 43 32 31 33 31 31 23 25 30 39 31 22 45 27 19 12 46 25 26 29 33 30 33 29 31 31 30 47 47 46 31 36 34 42 37 35 31 31 28 42 27 14 26 31 16 40 31 31 24 21 31 38 15 30 42 31 31 27 31 30 22 20 31 39 21 27 21 26 41 8 20 43 32 30 12 24 36 36 38 30 26 31 27 10 16 30 46 38 17 29 24 20 27 21 19 22 5 14 32 19 21 38 25 9 11 24 37 23 31 31 32 28 30 24 31 36 32 23 31 19 32 26 19 24 25 19 30 25 39 43 43 43 23 22 32 23 36 18 25 10 14 13 13 14 9 15 8 31 26 19 22 33 32 32 32 29 11 6 10 22 34 34 17 11 21 9 13 28 8 4 18 9 27 15 7 3 5 7 24 16 16 13 30 16 10 32 12 23 29 11 13 28 10 28 11 12 28 13 14 19 11 29 7 23 10 10 28 32 47 22 6 11 12 31 40 38 21 6 6 28 33 38 15 11 10 26 20 10 25 8 6 10 7 23 16 5 4 3 2 11 18 5 11 6 1 2 2 7 6 5 6 4 12 9 6 16 24 17 17 16 9 7 7 5 8 10 14 6 4 3 3 7 19 16 16 21 9 6 6 13 6 17 7 13 9 8 4 2 4 5 10 10 9 6 4 3 4 24 5 4 13 10 23 28 9 4 11 4 3 4 3 3 2 4 4 12 7 4 2 3 9 11 4	Open. Hide. 62 47 39 41 62 47 42 47 62 47 56 62 62 56 51 56 30 38 56 56 56 62 54 56 62 62 59 59 62 59 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 43 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 56 62 62 56 49 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 52 62 62 62 62 62 62 54 31 62 62 52 62 62 43 49 62 62 62 62 54 54 62 62 62 58 58 58 58 58 58 54 58 58 51 52 54 58 58 58 58 58 58 58 58 58 54 51 54 54 54 58 54 58 58 41 58 58 58 54 54 47 58 58 58 58 58 58 40 58 54 39 58 51 58 42 58 54 54 54 58 58 58 45 42 58 58 54 54 58 58 58 54 54 58 54 52 54 37 58 58 58 51 53 53 50 54 58 51 54 52 52 51 48 50 48 51 49 51 58 49 25 58 50 50 49 49 51 58 58 58 49 49 50 58 53 53 49 58 51 51 53 41 39 39 53 53 54 52 51 50 49 58 58 50 58 58 58 36 19 58 49 25 51 52 54 28 35 54 58 51 46 50 43 49 50 58 48 51 32 58 58 50 54 58 52 52 40 50 51 50 41 40 40 54 42 58 46 17 38 21 43 38 43 43 51 58 17 39 50 38 52 38 33 58 28 19 58 50 54 36 30 51 45 52 40 52 32 54 40 52 35 53 37 39 54 40 52 52 51 40 49 44 42 34 54 54 54 50 40 49 40 46 52 53 53 45 51 37 39 54 47 52 42 51 52 53 54 54 49 32 37 54 45 33 37 32 45 54 42 52 40 54 42 29 51 38 52 54 42 33 52 38 38 18 54 42 52 53 54 40 31 51 38 31 44 24 26 18 54 46 31 32 35 26 53 32 27 17 32 42 32 33 40 32 32 53 41 46 52 52 32 45 41 34 32 21 5 49 51 32 45 31 46 53 32 51 38 38 53 52 53 51 33 31 46 33 32 31 45 29 43 31 36 31 46 30 30 43 30 41 31 38 35 31 30 31 30 45 31 51 46 31 33 29 29 41 26 31 31 31 38 42 31 46 39 31 35 46 34 27 25 32 43 42 31 31 32 32 9 31 31 39 24 41 12 9 46 28 46 14 29 16 42 28 29 32 32 31 38 38 31 32 31 31 31 31 31 38 28 21 27 32 25 29 17 18 25 46 41 32 22 31 13 21 31 34 42 35 31 21 33 32 15 28 19 24 27 30 28 12 37 31 46 33 25 12 6 36 11 34 21 37 16 24 29 20 28 34 32 21 35 18 16 43 29 34 27 20 36 33 13 27 31 31 32 35 36 31 19 22 31 34 23 24 42 27 31 31 27 33 23 26 18 33 32 22 24 34 28 32 20 23 31 48 33 29 24 37 33 28 20 10 32 33 15 19 11 32 18 22 30 47 20 12 19 14 20 31 34 24 12 10 12 26 26 12 14 24 31 19 24 48 43 22 7 10 14 18 5 5 8 14 16 27 20 14 18 30 11 20 27 28 28 27 20 23 23 29 16 30 20 9 16 15 6 18 13 7 4 12 5 12 15 20 6 17 11 12 11 24 32 21 6 26 10 6 13 34 47 34 27 9 9 7 6 15 8 16 7 6 3 3 2 4 12 5 15 22 28 11 3 8 12 12 14 11 9 16 5 12 18 15 7 3 3 5 10 8 17 22 21 21 12 8 3 3 1 2 3 2 10 3 1 3 16 8 8 17 8 10 6 6 2 2 3 11 4 3 4 16 4 6 5 6 4 3 4 7 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_18025788_18026909
seq2: B6Ng01-256G09.b_47_1180 (reverse)

seq1  GCCCTG-TGTGGCTCT--GGGGAGACCACATGGTCCT-GAGGCTACTGAG  46
      |||||| |||||||||  ||||||||  |||||| || ||||||||||||
seq2  GCCCTGATGTGGCTCTGAGGGGAGACACCATGGTTCTGGAGGCTACTGAG  50

seq1  GTTCTGTAG--ACTTTTCA--TGTGTACATGA-CAAACAAAGTACA-GGC  90
      |||||||||  ||||||||  ||||  ||||| ||| ||| ||||| |||
seq2  GTTCTGTAGGAACTTTTCAATTGTGGTCATGACCAACCAAGGTACAGGGC  100

seq1  AAAATAAAAAAATAAAAATCACAGTAAACGCGA-GGCTC-GGCTTACCTT  138
      ||||| ||||||||||| ||||||||||||||| ||||| |||||| |||
seq2  AAAATTAAAAAATAAAATTCACAGTAAACGCGAGGGCTCGGGCTTAACTT  150

seq1  ACTCTGA-GGGCAGGATCATGAGTTACTTATGTTCCTTTCATTTTTTGTG  187
      ||||||| ||||||||||||||||||| ||||||||||||||||||||||
seq2  ACTCTGAGGGGCAGGATCATGAGTTAC-TATGTTCCTTTCATTTTTTGTG  199

seq1  GTGATATAAGTGTACATACTTGGGTTTGTTCTGGTTTAAATGGTATTTTT  237
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  GTGATATAAGTGTACATACTTGGGTTTG-TCTGGTTTAAATGGTATTTTT  248

seq1  CTACATTATTAACTGTTTGTAG-CCACTGTGTCCTCCTTGGGGAGAAAAG  286
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  CTACATTATTAACTGTTTGTAGCCCACTGTGTCCTCCTTGGGGAGAAAAG  298

seq1  AAGGCTGGCCTTGGAGCTTGAGGACACACTCCAGGGCAGGAAAGGCCTGT  336
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCTGGCCTTGGAGCTTGAGGACACACTCCAGGGCAGGAAAGGCCTGT  348

seq1  AGTCCTAGATAGCTTCCCCACAAGGTGCCCTTGCTCCCTCATTTCTGTGT  386
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCTAGATAGCTTCCCCACAAGGTGCCCTTGCTCCCTCATTTCTGTGT  398

seq1  CCCCAGACACTATAGATGCTCAGAGTGGCACACAGGGGAGCAGTGACCTG  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAGACACTATAGATGCTCAGAGTGGCACACAGGGGAGCAGTGACCTG  448

seq1  AGATCCCCAGACAGACATTCAGATCAAGCCTGAGATCAGAGGACAAGAGC  486
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCCCCAGACAGACATTCAGATCAAGCCTGAGATCAGAGGACAAGAGC  498

seq1  CATCCTTACCAGGATAAGGTTATGTTGTCCACTTTTTAACTGAATATAGA  536
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCCTTACCAGGATAAGGTTATGTTGTCCACTTTTTAACTGAATATAGA  548

seq1  CTTAGAACTAGTTTCAGAATACATTTCCTTTTTAAAATTGCTGGTTTTGA  586
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGAACTAGTTTCAGAATACATTTCCTTTTTAAAATTGCTGGTTTTGA  598

seq1  CCTTAAACCAGTTGTATCTACTGTTGATATATATGTATATATGATATATA  636
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTAAACCAGTTGTATCTACTGTTGATATATATGTATATATGATATATA  648

seq1  TATATGATACATGTATATTATATATTTATATATATATATATATATATATA  686
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATGATACATGTATATTATATATTTATATATATATATATATATATATA  698

seq1  TATATAAAAGATCTCAAAGCATATGTAGGGACAAGCAGCCCACACAATGT  736
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATAAAAGATCTCAAAGCATATGTAGGGACAAGCAGCCCACACAATGT  748

seq1  AGACCTTAGTGAACTTTGTAAGCACAACGCCTGCCAAGTTTCCCTTGGCA  786
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCTTAGTGAACTTTGTAAGCACAACGCCTGCCAAGTTTCCCTTGGCA  798

seq1  TCTCACCCTCCACAGAAGACAACCTGGGGAACATCAGACTCAGCCTCTTG  836
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCACCCTCCACAGAAGACAACCTGGGGAACATCAGACTCAGCCTCTTG  848

seq1  TGAGAGCACACTACCATAGCCATTTGTGCTCAGAATGCACACATCCTAAC  886
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGCACACTACCATAGCCATTTGTGCTCAGAATGCACACATCCTAAC  898

seq1  TCACTTCTCTCTCATAGCCTTTCAAGTTAGAGATTCCTATTCTACCCACA  936
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTTCTCTCTCATAGCCTTTCAAGTTAGAGATTCCTATTCTACCCACA  948

seq1  GGAGGCTGCCATTATGATTGAGCCAGACCATTATGCTGATGTGGTGTCAG  986
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGCTGCCATTATGATTGAGCCAGACCATTATGCTGATGTGGTGTCAG  998

seq1  CATCAGGCATATGAATTTATAGGGACCAATATTCCAAATGCAGTCATACT  1036
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCAGGCATATGAATTTATAGGGACCAATATTCCAAATGCAGTCATACT  1048

seq1  GTGTAATAATAAGCATCAATTAAAACAATAGAAAGGAGCGTTTTTCGACA  1086
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTAATAATAAGCATCAATTAAAACAATAGAAAGGAGCGTTTTTCGACA  1098

seq1  AAGCATCCTTCATGCCAGGGAGCTGCATCTGAATTC  1122
      ||||||||||||||||||||||||||||||||||||
seq2  AAGCATCCTTCATGCCAGGGAGCTGCATCTGAATTC  1134

seq1: chr16_17856558_17857684
seq2: B6Ng01-256G09.g_67_1191

seq1  GAATTCACTCAAAGCAGGCAGCCAAGAGGAACTAAGTTACTAACCCAGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTCAAAGCAGGCAGCCAAGAGGAACTAAGTTACTAACCCAGCT  50

seq1  CAACAGTTACTAAGGCCCTAGACAATGCAGAGGTGCCACAGGCTTTTCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAGTTACTAAGGCCCTAGACAATGCAGAGGTGCCACAGGCTTTTCAA  100

seq1  GTCCCCAGGTCATTGTTCTCACTCAATGTCTTGAAAACACTGAAGCCATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCCAGGTCATTGTTCTCACTCAATGTCTTGAAAACACTGAAGCCATA  150

seq1  AAGCAAGAATTTCCCCTAGCAGGGGAAAGGGAACCAGGGGTCAAGAACTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAAGAATTTCCCCTAGCAGGGGAAAGGGAACCAGGGGTCAAGAACTC  200

seq1  CTCTATGGCTGCCTGGGCCACAGAGCTAGAGGTAAGGTGGGTGCTTCAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTATGGCTGCCTGGGCCACAGAGCTAGAGGTAAGGTGGGTGCTTCAAA  250

seq1  GCACCATGAGGTTGGCGCCTACTGGAGGCTGACTCACTTCTTTTACACAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCATGAGGTTGGCGCCTACTGGAGGCTGACTCACTTCTTTTACACAG  300

seq1  AAACGAAGACTTCTCAGAGCAGCTCTCGGCGTGCCAGCTGTGGAGGTCAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACGAAGACTTCTCAGAGCAGCTCTCGGCGTGCCAGCTGTGGAGGTCAT  350

seq1  GGTGCCTCAGGGTAGGAAAGTGGAAACACTGGAGCTGGGCGCAGAACACG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCCTCAGGGTAGGAAAGTGGAAACACTGGAGCTGGGCGCAGAACACG  400

seq1  TTGTCATTCTCAGACATGGCAGAGGCGAAGATGGGATCTGGGGGCAGGAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCATTCTCAGACATGGCAGAGGCGAAGATGGGATCTGGGGGCAGGAA  450

seq1  CACTTCTGGGGAGCCTGTAAGGGAGACTAAAGGTGAGGCCAGACATGCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTCTGGGGAGCCTGTAAGGGAGACTAAAGGTGAGGCCAGACATGCCA  500

seq1  AGACTTTAGCAGATTGTCACAAACAGTCCTCCAGGAGGTCCTAGTGTCAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTTTAGCAGATTGTCACAAACAGTCCTCCAGGAGGTCCTAGTGTCAA  550

seq1  TAGGACACCAATCACAGGGCTGGAGGACTACCAAAAGTTAGAGGCTGCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGACACCAATCACAGGGCTGGAGGACTACCAAAAGTTAGAGGCTGCTG  600

seq1  CAGCTCTAGAGAAGGCCCCGGAAACACAGGACCTGACCACAAGGCAGCAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTCTAGAGAAGGCCCCGGAAACACAGGACCTGACCACAAGGCAGCAT  650

seq1  GCTGGCCCAGGGGGCCTTCTCTGTAACTCCTCCCCACTTCCATGTGCCTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGCCCAGGGGGCCTTCTCTGTAACTCCTCCCCACTTCCATGTGCCTT  700

seq1  GTCCCACTAGGTGAAAGGAGGCAGGGAGACTCCAACAGTATCTTCTGAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCACTAGGTGAAAGGAGGCAGGGAGACTCCAACAGTATCTTCTGAAT  750

seq1  CAGGGCAGTTCCCTGTTTTAAACTTAACACCCACAATACTTACCTTTGAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGCAGTTCCCTGTTTTAAACTTAACACCCACAATACTTACCTTTGAA  800

seq1  TGCCACTTCCCAGCGACCTTCTAAGGAATGGTTCCGGCCAGTAATGACAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCACTTCCCAGCGACCTTCTAAGGAATGGTTCCGGCCAGTAATGACAT  850

seq1  ACTGATAACCAACCCAGAGCCTGCAGAAGACATAAGGAAAAG-CCTTAGT  899
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  ACTGATAACCAACCCAGAGCCTGCAGAAGACATAAGGAAAAGCCCTTAGT  900

seq1  ACCTAGGTAAACAGCCACTGATGACCTCATGTGTACACATGTACGTAATT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTAGGTAAACAGCCACTGATGACCTCATGTGTACACATGTACGTAATT  950

seq1  TAGAGGACTGAGGACGTTTGCCTTTTCCTGGTCCCAGGGGTTCAAGTTTG  999
      ||||||||||||||||||||||||||||||||||||||||||||   |||
seq2  TAGAGGACTGAGGACGTTTGCCTTTTCCTGGTCCCAGGGGTTCA--GTTG  998

seq1  CAAAGCAAGTACTCTACTCCCGCACCACAA-CGAGTTCTCCC-TTCGGGG  1047
      | |||| ||||||||||||||||||||||| ||||||||||| |||||||
seq2  C-AAGC-AGTACTCTACTCCCGCACCACAACCGAGTTCTCCCTTTCGGGG  1046

seq1  GTACACTAGAATTGAGCTTTTAACTCTACTGG--CTCAGCCCCATAAGGA  1095
      |||||||||||| |||| ||||||||||||||  | ||||||||||  ||
seq2  GTACACTAGAATGGAGC-TTTAACTCTACTGGGCCCCAGCCCCATA--GA  1093

seq1  GCTGGTTTGCCATACATGACATAACTGAAGTT  1127
       |||| |||||||||||||| || ||||||||
seq2  ACTGGCTTGCCATACATGACTTACCTGAAGTT  1125

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information