MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-270M14
Chromosome	16 (Build37)
Map Location	91,372,797 - 91,512,189
singlet/doublet	doublet
Overlap gene	Ifnar2, Il10rb, Ifnar1
Upstream gene	Hunk, 2610039C10Rik, Mrap, 4921511H13Rik, 4931408A02Rik, LOC665863, 1110004E09Rik, 4930534H18Rik, Synj1, 1810007M14Rik, 4932438H23Rik, H3f3a-ps2, Olig2, Olig1
Downstream gene	LOC665939, LOC665947, Ifngr2, Tmem50b, ORF28, Gart, Son, Donson, Cryzl1, LOC100040653, Itsn1, Atp5o, Mrps6, Slc5a3, Kcne2, 1190017O12Rik, 4930563D23Rik, Kcne1, Dscr1, 2410124H12Rik, Clic6
Link	Open Mouse BAC browser

Click to get alignment info.

name	Hunk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26559 MGI:1347352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610039C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66578 MGI:1913828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77037 MGI:1924287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921511H13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207932 MGI:2146468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 101 ESTs, 4 Proteins

name	4931408A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70967 MGI:1918217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	1110004E09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68001 MGI:1915251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930534H18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68174 MGI:1915424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs

name	Synj1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104015 MGI:1354961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 227 ESTs, 6 Proteins

name	1810007M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67367 MGI:1914617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 92 ESTs, 5 Proteins

name	4932438H23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74387 MGI:1921637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H3f3a-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15080 MGI:1101758
definition	gene_synonym : MH-921 note : H3 histone, family 3A, pseudogene 2 pseudo : _no_value

name	Olig2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50913 MGI:1355331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olig1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50914 MGI:1355334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifnar2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15976 MGI:1098243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il10rb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16155 MGI:109380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifnar1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15975 MGI:107658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 9 Proteins pseudo : _no_value

name	LOC665947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 5 Proteins pseudo : _no_value

name	Ifngr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15980 MGI:107654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem50b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77975 MGI:1925225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ORF28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246738 MGI:2181053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gart (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14450 MGI:95654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Son (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20658 MGI:98353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Donson (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60364 MGI:1890621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cryzl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66609 MGI:1913859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040653 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Itsn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16443 MGI:1338069
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5o (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28080 MGI:106341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:121022 MGI:2153111
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53881 MGI:1858226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcne2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246133 MGI:1891123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190017O12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68936 MGI:1916186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930563D23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75328 MGI:1922578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcne1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16509 MGI:96673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dscr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54720 MGI:1890564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2410124H12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76785 MGI:1924035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Clic6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209195 MGI:2146607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hunk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131024 GeneID:26559 MGI:1347352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hormonally upregulated Neu-associated kinase transcript_id : NM_015755.2

name	2610039C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909368 GeneID:66578 MGI:1913828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610039C10 gene transcript_id : NM_025642.1

name	Mrap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376890 GeneID:77037 MGI:1924287
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanocortin 2 receptor accessory protein transcript_id : NM_029844.2

name	4921511H13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268185 GeneID:207932 MGI:2146468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 101 ESTs, 4 Proteins product : RIKEN cDNA 4921511H13 gene transcript_id : XM_489612.5

name	4931408A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625808 GeneID:70967 MGI:1918217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931408A02 gene transcript_id : NM_027627.1

name	1110004E09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956185 GeneID:68001 MGI:1915251
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110004E09 gene transcript_id : NM_026502.1

name	4930534H18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268193 GeneID:68174 MGI:1915424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs product : RIKEN cDNA 4930534H18 gene transcript_id : XM_001474847.1

name	Synj1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268188 GeneID:104015 MGI:1354961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 227 ESTs, 6 Proteins product : synaptojanin 1 transcript_id : XM_001481287.1

name	1810007M14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400755 GeneID:67367 MGI:1914617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 92 ESTs, 5 Proteins product : RIKEN cDNA 1810007M14 gene, transcript variant 1 transcript_id : XM_358888.5

name	4932438H23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802533 GeneID:74387 MGI:1921637
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932438H23 gene transcript_id : NM_028905.2

name	Olig2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858556 GeneID:50913 MGI:1355331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oligodendrocyte transcription factor 2 transcript_id : NM_016967.2

name	Olig1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59894798 GeneID:50914 MGI:1355334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oligodendrocyte transcription factor 1 transcript_id : NM_016968.4

name	Ifnar2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754299 GeneID:15976 MGI:1098243
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon (alpha and beta) receptor 2 transcript_id : NM_010509.1

name	Il10rb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361227 GeneID:16155 MGI:109380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 10 receptor, beta transcript_id : NM_008349.3

name	Ifnar1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754301 GeneID:15975 MGI:107658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon (alpha and beta) receptor 1 transcript_id : NM_010508.1

name	Ifngr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892283 GeneID:15980 MGI:107654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon gamma receptor 2 transcript_id : NM_008338.3

name	Tmem50b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802853 GeneID:77975 MGI:1925225
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 50B transcript_id : NM_030018.3

name	ORF28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149745 GeneID:246738 MGI:2181053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 28 transcript_id : NM_138664.1

name	Gart (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102414 GeneID:14450 MGI:95654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoribosylglycinamide formyltransferase transcript_id : NM_010256.2

name	Son (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358954 GeneID:20658 MGI:98353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Son cell proliferation protein transcript_id : NM_178880.4

name	Son (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378036 GeneID:20658 MGI:98353
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Son cell proliferation protein transcript_id : NM_019973.2

name	Donson (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29789129 GeneID:60364 MGI:1890621
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : downstream neighbor of SON transcript_id : NM_021720.1

name	Cryzl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21617846 GeneID:66609 MGI:1913859
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, zeta (quinone reductase)-like 1 transcript_id : NM_133679.1

name	LOC100040653 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268195 GeneID:100040653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100040653 transcript_id : XM_001475029.1

name	Itsn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288903 GeneID:16443 MGI:1338069
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intersectin 1 (SH3 domain protein 1A) transcript_id : NM_010587.2

name	Atp5o (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129975 GeneID:28080 MGI:106341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit transcript_id : NM_138597.2

name	Mrps6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956243 GeneID:121022 MGI:2153111
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S6 transcript_id : NM_080456.1

name	Slc5a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394315 GeneID:53881 MGI:1858226
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (inositol transporters), member 3 transcript_id : NM_017391.1

name	Kcne2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374181 GeneID:246133 MGI:1891123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, Isk-related subfamily, gene 2 transcript_id : NM_134110.2

name	1190017O12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358928 GeneID:68936 MGI:1916186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190017O12 gene transcript_id : NM_138743.2

name	4930563D23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461978 GeneID:75328 MGI:1922578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930563D23 gene transcript_id : NM_029252.2

name	Kcne1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227204 GeneID:16509 MGI:96673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, Isk-related subfamily, member 1 transcript_id : NM_008424.3

name	Dscr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125656175 GeneID:54720 MGI:1890564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Down syndrome critical region homolog 1 (human) transcript_id : NM_001081549.1

name	Dscr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125656174 GeneID:54720 MGI:1890564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Down syndrome critical region homolog 1 (human) transcript_id : NM_019466.3

name	2410124H12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268205 GeneID:76785 MGI:1924035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 2410124H12 gene transcript_id : XM_001475819.1

name	Clic6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366821 GeneID:209195 MGI:2146607
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride intracellular channel 6 transcript_id : NM_172469.2

name	Hunk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657216 CCDS:CCDS28315.1 GeneID:26559 MGI:1347352
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA] codon_start : 1 product : hormonally upregulated Neu-associated kinase protein_id : NP_056570.1

name	2610039C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909369 CCDS:CCDS28316.1 GeneID:66578 MGI:1913828
definition	codon_start : 1 product : 2610039C10Rik protein protein_id : NP_079918.1

name	Mrap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229245 CCDS:CCDS28317.1 GeneID:77037 MGI:1924287
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : fat cell-specific low molecular weight protein protein_id : NP_084120.1

name	4921511H13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268186 GeneID:207932 MGI:2146468
definition	codon_start : 1 product : hypothetical protein LOC207932 protein_id : XP_489612.5

name	4931408A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625809 CCDS:CCDS28319.1 GeneID:70967 MGI:1918217
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70967 protein_id : NP_081903.1

name	1110004E09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956186 CCDS:CCDS28321.1 GeneID:68001 MGI:1915251
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68001 protein_id : NP_080778.1

name	4930534H18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268194 GeneID:68174 MGI:1915424
definition	codon_start : 1 product : hypothetical protein LOC68174 protein_id : XP_001474897.1

name	Synj1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268189 GeneID:104015 MGI:1354961
definition	codon_start : 1 note : overriding stop codons product : similar to mKIAA0910 protein protein_id : XP_001481337.1 transl_except : (pos:complement(90940721..90940723),aa:OTHER)

name	1810007M14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268197 GeneID:67367 MGI:1914617
definition	codon_start : 1 product : GC-rich sequence DNA-binding factor candidate isoform 1 protein_id : XP_358888.5

name	4932438H23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19920334 CCDS:CCDS28322.1 GeneID:74387 MGI:1921637
definition	codon_start : 1 product : hypothetical protein LOC74387 protein_id : NP_083181.1

name	Olig2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858557 CCDS:CCDS28323.1 GeneID:50913 MGI:1355331
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0042552 - myelination [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0007399 - nervous system development [Evidence IDA]; GO:0048663 - neuron fate commitment [Evidence IMP]; GO:0048709 - oligodendrocyte differentiation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence ISS] [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : oligodendrocyte transcription factor 2 protein_id : NP_058663.2

name	Olig1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858559 CCDS:CCDS28324.1 GeneID:50914 MGI:1355334
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0048663 - neuron fate commitment [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence ISS] [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : oligodendrocyte transcription factor 1 protein_id : NP_058664.2

name	Ifnar2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754300 CCDS:CCDS28325.1 GeneID:15976 MGI:1098243
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0016021 - integral to membrane [Evidence TAS] GO_function : GO:0004905 - interferon-alpha/beta receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 exception : mismatches in translation note : type I interferon alpha/beta receptor 2a; type I interferon alpha/beta receptor 2a'; interferon receptor 2c product : interferon (alpha and beta) receptor 2 protein_id : NP_034639.1

name	Il10rb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607428 GeneID:16155 MGI:109380
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004920 - interleukin-10 receptor activity [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 note : interleukin 10 receptor 2 product : interleukin 10 receptor, beta protein_id : NP_032375.2

name	Ifnar1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754302 CCDS:CCDS28326.1 GeneID:15975 MGI:107658
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004904 - interferon receptor activity [Evidence IMP]; GO:0004637 - phosphoribosylamine-glycine ligase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0045351 - interferon type I biosynthesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : INF-a receptor product : interferon (alpha and beta) receptor 1 protein_id : NP_034638.1

name	Ifngr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680373 CCDS:CCDS28327.1 GeneID:15980 MGI:107654
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : interferon gamma receptor 2 protein_id : NP_032364.1

name	Tmem50b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313410 CCDS:CCDS28328.1 GeneID:77975 MGI:1925225
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 50B protein_id : NP_084294.1

name	ORF28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149746 GeneID:246738 MGI:2181053
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC246738 protein_id : NP_619605.1

name	Gart (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93102415 CCDS:CCDS28329.1 GeneID:14450 MGI:95654
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016742 - hydroxymethyl-, formyl- and related transferase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004637 - phosphoribosylamine-glycine ligase activity [Evidence IEA]; GO:0004641 - phosphoribosylformylglycinamidine cyclo-ligase activity [Evidence IEA]; GO:0004644 - phosphoribosylglycinamide formyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006189 - 'de novo' IMP biosynthesis [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0009113 - purine base biosynthesis [Evidence IEA]; GO:0006164 - purine nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : phosphoribosylglycinamide formyltransferase protein_id : NP_034386.2

name	Son (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358955 GeneID:20658 MGI:98353
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : Son cell proliferation protein protein_id : NP_849211.3

name	Son (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378037 GeneID:20658 MGI:98353
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : truncated isoform is encoded by transcript variant 2 product : Son cell proliferation protein truncated isoform protein_id : NP_064357.2

name	Donson (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789130 CCDS:CCDS28330.1 GeneID:60364 MGI:1890621
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : downstream neighbor of SON protein_id : NP_068366.1

name	Cryzl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21617847 GeneID:66609 MGI:1913859
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : crystallin, zeta (quinone reductase)-like 1 protein_id : NP_598440.1

name	LOC100040653 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268196 GeneID:100040653
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475079.1

name	Itsn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288904 GeneID:16443 MGI:1338069
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IDA] codon_start : 1 note : Eh domain, SH3 domain regulator of endocytosis 1; Intersectin-L; intersectin (SH3 domain protein 1A) product : intersectin 1 protein_id : NP_034717.2

name	Atp5o (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070412 CCDS:CCDS28331.1 GeneID:28080 MGI:106341
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0045261 - proton-transporting ATP synthase complex, catalytic core F(1) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit protein_id : NP_613063.1

name	Mrps6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956244 CCDS:CCDS28332.1 GeneID:121022 MGI:2153111
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S6 protein_id : NP_536704.1

name	Slc5a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394316 GeneID:53881 MGI:1858226
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0015798 - myo-inositol transport [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0043576 - regulation of respiratory gaseous exchange [Evidence IMP]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sodium myo-inositol transporter 1; Na(+)/myo-inositol cotransporter; solute carrier family 5, member alpha 3; solute carrier family 5, member 3 product : solute carrier family 5 (inositol transporters), member 3 protein_id : NP_059087.1

name	Kcne2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19882205 CCDS:CCDS28333.1 GeneID:246133 MGI:1891123
definition	GO_function : GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : minK-related peptide 1; minimum potassium ion channel related peptide 1 product : potassium voltage-gated channel, Isk-related subfamily, gene 2 protein_id : NP_598871.1

name	1190017O12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270271 GeneID:68936 MGI:1916186
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC68936 protein_id : NP_620082.1

name	4930563D23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794180 CCDS:CCDS28335.1 GeneID:75328 MGI:1922578
definition	codon_start : 1 product : hypothetical protein LOC75328 protein_id : NP_083528.1

name	Kcne1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680528 CCDS:CCDS28336.1 GeneID:16509 MGI:96673
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0002070 - epithelial cell maturation [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium voltage-gated channel, Isk-related subfamily, member 1 protein_id : NP_032450.1

name	Dscr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125656176 GeneID:54720 MGI:1890564
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0019722 - calcium-mediated signaling [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; myocyte-enriched calcineurin interactin protein 1; calcineurin inhibitor; calcipressin 1 product : calcipressin 1 isoform 1 protein_id : NP_001075018.1

name	Dscr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542574 CCDS:CCDS28337.1 GeneID:54720 MGI:1890564
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0019722 - calcium-mediated signaling [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; myocyte-enriched calcineurin interactin protein 1; calcineurin inhibitor; calcipressin 1 product : calcipressin 1 isoform 2 protein_id : NP_062339.2

name	2410124H12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268206 GeneID:76785 MGI:1924035
definition	codon_start : 1 product : hypothetical protein LOC76785 protein_id : XP_001475869.1

name	Clic6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369633 CCDS:CCDS28338.1 GeneID:209195 MGI:2146607
definition	GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : chloride intracellular channel 6 protein_id : NP_766057.1

name	LOC665863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665863
definition	number : 1 pseudo : _no_value

name	LOC665863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665863
definition	number : 2 pseudo : _no_value

name	LOC665939 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268192 GeneID:665939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 9 Proteins product : similar to cell division cycle 20 homolog (S. cerevisiae) pseudo : _no_value transcript_id : XR_032021.1

name	LOC665947 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268202 GeneID:665947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 5 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_032076.1

clone name	MSMg01-293N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086B15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-512O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388H22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-266F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019N06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-270M14.b	B6Ng01-270M14.g
ACC	GA073038	GA073039
length	1,167	539
definition	B6Ng01-270M14.b	B6Ng01-270M14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(91,372,797 - 91,373,977)	(91,511,645 - 91,512,189)
sequence	atcctcctgccaaggccttcctggaagaagagagtacacacccgcatcac taggccaggcacccaacccattcgtatccagttagttctagggatcaggc actacctagtcctccaaggaggcagcgataaacacaacaaccccgatccg ttaactctggctccctggactgtacttgaagtgggtggggtcgtaatgga tgcgaaagtgcccatttgtcgccggctccgcccgggccccgcctctcgcc tcgttctctgttcaccgctaaccccgcggctgggaacccttggcctccgg gagcctgcgtggtctagccctagaccaggggaaaccaggctgccagcgga gactcttcgggtcgcggggcaccggccatcccgccgccgtccctttcgcc tggctcggctcccgcctgcctccactgctcgccagccgcgcgcagctgcg cctgatgcccagagcagctcggaggtggccccaggacatcccagaggggg attcacgagacccggcgattcaggtactgtactgcgggcattacggggac atgaatgggtgtcgctcgcctcgcggacagtaggactgggccgcctcccc gctgccagttcccggaatccccttttcaattctcctcttcgggactccgc ctcttcctgcctttcttccgtggagagtctgaggattctagctcccccga cccacaagctgcgtatggggggccctcgtggcccccgcatgggcgccttc ctttcaccgttcctttggtgaactctgggtttttgtgggctctctgcctt cactccaccagcgtcgcctcaccgagggtgcatggggcaccttagcccga gccattgccagatcctagggggtccacattccttaggatccactacgcct tgccaagctagttatcatctccagcctctgggttctgttctgcgtctgac accctccccttaacacacaccacacacacacacacacacacacacacaca cacacacacacacctgcgcgcctgaaacttacctaaggtcccagggatcg tttgttcagctcttacgaggtcactgaggtgtgacccgcagagatgccag gaatggaatacagaaggcactgataatggttagccttgcatttcttattc aagccagccaagtagtg	cttcttgcctttgttcctccaggtggagaaaaagacttatcccagtaaaa aagcattccatcacagaaatccatgtgtattacgcatgccctcaagacca gcaattctgtgatcactgtaagcctgagaagagttgtaagaaaaagctga atggggcctggggacactgcccaccggacaagtgcttggtgtgcaagtgt gaagtcctgagtacaaacctccaatacctaacaaaaaagccagacttcac tgttcatacccagtcctagcattgggcacagacagggagattcccagagc ttactggtcaaccagctaaggcagaatggtgagcttcctctcctgtgaga ggtcttgtttcaagacgatagggtggaggacaacatcctatgtttacctt cacatgtgcgcatgggtacggacatgtgtgacacctgtgtactcacattc ctgctcaggagtgtgcacacccatgtgtacagcacagcagacacacaggg gtgggggagagcgagagggggagggacaggggaagagcg
quality values	Open. Hide. 31 27 62 62 62 62 62 62 62 62 26 21 62 62 62 62 62 62 62 62 62 62 62 59 44 46 43 62 38 32 62 50 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 42 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 59 54 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 54 54 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 49 35 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 54 43 54 54 58 49 58 58 42 35 58 58 58 58 54 58 49 45 46 58 58 58 58 58 58 54 49 58 58 54 41 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 54 54 58 54 58 54 58 58 58 45 49 54 54 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 53 58 58 47 38 33 50 51 53 53 38 58 45 39 58 58 58 58 58 58 50 58 58 51 51 58 58 58 54 58 51 51 58 49 46 52 58 53 52 58 51 54 51 58 41 50 48 43 43 46 58 58 58 54 46 47 39 51 58 50 49 53 53 51 41 54 49 52 38 58 58 41 40 53 52 58 50 58 58 50 50 51 51 36 51 50 54 50 54 51 58 51 40 52 52 38 54 52 52 49 40 44 23 58 50 42 52 50 53 39 8 49 33 21 50 41 49 51 50 50 49 42 46 28 26 49 35 39 24 28 39 37 40 47 33 35 51 53 53 52 38 33 42 42 39 54 54 54 54 49 32 54 54 49 40 35 29 51 51 26 46 42 44 49 44 46 45 42 39 49 42 47 33 35 45 42 40 37 52 52 54 39 35 35 46 49 41 32 41 37 47 33 49 39 47 33 32 41 31 20 22 35 37 32 35 49 47 41 49 49 49 45 53 32 51 52 37 31 32 31 32 32 32 41 34 32 33 34 40 31 29 39 31 31 31 26 30 31 26 45 31 37 43 31 43 46 33 35 31 30 33 26 31 13 46 33 31 42 28 24 31 31 46 46 51 30 22 22 31 30 33 26 23 46 41 38 31 37 21 30 27 26 33 18 26 33 30 29 29 32 24 28 30 31 9 13 36 47 46 37 24 35 30 18 29 26 27 41 21 21 18 32 27 7 31 27 21 18 25 18 29 32 34 32 21 23 25 22 18 27 19 23 14 23 22 31 25 35 19 19 19 27 22 24 21 31 32 34 15 31 29 34 21 21 26 31 30 29 44 33 8 8 44 15 24 14 22 23 26 31 27 24 28 34 7 25 32 19 14 30 33 25 32 30 24 19 25 14 16 7 4 14 29 12 19 9 5 4 4 9 17 11 14 13 6 10 11 14 11 16 14 11 17 21 16 12 16 20 19 10 10 20 15 9 10 10 6 7 9 10 15 9 7 10 13 11 11 6 12 4 3 3 8 17 6 16 14 9 3 3 3 3 11 34 5 3 3 13 18 15 15 14 7 6 7 9 14 14 34 14 12 8 27 7 28 20 24 10 15 28 11 8 7 14 21 25 13 21 15 24 4 7 8 18 9 25 5 16 7 14 16 7 8 6 3 3 3 2 3 4 3 1 3 26 18 9 20 12 4 9 3 6 5 14 3 5 10 9 17 6 10 11 21 17 4 6 7 8 15 8 21 18 17 3 7 4 7 6 6 4 3 5 1 3 16 7 13 4 4 20 16 7 8 8 8 7 14 11 17 16 10 10 5 5 5 17 12 14 6 4 4 5 7 5 3 3 4 9 2 1 1 2 2 4 7	Open. Hide. 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 62 59 59 62 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 59 59 62 59 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 59 59 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 54 58 58 58 58 49 58 58 58 58 41 41 58 58 41 51 58 58 51 58 58 58 45 58 58 58 58 58 58 58 58 34 46 58 58 58 51 58 58 45 34 49 33 11 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_91372797_91373977
seq2: B6Ng01-270M14.b_52_1218

seq1  ATCCTCCTGCCAAGGCCTTCCTGGAAGAAGAGAGTACACACCCGCATCAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTCCTGCCAAGGCCTTCCTGGAAGAAGAGAGTACACACCCGCATCAC  50

seq1  TAGGCCAGGCACCCAACCCATTCGTATCCAGTTAGTTCTAGGGATCAGGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGCCAGGCACCCAACCCATTCGTATCCAGTTAGTTCTAGGGATCAGGC  100

seq1  ACTACCTAGTCCTCCAAGGAGGCAGCGATAAACACAACAACCCCGATCCG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTACCTAGTCCTCCAAGGAGGCAGCGATAAACACAACAACCCCGATCCG  150

seq1  TTAACTCTGGCTCCCTGGACTGTACTTGAAGTGGGTGGGGTCGTAATGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACTCTGGCTCCCTGGACTGTACTTGAAGTGGGTGGGGTCGTAATGGA  200

seq1  TGCGAAAGTGCCCATTTGTCGCCGGCTCCGCCCGGGCCCCGCCTCTCGCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCGAAAGTGCCCATTTGTCGCCGGCTCCGCCCGGGCCCCGCCTCTCGCC  250

seq1  TCGTTCTCTGTTCACCGCTAACCCCGCGGCTGGGAACCCTTGGCCTCCGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTTCTCTGTTCACCGCTAACCCCGCGGCTGGGAACCCTTGGCCTCCGG  300

seq1  GAGCCTGCGTGGTCTAGCCCTAGACCAGGGGAAACCAGGCTGCCAGCGGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCTGCGTGGTCTAGCCCTAGACCAGGGGAAACCAGGCTGCCAGCGGA  350

seq1  GACTCTTCGGGTCGCGGGGCACCGGCCATCCCGCCGCCGTCCCTTTCGCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCTTCGGGTCGCGGGGCACCGGCCATCCCGCCGCCGTCCCTTTCGCC  400

seq1  TGGCTCGGCTCCCGCCTGCCTCCACTGCTCGCCAGCCGCGCGCAGCTGCG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTCGGCTCCCGCCTGCCTCCACTGCTCGCCAGCCGCGCGCAGCTGCG  450

seq1  CCTGATGCCCAGAGCAGCTCGGAGGTGGCCCCAGGACATCCCAGAGGGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGATGCCCAGAGCAGCTCGGAGGTGGCCCCAGGACATCCCAGAGGGGG  500

seq1  ATTCACGAGACCCGGCGATTCAGGTACTGTACTGCGGGCATTACGGGGAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCACGAGACCCGGCGATTCAGGTACTGTACTGCGGGCATTACGGGGAC  550

seq1  ATGAATGGGTGTCGCTCGCCTCGCGGACAGTAGGACTGGGCCGCCTCCCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAATGGGTGTCGCTCGCCTCGCGGACAGTAGGACTGGGCCGCCTCCCC  600

seq1  GCTGCCAGTTCCCGGAATCCCCTTTTCAATTCTCCTCTTCGGGACTCCGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCCAGTTCCCGGAATCCCCTTTTCAATTCTCCTCTTCGGGACTCCGC  650

seq1  CTCTTCCTGCCTTTCTTCCGTGGAGAGTCTGAGGATTCTAGCTCCCCCGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCCTGCCTTTCTTCCGTGGAGAGTCTGAGGATTCTAGCTCCCCCGA  700

seq1  CCCACAAGCTGCGTATGGGGGGCCCTCGTGGCCCCCGCATGGGCGCCTTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACAAGCTGCGTATGGGGGGCCCTCGTGGCCCCCGCATGGGCGCCTTC  750

seq1  CTTTCACCGTTCCTTTGGTGAACTCTGGGTTTTTGTGGGCTCTCTGCCTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCACCGTTCCTTTGGTGAACTCTGGGTTTTTGTGGGCTCTCTGCCTT  800

seq1  CACTCCACCAGCGTCGCCTCACCGAGGGTGCATGGGGCACCTTAGCCCGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCCACCAGCGTCGCCTCACCGAGGGTGCATGGGGCACCTTAGCCCGA  850

seq1  GCCATTGCCAGATCCTAGGGGGTCCACATTCCTTAGGATCCACTACGCCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATTGCCAGATCCTAGGGGGTCCACATTCCTTAGGATCCACTACGCCT  900

seq1  TGCCAAGCTAGTTATCATCTCCAGCCTCTGGGTCCTGTTCTGCGTCCTGA  950
      ||||||||||||||||||||||||||||||||| ||||||||||| ||||
seq2  TGCCAAGCTAGTTATCATCTCCAGCCTCTGGGTTCTGTTCTGCGT-CTGA  949

seq1  CACCCCTCCCCCTACACACACACACACACACACACACACACACACACACA  1000
      || |||||||| || |||||||| ||||||||||||||||||||||||||
seq2  CA-CCCTCCCCTTA-ACACACAC-CACACACACACACACACACACACACA  996

seq1  CACACACACACACACACACTGCGCGCCCTGAAACCTACCTAAGGTCCCA-  1049
      ||||||||||||||||| ||||||| |||||||| |||||||||||||| 
seq2  CACACACACACACACAC-CTGCGCG-CCTGAAACTTACCTAAGGTCCCAG  1044

seq1  GGATCGTTTGTTCAAGCTCCTACGAGGTCACTGAAGGGGTTGTGGCCCGC  1099
      ||||||||||||| ||||| ||||||||||||||    | |||| |||||
seq2  GGATCGTTTGTTC-AGCTCTTACGAGGTCACTGA----GGTGTGACCCGC  1089

seq1  AGAAGATGGGCAGGGATGGGATACAGGAAAGGCACTGAGTTTATTGGTAG  1149
      || |||| | |||| |||| ||||||  ||||||||||  | || | |||
seq2  AG-AGAT-GCCAGGAATGGAATACAG--AAGGCACTGA--TAATGGTTAG  1133

seq1  -CTTGCATTTCTATTCCAAGCCAGCCAA-TAGTG  1181
       |||||||||||  | |||||||||||| |||||
seq2  CCTTGCATTTCTTATTCAAGCCAGCCAAGTAGTG  1167

seq1: chr16_91511645_91512189
seq2: B6Ng01-270M14.g_67_611 (reverse)

seq1  CGCTCTTCCCCTGTCCCTCCCCCTCTCGCTCTCCCCCACCCCTGTGTGTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTCTTCCCCTGTCCCTCCCCCTCTCGCTCTCCCCCACCCCTGTGTGTC  50

seq1  TGCTGTGCTGTACACATGGGTGTGCACACTCCTGAGCAGGAATGTGAGTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGTGCTGTACACATGGGTGTGCACACTCCTGAGCAGGAATGTGAGTA  100

seq1  CACAGGTGTCACACATGTCCGTACCCATGCGCACATGTGAAGGTAAACAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGGTGTCACACATGTCCGTACCCATGCGCACATGTGAAGGTAAACAT  150

seq1  AGGATGTTGTCCTCCACCCTATCGTCTTGAAACAAGACCTCTCACAGGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATGTTGTCCTCCACCCTATCGTCTTGAAACAAGACCTCTCACAGGAG  200

seq1  AGGAAGCTCACCATTCTGCCTTAGCTGGTTGACCAGTAAGCTCTGGGAAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGCTCACCATTCTGCCTTAGCTGGTTGACCAGTAAGCTCTGGGAAT  250

seq1  CTCCCTGTCTGTGCCCAATGCTAGGACTGGGTATGAACAGTGAAGTCTGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCTGTCTGTGCCCAATGCTAGGACTGGGTATGAACAGTGAAGTCTGG  300

seq1  CTTTTTTGTTAGGTATTGGAGGTTTGTACTCAGGACTTCACACTTGCACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTTTGTTAGGTATTGGAGGTTTGTACTCAGGACTTCACACTTGCACA  350

seq1  CCAAGCACTTGTCCGGTGGGCAGTGTCCCCAGGCCCCATTCAGCTTTTTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGCACTTGTCCGGTGGGCAGTGTCCCCAGGCCCCATTCAGCTTTTTC  400

seq1  TTACAACTCTTCTCAGGCTTACAGTGATCACAGAATTGCTGGTCTTGAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAACTCTTCTCAGGCTTACAGTGATCACAGAATTGCTGGTCTTGAGG  450

seq1  GCATGCGTAATACACATGGATTTCTGTGATGGAATGCTTTTTTACTGGGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCGTAATACACATGGATTTCTGTGATGGAATGCTTTTTTACTGGGA  500

seq1  TAAGTCTTTTTCTCCACCTGGAGGAACAAAGGCAAGAAGGAATTC  545
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTCTTTTTCTCCACCTGGAGGAACAAAGGCAAGAAGGAATTC  545

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information