MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-324E20
Chromosome	16 (Build37)
Map Location	11,678,614 - 11,856,174
singlet/doublet	doublet
Overlap gene	4933437K13Rik, LOC100043171, C530044N13Rik
Upstream gene	4932416N17Rik, Socs1, Tnp2, Prm3, Prm2, Prm1, A630055G03Rik, Litaf, LOC100043147, LOC100042597, Snn, Txndc11, Zc3h7a, LOC665450, LOC622271, Rsl1d1, Gspt1, Tnfrsf17
Downstream gene	2700045P11Rik, EG622509
Link	Open Mouse BAC browser

Click to get alignment info.

name	4932416N17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74374 MGI:1921624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Socs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12703 MGI:1354910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21959 MGI:98785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19120 MGI:106601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19119 MGI:97766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19118 MGI:97765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A630055G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223970 MGI:2685383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Litaf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56722 MGI:1929512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100042597 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Snn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20621 MGI:1276549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txndc11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106200 MGI:1923620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zc3h7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106205 MGI:2445044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665450 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 8 Proteins pseudo : _no_value

name	LOC622271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 120 ESTs, 8 Proteins pseudo : _no_value

name	Rsl1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66409 MGI:1913659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gspt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14852 MGI:1316728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21935 MGI:1343050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933437K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74478 MGI:1921728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043171 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	C530044N13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:223978 MGI:2443300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700045P11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72555 MGI:1919805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 1 Protein

name	EG622509 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622509 MGI:3646646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 81 Proteins

name	4932416N17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130442 GeneID:74374 MGI:1921624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932416N17 gene transcript_id : NM_177562.4

name	Socs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044896 GeneID:12703 MGI:1354910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of cytokine signaling 1 transcript_id : NM_009896.2

name	Tnp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62461573 GeneID:21959 MGI:98785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transition protein 2 transcript_id : NM_013694.4

name	Prm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326494 GeneID:19120 MGI:106601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protamine 3 transcript_id : NM_013638.2

name	Prm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679474 GeneID:19119 MGI:97766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protamine 2 transcript_id : NM_008933.1

name	Prm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50657349 GeneID:19118 MGI:97765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protamine 1 transcript_id : NM_013637.4

name	A630055G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701779 GeneID:223970 MGI:2685383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630055G03 gene transcript_id : NM_001033278.1

name	Litaf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910577 GeneID:56722 MGI:1929512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LPS-induced TN factor transcript_id : NM_019980.1

name	LOC100043147 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267322 GeneID:100043147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043147 transcript_id : XM_001480214.1

name	Snn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50233915 GeneID:20621 MGI:1276549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stannin transcript_id : NM_009223.2

name	Txndc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130624 GeneID:106200 MGI:1923620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 11 transcript_id : NM_029582.2

name	Txndc11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383937 GeneID:106200 MGI:1923620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 11 transcript_id : NM_134105.2

name	Zc3h7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122350 GeneID:106205 MGI:2445044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger CCCH type containing 7 A transcript_id : NM_145931.1

name	Rsl1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385918 GeneID:66409 MGI:1913659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal L1 domain containing 1 transcript_id : NM_025546.2

name	Gspt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203748 GeneID:14852 MGI:1316728
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G1 to S phase transition 1 transcript_id : NM_146066.1

name	Tnfrsf17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755822 GeneID:21935 MGI:1343050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 17 transcript_id : NM_011608.1

name	4933437K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385413 GeneID:74478 MGI:1921728
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933437K13 gene transcript_id : NM_028964.2

name	LOC100043171 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267351 GeneID:100043171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043171 transcript_id : XM_001480241.1

name	C530044N13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351105 GeneID:223978 MGI:2443300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C530044N13 gene transcript_id : NM_146067.3

name	2700045P11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267278 GeneID:72555 MGI:1919805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 1 Protein product : RIKEN cDNA 2700045P11 gene, transcript variant 2 transcript_id : XM_980313.2

name	EG622509 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267280 GeneID:622509 MGI:3646646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 81 Proteins product : predicted gene, EG622509 transcript_id : XM_886942.2

name	4932416N17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656175 GeneID:74374 MGI:1921624
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74374 protein_id : NP_808230.2

name	Socs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753424 CCDS:CCDS27952.1 GeneID:12703 MGI:1354910
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0019210 - kinase inhibitor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA] [Evidence IMP]; GO:0045444 - fat cell differentiation [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0046627 - negative regulation of insulin receptor signaling pathway [Evidence IDA]; GO:0046426 - negative regulation of JAK-STAT cascade [Evidence IMP]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0042518 - negative regulation of tyrosine phosphorylation of Stat3 protein [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0001932 - regulation of protein amino acid phosphorylation [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : cytokine inducible SH2-containing protein 7; cytokine inducible SH2-containing protein 1; JAK-binding protein; JAK2-binding protein; STAT-induced STAT inhibitor 1 product : suppressor of cytokine signaling 1 protein_id : NP_034026.1

name	Tnp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981239 CCDS:CCDS27953.1 GeneID:21959 MGI:98785
definition	GO_component : GO:0001673 - male germ cell nucleus [Evidence TAS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007340 - acrosome reaction [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007341 - penetration of zona pellucida [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : transition protein 2 (alt.) product : transition protein 2 protein_id : NP_038722.3

name	Prm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326495 CCDS:CCDS27954.1 GeneID:19120 MGI:106601
definition	codon_start : 1 product : protamine 3 protein_id : NP_038666.2

name	Prm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679475 CCDS:CCDS27955.1 GeneID:19119 MGI:97766
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0030261 - chromosome condensation [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0006997 - nuclear organization and biogenesis [Evidence IMP]; GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 product : protamine 2 protein_id : NP_032959.1

name	Prm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305409 CCDS:CCDS27956.1 GeneID:19118 MGI:97765
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence TAS] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0030261 - chromosome condensation [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0006997 - nuclear organization and biogenesis [Evidence IMP]; GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 product : protamine 1 protein_id : NP_038665.1

name	A630055G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701780 GeneID:223970 MGI:2685383
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC223970 protein_id : NP_001028450.1

name	Litaf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910578 CCDS:CCDS27958.1 GeneID:56722 MGI:1929512
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : LPS-induced TNF-alpha factor; Nedd4 WW domain-binding protein 3 product : LPS-induced TN factor protein_id : NP_064364.1

name	LOC100043147 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267323 GeneID:100043147
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480264.1

name	Snn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678051 GeneID:20621 MGI:1276549
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : stannin protein_id : NP_033249.1

name	Txndc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077061 CCDS:CCDS27960.1 GeneID:106200 MGI:1923620
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; EF-hand binding protein 1 product : thioredoxin domain containing 11 isoform 1 protein_id : NP_083858.1

name	Txndc11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527336 GeneID:106200 MGI:1923620
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; EF-hand binding protein 1 product : thioredoxin domain containing 11 isoform 2 protein_id : NP_598866.1

name	Zc3h7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122351 GeneID:106205 MGI:2445044
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger CCCH type domain containing 7 product : zinc finger CCCH type containing 7 protein_id : NP_666043.1

name	Rsl1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794470 GeneID:66409 MGI:1913659
definition	codon_start : 1 product : ribosomal L1 domain containing 1 protein_id : NP_079822.1

name	Gspt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203749 CCDS:CCDS27961.1 GeneID:14852 MGI:1316728
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003747 - translation release factor activity [Evidence ISS] GO_process : GO:0000082 - G1/S transition of mitotic cell cycle [Evidence ISS]; GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence ISS] codon_start : 1 note : eukaryotic polypeptide chain release factor 3; guanine nucleotide regulatory protein; G1-to-S transition GTP binding protein; G1 to phase transition 1 product : G1 to S phase transition 1 protein_id : NP_666178.1

name	Tnfrsf17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755823 CCDS:CCDS27962.1 GeneID:21935 MGI:1343050
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : tumor necrosis factor receptor superfamily, member 17 protein_id : NP_035738.1

name	4933437K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312778 CCDS:CCDS27963.1 GeneID:74478 MGI:1921728
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74478 protein_id : NP_083240.1

name	LOC100043171 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267352 GeneID:100043171
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480291.1

name	C530044N13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981882 CCDS:CCDS27964.1 GeneID:223978 MGI:2443300
definition	codon_start : 1 product : hypothetical protein LOC223978 protein_id : NP_666179.2

name	2700045P11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267279 GeneID:72555 MGI:1919805
definition	codon_start : 1 product : hypothetical protein LOC72555 isoform 2 protein_id : XP_985407.2

name	EG622509 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267281 GeneID:622509 MGI:3646646
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892035.2

name	LOC100042597 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042597
definition	number : 2 pseudo : _no_value

name	LOC100042597 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042597
definition	number : 1 pseudo : _no_value

name	LOC665450 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267276 GeneID:665450
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 8 Proteins product : similar to MGC27348 protein pseudo : _no_value transcript_id : XR_033740.1

name	LOC622271 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267277 GeneID:622271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 120 ESTs, 8 Proteins product : similar to Wdr45 like pseudo : _no_value transcript_id : XR_033745.1

clone name	MSMg01-138C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489D19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-413B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186G24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-324E20.b	B6Ng01-324E20.g
ACC	GA112652	GA112653
length	1,133	1,123
definition	B6Ng01-324E20.b	B6Ng01-324E20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(11,678,614 - 11,679,738)	(11,855,065 - 11,856,174)
sequence	gaattcacttacctatactgttgtctgtgttctgtacgcattgcagctag ccatactgttactgatcactttgtatgcgtgtgcaagcacatttttaaat gtgaatatgtatgcatctttctctcttgctctccactttgtatttagaga tggggtctcatcttgaatccagagctcatttgtttggctagattgtttgg ttagtgagccctgaagatcttgctcagtgctagatggacacacaccacca catccacttttccatgggtgctgccgagcacatcccaggtcctcatgctt gcacagtgggcactttactctccagccacacattggccacacagttccac agaggagctgtgcaggagctaacgtggaagaatcgaggggtgcctcactc ttggagagcagtggtagtgattttaggtcgtcctgggggagtgttccatg tactgcctgtaatgctgagttgggaccagtcagcagagaagcacagcaga ggacacagtatggtcctgtccagagaagagggcagggctgggaccaatga atgggggagttggaggaatgaccagaaccaagctatggtgtcaagactgt gtggccaagagtagcacccagctccccaagccctgggacctatgaggggg aaggtggcatgttattagattgttgtttccttggagactgaaacttttat tgtttaatgttgaagatattgatctacaaggtgggaatggtgattccagc tctgtggtataatgaaaaaaatgtaactttcatggaatccataaaaagta aaatagacattctttaaaaaaaaaaaaaaagcaagcttgatcttttgata aaatcttccagaaagtgggtctgtccatgttatataaagagtaagttttc tcttctgaaactaagtcaagtcaagaagtggttcaacccgtatctctttc ttagtgttaagagctgctgcccctcagtattcttgctgttgcccaaacct ttgagcaacaaggccaggcaggaactcacagccacaggattagcctcata gctacctttctggaagttcttcatccattcatccattttcatcaaccact gagacttgctaacaatggatattgaaaggcctt	gaattctcagtagtgcgttcagggccacctcccagcactgaaaagaaggg gacatgattacagagtgctttcttcacgtgtgacagttttgctaggctgt gctagctgtcctcctgtctccatgttccaagtgttaggattataggcatg tgccaccactcccggccttatcttctgagccctagattttgtgcctctaa attttctattcacaccaatcactccattctctaagaggcagaaccttgtc ctttctaaacagaataattttgatctatttatattggttattgctgtttt tcttagatctaacttttctttcttgttagaagttctttttgtggataagg tgcctaatttgcttatttctattctagctggtgcatttttttggcttaag aacttactcttggtgaggagtgatggtacacacccatagtcaaagcatgc aggaggctgagctagaagatgtagcattttaggccagcctaggacacata gctatactgtgtctctaaaatgacagaaagcatttttttaaaagatttat ttatcgtatgtatgtgagtacactgtcaccctcttcagacacaccagaag agggcatcagatcctattacagatggttatgagccaccatgtggttgctg ggaattgaactcaggacctctgaaagagcagtcagtgctcttaacggctg aggcatctctctagccagttgtttgttttgttgttgttgttgttgttgtt ttaatggcaaaggaccacagggcttaatgcataccaggcaagcactgtgc cactgagccacatctgcagacctaagaagtcactctttgtcctgaggtcc taaccttttaggttggtatatacatgatgaggctttgtcattgtgtcttt cattcatgagtatcattgcattctgcccgactattgcccttccctgatag gtctcttatgcacctggaaatgatgttgaacctatagcagagagagacga ttattgttttctttctggtgggatttctaagcttccccaagaaccattta cctgtacctcagtcctcagaatggaacctggtgtaaagtaaggtcctcgc cagagtcagtcatagaaacctgg
quality values	Open. Hide. 34 13 27 37 62 41 23 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 43 51 34 30 38 34 30 28 56 59 62 62 62 59 59 62 62 59 59 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 59 62 62 62 62 59 62 62 62 62 50 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 42 49 49 62 59 59 62 62 62 59 59 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 56 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 56 56 62 56 42 62 62 62 62 62 62 62 62 62 56 62 62 56 49 47 62 49 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 31 62 62 62 62 26 62 62 52 62 45 62 62 62 62 62 62 62 47 42 62 42 62 62 62 62 62 62 62 58 58 58 58 58 54 58 58 58 58 58 46 58 58 39 45 58 58 58 58 54 42 58 58 54 54 35 58 54 58 58 54 58 58 58 39 58 58 54 54 58 58 54 58 58 58 54 58 58 58 37 39 45 52 58 47 58 52 54 58 52 54 49 42 52 45 54 46 54 54 41 41 47 48 41 58 50 48 48 48 51 49 47 41 32 26 41 49 50 51 58 49 26 49 58 58 58 58 49 28 58 42 51 41 29 48 48 58 58 52 49 45 47 49 52 50 50 50 58 52 58 46 30 58 50 52 49 51 43 51 36 54 31 39 28 50 50 58 58 44 50 52 58 58 50 50 49 46 58 52 58 50 28 44 37 58 32 33 32 49 58 29 53 50 39 47 58 51 49 53 52 50 32 50 23 33 39 58 40 51 58 40 58 39 39 50 58 37 53 35 23 35 35 44 32 42 49 54 53 52 51 37 50 51 33 45 34 37 54 35 54 51 54 54 50 54 54 49 25 35 28 25 54 40 54 49 46 45 28 27 29 28 35 45 34 45 52 25 14 9 54 54 54 24 21 37 47 49 54 22 33 32 23 28 19 21 18 9 26 31 34 31 28 31 22 46 40 52 51 47 52 51 49 51 52 51 32 20 27 35 31 35 36 20 22 35 32 32 32 17 52 51 12 18 42 36 43 51 51 26 31 37 35 38 20 32 23 16 36 51 29 21 30 30 51 31 30 32 31 30 30 42 30 26 30 38 30 30 19 6 14 34 30 46 38 28 42 31 33 33 30 31 43 46 46 30 31 29 33 26 31 30 26 22 15 48 11 21 21 7 24 10 29 25 30 31 31 15 21 32 30 19 39 19 23 23 24 23 6 10 29 30 22 15 29 23 17 28 29 32 31 32 18 22 13 25 24 14 15 25 8 4 5 16 34 19 8 44 29 15 21 19 19 34 32 27 17 38 36 11 18 31 27 13 21 9 6 18 25 35 34 32 31 32 32 25 9 9 17 33 16 30 39 22 15 18 7 40 16 9 10 12 13 19 7 12 9 25 24 13 9 11 12 12 18 5 11 11 14 8 19 14 32 13 15 10 6 6 10 8 11 12 18 21 27 8 8 9 9 18 13 9 14 6 10 5 11 16 13 13 14 9 5 27 40 13 6 3 3 4 19 17 8 3 11 3 5 5 12 16 19 11 11 11 10 23 17 14 29 21 19 5 11 29 30 16 9 3 1 3 13 6 17 6 12 19 6 15 20 4 4 9 5 5 12 20 8 4 8 7 4 4 7 23 7 6 6 7 4 7 9 12 17 9 14 8 9 5 14 9	Open. Hide. 62 47 39 42 62 62 62 54 47 39 44 50 21 32 46 24 34 41 51 59 59 59 62 62 62 59 59 62 62 62 62 62 59 59 62 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 59 59 62 59 59 59 59 59 59 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 59 59 62 59 62 62 62 59 62 62 62 59 62 62 62 59 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 56 54 62 56 62 56 62 62 62 62 62 62 51 56 56 51 56 56 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 54 51 62 62 62 62 62 62 56 49 47 62 62 56 56 56 56 62 62 62 62 62 62 62 62 54 56 50 56 62 56 62 56 62 47 56 62 62 62 62 56 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 47 43 62 62 62 62 62 62 62 42 48 62 52 62 54 62 41 42 62 62 62 62 62 47 42 62 54 62 62 54 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 52 54 58 58 58 58 52 54 54 54 54 58 58 58 58 54 48 54 54 54 54 54 58 54 54 42 32 58 52 34 52 47 47 42 46 46 58 40 52 58 36 58 48 52 54 54 58 58 35 42 50 52 58 52 54 41 36 52 50 54 54 54 52 58 54 52 54 52 54 58 58 37 54 41 32 41 37 30 54 58 47 45 58 54 36 48 52 52 58 58 58 45 58 50 58 43 48 58 50 58 51 40 13 41 24 20 49 51 53 53 53 58 50 51 40 58 32 52 51 32 50 52 33 39 52 53 50 58 52 58 40 47 47 38 50 50 40 37 34 35 8 39 40 37 38 39 53 54 51 52 46 46 46 58 50 33 39 40 51 51 50 58 58 58 37 51 58 54 58 32 51 48 41 36 49 39 49 58 33 36 46 27 30 26 12 43 46 50 51 51 30 50 54 35 50 40 37 29 37 32 27 33 50 21 42 36 52 35 19 58 26 12 58 25 14 39 41 49 26 19 40 28 25 49 23 9 29 21 17 32 35 39 26 37 38 53 42 45 47 40 18 23 28 40 27 12 29 40 29 28 23 34 32 37 37 39 26 9 34 32 31 26 31 31 27 54 42 31 30 31 17 28 37 32 33 54 35 40 26 35 40 30 42 33 21 49 14 37 25 21 21 23 12 8 46 53 51 46 30 28 39 21 30 33 46 19 20 30 26 15 12 33 23 31 31 33 16 30 32 9 46 16 25 51 32 32 20 10 6 13 19 29 17 31 13 30 11 51 18 31 23 20 31 16 21 33 29 31 16 29 21 26 24 19 31 30 31 31 24 31 26 31 21 37 32 46 26 24 33 24 31 34 25 20 18 7 43 29 26 15 11 41 41 15 37 36 22 28 27 28 28 31 31 31 32 13 25 21 31 32 29 32 32 30 24 7 9 31 31 18 25 20 16 21 21 31 17 25 28 14 22 31 21 21 10 7 10 15 46 18 7 25 22 18 7 16 18 11 25 9 6 7 31 8 10 16 37 42 21 15 31 36 19 6 14 25 14 18 32 31 21 22 17 11 9 6 21 11 31 11 7 16 25 29 38 39 19 17 9 15 18 32 13 37 10 13 39 30 7 9 10 5 12 4 7 22 6 6 9 5 7 8 26 32 19 12 5 10 21 34 9 5 6 22 32 10 14 19 14 7 18 15 7 6 5 3 3 9 15 7 9 11 4 24 16 14 28 7 13 6 13 6 14 8 7 4 8 7 10 14 10 7 7 7 8 32 22 3 6 5 14 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_11678614_11679738
seq2: B6Ng01-324E20.b_53_1185

seq1  GAATTCACTTACCTATACTGTTGTCTGTGTTCTGTACGCATTGCAGCTAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTTACCTATACTGTTGTCTGTGTTCTGTACGCATTGCAGCTAG  50

seq1  CCATACTGTTACTGATCACTTTGTATGCGTGTGCAAGCACATTTTTAAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATACTGTTACTGATCACTTTGTATGCGTGTGCAAGCACATTTTTAAAT  100

seq1  GTGAATATGTATGCATCTTTCTCTCTTGCTCTCCACTTTGTATTTAGAGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAATATGTATGCATCTTTCTCTCTTGCTCTCCACTTTGTATTTAGAGA  150

seq1  TGGGGTCTCATCTTGAATCCAGAGCTCATTTGTTTGGCTAGATTGTTTGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGTCTCATCTTGAATCCAGAGCTCATTTGTTTGGCTAGATTGTTTGG  200

seq1  TTAGTGAGCCCTGAAGATCTTGCTCAGTGCTAGATGGACACACACCACCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTGAGCCCTGAAGATCTTGCTCAGTGCTAGATGGACACACACCACCA  250

seq1  CATCCACTTTTCCATGGGTGCTGCCGAGCACATCCCAGGTCCTCATGCTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCCACTTTTCCATGGGTGCTGCCGAGCACATCCCAGGTCCTCATGCTT  300

seq1  GCACAGTGGGCACTTTACTCTCCAGCCACACATTGGCCACACAGTTCCAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAGTGGGCACTTTACTCTCCAGCCACACATTGGCCACACAGTTCCAC  350

seq1  AGAGGAGCTGTGCAGGAGCTAACGTGGAAGAATCGAGGGGTGCCTCACTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGAGCTGTGCAGGAGCTAACGTGGAAGAATCGAGGGGTGCCTCACTC  400

seq1  TTGGAGAGCAGTGGTAGTGATTTTAGGTCGTCCTGGGGGAGTGTTCCATG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGAGAGCAGTGGTAGTGATTTTAGGTCGTCCTGGGGGAGTGTTCCATG  450

seq1  TACTGCCTGTAATGCTGAGTTGGGACCAGTCAGCAGAGAAGCACAGCAGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGCCTGTAATGCTGAGTTGGGACCAGTCAGCAGAGAAGCACAGCAGA  500

seq1  GGACACAGTATGGTCCTGTCCAGAGAAGAGGGCAGGGCTGGGACCAATGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACACAGTATGGTCCTGTCCAGAGAAGAGGGCAGGGCTGGGACCAATGA  550

seq1  ATGGGGGAGTTGGAGGAATGACCAGAACCAAGCTATGGTGTCAAGACTGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGGGAGTTGGAGGAATGACCAGAACCAAGCTATGGTGTCAAGACTGT  600

seq1  GTGGCCAAGAGTAGCACCCAGCTCCCCAAGCCCTGGGACCTATGAGGGGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCCAAGAGTAGCACCCAGCTCCCCAAGCCCTGGGACCTATGAGGGGG  650

seq1  AAGGTGGCATGTTATTAGATTGTTGTTTCCTTGGAGACTGAAACTTTTAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTGGCATGTTATTAGATTGTTGTTTCCTTGGAGACTGAAACTTTTAT  700

seq1  TGTTTAATGTTGAAGATATTGATCTACAAGGTGGGAATGGTGATTCCAGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTAATGTTGAAGATATTGATCTACAAGGTGGGAATGGTGATTCCAGC  750

seq1  TCTGTGGTATAATGAAAAAAATGTAACTTTCATGGAATCCATAAAAAGTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTGGTATAATGAAAAAAATGTAACTTTCATGGAATCCATAAAAAGTA  800

seq1  AAATAGACATTCTTT-AAAAAAAAAAAAAAGCAAGCTTGATC-TTTGATA  848
      ||||||||||||||| |||||||||||||||||||||||||| |||||||
seq2  AAATAGACATTCTTTAAAAAAAAAAAAAAAGCAAGCTTGATCTTTTGATA  850

seq1  AAATCTTCCAGAAAGTGGGTCTGTCCATGTTATATAAAGAGTAAGTTTTC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCTTCCAGAAAGTGGGTCTGTCCATGTTATATAAAGAGTAAGTTTTC  900

seq1  TCTTCTG-AACTAAGTCAAGTCAAGAAGTGG-TCAACCCGTATCTCTTTC  946
      ||||||| ||||||||||||||||||||||| ||||||||||||||||||
seq2  TCTTCTGAAACTAAGTCAAGTCAAGAAGTGGTTCAACCCGTATCTCTTTC  950

seq1  TTAGTGTTAGGAGCTGCTG-CCCTCAGTA-TCTTGCTGTTGCCCAAACCC  994
      ||||||||| ||||||||| ||||||||| ||||||||||||||||||| 
seq2  TTAGTGTTAAGAGCTGCTGCCCCTCAGTATTCTTGCTGTTGCCCAAACCT  1000

seq1  TTGAGCAACAAGGCCAGGCAGG-ACTCACAG-CACAGGGATAG-CTCATA  1041
      |||||||||||||||||||||| |||||||| ||||||  ||| ||||||
seq2  TTGAGCAACAAGGCCAGGCAGGAACTCACAGCCACAGGATTAGCCTCATA  1050

seq1  GGCTA-CTTTCTGGAAGTTCTTTCATCCATTCATCCCATTTTCCAACCAA  1090
       |||| |||||||||||||| ||||||||||||| ||||||||  | |||
seq2  -GCTACCTTTCTGGAAGTTC-TTCATCCATTCAT-CCATTTTC--ATCAA  1095

seq1  CCACTGAG-CCTGCTAAC-ATGGATA-TGGAAGGCCTT  1125
      |||||||| | ||||||| ||||||| || ||||||||
seq2  CCACTGAGACTTGCTAACAATGGATATTGAAAGGCCTT  1133

seq1: chr16_11855065_11856174
seq2: B6Ng01-324E20.g_65_1187 (reverse)

seq1  CCAGGTTTCTA--GCTG-CT-TGCGGAGGACC-TACTGTACA-CAGGTTC  44
      |||||||||||   ||| || ||  ||||||| |||| |||| |||||||
seq2  CCAGGTTTCTATGACTGACTCTGGCGAGGACCTTACTTTACACCAGGTTC  50

seq1  --ATCTGAGGACTGAGGTACAGGTAAATGG-TCTTGGGGAAGCTTAG-AA  90
         ||||||||||||||||||||||||||| |||||||||||||||| ||
seq2  CATTCTGAGGACTGAGGTACAGGTAAATGGTTCTTGGGGAAGCTTAGAAA  100

seq1  TCCCACCAGAAAG-AAACAAT-ATCGTCTCTCTCCTGCTATAGGTTCAAC  138
      ||||||||||||| ||||||| ||||||||||| ||||||||||||||||
seq2  TCCCACCAGAAAGAAAACAATAATCGTCTCTCT-CTGCTATAGGTTCAAC  149

seq1  ATCATTTCCAGGTGCATAAGAGACCTATCAGGGAA-GGCAATAGTCGGGC  187
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  ATCATTTCCAGGTGCATAAGAGACCTATCAGGGAAGGGCAATAGTCGGGC  199

seq1  AGAATGCAATGATACTCATGAATG-AAGACACAATGACAAAGCCTCATCA  236
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  AGAATGCAATGATACTCATGAATGAAAGACACAATGACAAAGCCTCATCA  249

seq1  TGTATATACCAACCTAAAAAGTTAGGACCTCAGGACAAAGAGTGACTTCT  286
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TGTATATACCAACCTAAAAGGTTAGGACCTCAGGACAAAGAGTGACTTCT  299

seq1  TAGGTCTGCAGATGTGGCTCAGTGGCACAGTGCTTGCCTGGTATGCATTA  336
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTCTGCAGATGTGGCTCAGTGGCACAGTGCTTGCCTGGTATGCATTA  349

seq1  AGCCCTGTGGTCCTTTGCCATTAAAACAACAACAACAACAACAACAAAAC  386
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCTGTGGTCCTTTGCCATTAAAACAACAACAACAACAACAACAAAAC  399

seq1  AAACAACTGGCTAGAGAGATGCCTCAGCCGTTAAGAGCACTGACTGCTCT  436
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAACTGGCTAGAGAGATGCCTCAGCCGTTAAGAGCACTGACTGCTCT  449

seq1  TTCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCATAACC  486
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCATAACC  499

seq1  ATCTGTAATAGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGAGGGTGAC  536
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGTAATAGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGAGGGTGAC  549

seq1  AGTGTACTCACATACATACGATAAATAAATCTTTTAAAAAAATGCTTTCT  586
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTACTCACATACATACGATAAATAAATCTTTTAAAAAAATGCTTTCT  599

seq1  GTCATTTTAGAGACACAGTATAGCTATGTGTCCTAGGCTGGCCTAAAATG  636
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATTTTAGAGACACAGTATAGCTATGTGTCCTAGGCTGGCCTAAAATG  649

seq1  CTACATCTTCTAGCTCAGCCTCCTGCATGCTTTGACTATGGGTGTGTACC  686
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACATCTTCTAGCTCAGCCTCCTGCATGCTTTGACTATGGGTGTGTACC  699

seq1  ATCACTCCTCACCAAGAGTAAGTTCTTAAGCCAAAAAAATGCACCAGCTA  736
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCACTCCTCACCAAGAGTAAGTTCTTAAGCCAAAAAAATGCACCAGCTA  749

seq1  GAATAGAAATAAGCAAATTAGGCACCTTATCCACAAAAAGAACTTCTAAC  786
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATAGAAATAAGCAAATTAGGCACCTTATCCACAAAAAGAACTTCTAAC  799

seq1  AAGAAAGAAAAGTTAGATCTAAGAAAAACAGCAATAACCAATATAAATAG  836
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAAGAAAAGTTAGATCTAAGAAAAACAGCAATAACCAATATAAATAG  849

seq1  ATCAAAATTATTCTGTTTAGAAAGGACAAGGTTCTGCCTCTTAGAGAATG  886
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAAAATTATTCTGTTTAGAAAGGACAAGGTTCTGCCTCTTAGAGAATG  899

seq1  GAGTGATTGGTGTGAATAGAAAATTTAGAGGCACAAAATCTAGGGCTCAG  936
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGATTGGTGTGAATAGAAAATTTAGAGGCACAAAATCTAGGGCTCAG  949

seq1  AAGATAAGGCCGGGAGTGGTGGCACATGCCTATAATCCTAACACTTGGAA  986
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATAAGGCCGGGAGTGGTGGCACATGCCTATAATCCTAACACTTGGAA  999

seq1  CATGGAGACAGGAGGACAGCTAGCACAGCCTAGCAAAACTGTCACACGTG  1036
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGAGACAGGAGGACAGCTAGCACAGCCTAGCAAAACTGTCACACGTG  1049

seq1  AAGAAAGCACTCTGTAATCATGTCCCCTTCTTTTCAGTGCTGGGAGGTGG  1086
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAAGCACTCTGTAATCATGTCCCCTTCTTTTCAGTGCTGGGAGGTGG  1099

seq1  CCCTGAACGCACTACTGAGAATTC  1110
      ||||||||||||||||||||||||
seq2  CCCTGAACGCACTACTGAGAATTC  1123

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information