MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-348L12
Chromosome	16 (Build37)
Map Location	37,426,620 - 37,427,766
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Stfa3, Casr, EG667232, Cd86, Ildr1, LOC667246, Slc15a2, LOC667023, Eaf2, Iqcb1, LOC628101, Golgb1, Hcls1, Fbxo40, LOC100043252, Polq, Stxbp5l
Downstream gene	Gtf2e1, Rabl3, Hgd, Ndufb4, LOC100043709, Fstl1, LOC100043264, Lrrc58, Gpr156, LOC100043271, LOC100043713, Gsk3b, Nr1i2, 4932425I24Rik, Cox17, LOC100043715, Popdc2, Pla1a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Stfa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20863 MGI:106196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12374 MGI:1351351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667232 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667232 MGI:3645223
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Cd86 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12524 MGI:101773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ildr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106347 MGI:2146574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667246 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Slc15a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57738 MGI:1890457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667023 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 10 Proteins pseudo : _no_value

name	Eaf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106389 MGI:2146616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqcb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320299 MGI:2443764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 20 ESTs

name	Golgb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224139 MGI:1099447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 153 ESTs, 6 Proteins

name	Hcls1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15163 MGI:104568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207215 MGI:2443753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043252 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Polq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77782 MGI:2155399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stxbp5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207227 MGI:2443815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtf2e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74197 MGI:1921447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67657 MGI:1914907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hgd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15233 MGI:96078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68194 MGI:1915444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043709 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1345 ESTs, 7 Proteins pseudo : _no_value

name	Fstl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14314 MGI:102793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043264 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Lrrc58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320184 MGI:2443542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239845 MGI:2653880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043713 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs

name	Gsk3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56637 MGI:1861437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr1i2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18171 MGI:1337040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932425I24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320214 MGI:2443598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12856 MGI:1333806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043715 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Popdc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64082 MGI:1930150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pla1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:85031 MGI:1934677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stfa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352955 GeneID:20863 MGI:106196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stefin A3 transcript_id : NM_025288.2

name	Casr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305100 GeneID:12374 MGI:1351351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium-sensing receptor transcript_id : NM_013803.1

name	EG667232 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267387 GeneID:667232 MGI:3645223
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG667232 transcript_id : XM_989186.2

name	Cd86 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542363 GeneID:12524 MGI:101773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD86 antigen transcript_id : NM_019388.2

name	Ildr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527337 GeneID:106347 MGI:2146574
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin-like domain containing receptor 1 transcript_id : NM_134109.1

name	Slc15a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227201 GeneID:57738 MGI:1890457
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 15 (H+/peptide transporter), member 2 transcript_id : NM_021301.2

name	Eaf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254104 GeneID:106389 MGI:2146616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELL associated factor 2 transcript_id : NM_134111.2

name	Iqcb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377605 GeneID:320299 MGI:2443764
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ calmodulin-binding motif containing 1 transcript_id : NM_177128.3

name	Golgb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149267530 GeneID:224139 MGI:1099447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 153 ESTs, 6 Proteins product : golgi autoantigen, golgin subfamily b, macrogolgin 1 transcript_id : XM_001481060.1

name	Hcls1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680186 GeneID:15163 MGI:104568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematopoietic cell specific Lyn substrate 1 transcript_id : NM_008225.1

name	Fbxo40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82617543 GeneID:207215 MGI:2443753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 40 transcript_id : NM_001037321.1

name	Polq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30387614 GeneID:77782 MGI:2155399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), theta transcript_id : NM_029977.1

name	Stxbp5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374311 GeneID:207227 MGI:2443815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin binding protein 5-like transcript_id : NM_172440.2

name	Gtf2e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351823 GeneID:74197 MGI:1921447
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II E, polypeptide 1 (alpha subunit) transcript_id : NM_028812.2

name	Rabl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948289 GeneID:67657 MGI:1914907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB, member of RAS oncogene family-like 3 transcript_id : NM_001042499.1

name	Hgd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41152515 GeneID:15233 MGI:96078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homogentisate 1, 2-dioxygenase transcript_id : NM_013547.2

name	Ndufb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314825 GeneID:68194 MGI:1915444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex 4 transcript_id : NM_026610.1

name	Fstl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802756 GeneID:14314 MGI:102793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : follistatin-like 1 transcript_id : NM_008047.3

name	LOC100043264 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267398 GeneID:100043264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to hCG1657343 transcript_id : XM_001479854.1

name	Lrrc58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347494 GeneID:320184 MGI:2443542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 58 transcript_id : NM_177093.3

name	Gpr156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254200 GeneID:239845 MGI:2653880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 156 transcript_id : NM_153394.2

name	LOC100043713 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267533 GeneID:100043713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs product : hypothetical protein LOC100043713 transcript_id : XM_001481072.1

name	Gsk3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802072 GeneID:56637 MGI:1861437
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycogen synthase kinase 3 beta transcript_id : NM_019827.4

name	Nr1i2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363671 GeneID:18171 MGI:1337040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group I, member 2 transcript_id : NM_010936.2

name	4932425I24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486623 GeneID:320214 MGI:2443598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932425I24 gene transcript_id : NM_001081025.1

name	Cox17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816953 GeneID:12856 MGI:1333806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit XVII assembly protein homolog (yeast) transcript_id : NM_001017429.2

name	LOC100043715 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149267535 GeneID:100043715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043715 transcript_id : XM_001481074.1

name	Popdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517507 GeneID:64082 MGI:1930150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : popeye domain containing 2 transcript_id : NM_001081984.1

name	Popdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517506 GeneID:64082 MGI:1930150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : popeye domain containing 2 transcript_id : NM_022318.2

name	Pla1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801864 GeneID:85031 MGI:1934677
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A1 member A transcript_id : NM_134102.3

name	Stfa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384636 CCDS:CCDS28153.1 GeneID:20863 MGI:106196
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : stefin A3 protein_id : NP_079564.1

name	Casr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305101 CCDS:CCDS28154.1 GeneID:12374 MGI:1351351
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation function : mediates changes in the extracellular concentration of calcium ions note : G protein coupled receptor, family C, group 2, member A; cation sensing receptor; extracellular calcium-sensing receptor product : G protein-coupled receptor, family C, group 2, member A protein_id : NP_038831.1

name	EG667232 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400184 GeneID:667232 MGI:3645223
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994280.1

name	Cd86 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542364 CCDS:CCDS28155.1 GeneID:12524 MGI:101773
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CD86 antigen protein_id : NP_062261.2

name	Ildr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527338 GeneID:106347 MGI:2146574
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : immunoglobulin-like domain containing receptor 1 protein_id : NP_598870.1

name	Slc15a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946598 CCDS:CCDS28156.1 GeneID:57738 MGI:1890457
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0015334 - high affinity oligopeptide transporter activity [Evidence IDA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006857 - oligopeptide transport [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : proton-dependent high affinity oligopeptide transporter PepT2 product : solute carrier family 15 (H+/peptide transporter), member 2 protein_id : NP_067276.1

name	Eaf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527340 GeneID:106389 MGI:2146616
definition	GO_component : GO:0005654 - nucleoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0008629 - induction of apoptosis by intracellular signals [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : testosterone regulated apoptosis inducer and tumor suppressor protein_id : NP_598872.1

name	Iqcb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893085 CCDS:CCDS28157.1 GeneID:320299 MGI:2443764
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : IQ calmodulin-binding motif containing 1 protein_id : NP_796102.1

name	Golgb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149267531 GeneID:224139 MGI:1099447
definition	codon_start : 1 product : golgi autoantigen, golgin subfamily b, macrogolgin 1 protein_id : XP_001481110.1

name	Hcls1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680187 GeneID:15163 MGI:104568
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0042531 - positive regulation of tyrosine phosphorylation of STAT protein [Evidence IMP]; GO:0009725 - response to hormone stimulus [Evidence IDA] codon_start : 1 exception : mismatches in translation product : hematopoietic cell specific Lyn substrate 1 protein_id : NP_032251.1

name	Fbxo40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82617544 GeneID:207215 MGI:2443753
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box protein 40 protein_id : NP_001032398.1

name	Polq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30387615 CCDS:CCDS28158.1 GeneID:77782 MGI:2155399
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IMP] [Evidence IGI]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : DNA polymerase theta protein_id : NP_084253.1

name	Stxbp5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369591 CCDS:CCDS28159.1 GeneID:207227 MGI:2443815
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : xb-tomosyn-2; s-tomosyn-2; b-tomosyn-2; m-tomosyn-2 product : syntaxin binding protein 5-like protein_id : NP_766028.1

name	Gtf2e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312660 CCDS:CCDS28160.1 GeneID:74197 MGI:1921447
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005673 - transcription factor TFIIE complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence IEA] codon_start : 1 note : general transcription factor IIE, polypeptide 1 (alpha subunit, 56kDa); general transcription factor II E, polypeptide 1 (alpha subunit, 56kDa) product : general transcription factor II E, polypeptide 1 (alpha subunit) protein_id : NP_083088.1

name	Rabl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948290 GeneID:67657 MGI:1914907
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAB, member of RAS oncogene family-like 3 protein_id : NP_001035964.1

name	Hgd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7549763 GeneID:15233 MGI:96078
definition	GO_function : GO:0004411 - homogentisate 1,2-dioxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006559 - L-phenylalanine catabolism [Evidence IEA]; GO:0006572 - tyrosine catabolism [Evidence IEA]; GO:0006570 - tyrosine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alkaptonuria product : homogentisate 1, 2-dioxygenase protein_id : NP_038575.1

name	Ndufb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314826 CCDS:CCDS28161.1 GeneID:68194 MGI:1915444
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : NADH:ubiquinone oxidoreductase B15 subunit product : NADH dehydrogenase 1 beta subcomplex 4 protein_id : NP_080886.1

name	Fstl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560699 GeneID:14314 MGI:102793
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] codon_start : 1 note : follistatin-like product : follistatin-like 1 protein_id : NP_032073.2

name	LOC100043264 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267399 GeneID:100043264
definition	codon_start : 1 product : similar to hCG1657343 protein_id : XP_001479904.1

name	Lrrc58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347495 GeneID:320184 MGI:2443542
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 58 protein_id : NP_796067.2

name	Gpr156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254201 CCDS:CCDS28162.1 GeneID:239845 MGI:2653880
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004965 - GABA-B receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GABAB-related G-protein coupled receptor product : G protein-coupled receptor 156 protein_id : NP_700443.2

name	LOC100043713 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267534 GeneID:100043713
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481122.1

name	Gsk3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790077 CCDS:CCDS28163.1 GeneID:56637 MGI:1861437
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0004696 - glycogen synthase kinase 3 activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0050321 - tau-protein kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0008283 - cell proliferation [Evidence TAS]; GO:0045444 - fat cell differentiation [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006611 - protein export from nucleus [Evidence IDA]; GO:0000320 - re-entry into mitotic cell cycle [Evidence IDA]; GO:0006950 - response to stress [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] [Evidence IGI] codon_start : 1 product : glycogen synthase kinase 3 beta protein_id : NP_062801.1

name	Nr1i2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468913 CCDS:CCDS28164.1 GeneID:18171 MGI:1337040
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Pregnane X receptor product : nuclear receptor subfamily 1, group I, member 2 protein_id : NP_035066.1

name	4932425I24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486624 GeneID:320214 MGI:2443598
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320214 protein_id : NP_001074494.1

name	Cox17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945234 CCDS:CCDS28165.1 GeneID:12856 MGI:1333806
definition	GO_component : GO:0005758 - mitochondrial intermembrane space [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016531 - copper chaperone activity [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IDA]; GO:0008047 - enzyme activator activity [Evidence IMP]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006825 - copper ion transport [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : cytochrome c oxidase assembly protein product : cytochrome c oxidase subunit XVII assembly protein homolog protein_id : NP_001017429.1

name	LOC100043715 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149267536 GeneID:100043715
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481124.1

name	Popdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612497 GeneID:64082 MGI:1930150
definition	GO_component : GO:0016020 - membrane [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; popeye protein 2; popeye 2 product : popeye domain containing 2 isoform 2 protein_id : NP_071713.1

name	Popdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517508 GeneID:64082 MGI:1930150
definition	GO_component : GO:0016020 - membrane [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; popeye protein 2; popeye 2 product : popeye domain containing 2 isoform 1 protein_id : NP_001075453.1

name	Pla1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982575 CCDS:CCDS28166.1 GeneID:85031 MGI:1934677
definition	codon_start : 1 exception : mismatches in translation note : phosphatidylserine-specific phospholipase A1 product : phospholipase A1 member A protein_id : NP_598863.2

name	LOC667246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667246
definition	number : 1 pseudo : _no_value

name	LOC100043252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043252
definition	number : 1 pseudo : _no_value

name	LOC100043252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043252
definition	number : 2 pseudo : _no_value

name	LOC100043252 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043252
definition	number : 3 pseudo : _no_value

name	LOC100043271 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043271
definition	number : 1 pseudo : _no_value

name	LOC100043271 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043271
definition	number : 2 pseudo : _no_value

name	LOC100043271 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043271
definition	number : 3 pseudo : _no_value

name	LOC667023 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267529 GeneID:667023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 10 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_034965.1

name	LOC628101 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267394 GeneID:628101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 20 ESTs product : hypothetical LOC628101 transcript_id : XR_035428.1

name	LOC100043709 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149267532 GeneID:100043709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1345 ESTs, 7 Proteins product : similar to ribosomal protein L9 pseudo : _no_value transcript_id : XR_034971.1

clone name	MSMg01-075B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490I18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-506A19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545C15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-548P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-348L12.b	B6Ng01-348L12.g
ACC	GA129930	GA129931
length	1,146	1,144
definition	B6Ng01-348L12.b	B6Ng01-348L12.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctcaaatacaaaagaaagctaaattctaaaatatacttccatttt ccatgtctatagcagaaggaataaaaatctatttgcctatagatttctaa tttacaagttgggaagttttataattttgctgattaggccttgaaatcta agggtccatggcagttataataaacatctcccccttagggactagaatca agaagtacattgccccaatttttcaaacatagtaggaaaagatggagaaa ggagccttctttgtggtccacaaaaatattgaaacatcattattggtaca taagagttggtacactagagctcaaacatatacaaatgagaatactagat tatatttcatctacattattgtatttccatagcctatataaattgccact gaaatcttatctggtattaaacagcaattcaaccttgacagtgaagtgaa gcttgaagaactaaaaagagttatttttaattctatggcaacctataaac cccatagttctataccgtgggctgacatttatatgcaaactagccaatta tctatatttttctttgttttccttatagtagaatggtaaaatcactttct tgtttgtcttcttctaagaagaatgctagtgaggaaaaagtaatacacac acacacacacacacacacacatacacccatttacacatacatatacacat atatatcctaaaataattttaggattttaatctatatttaaaatatttat tatatatttaatgtttgtaatatatctaattattttggagtccagagaag caattttatttatcggttattatacttgatcatcacatgacatgaaaact tacatgccatcttaaatgttatgtgtttttttttaattaggtattttctt catttacatttccaatgctatcccaaaagtcccccataccctccccccaa ctttcctacccacccactaccatttcttgggccctgggcgttccctgtac taaggggctgagagatatctcagtggtttaagagccactgagtgctctct gaggtctggagttcaaatcccagcacacatggtggctcacacatcggtaa tggaagatttgatgccctcttctgggtgcatctgaagacgctacag	gaattccacataaaaccagagacagtgaaatttatagaggagaaagtgcg gaaaagcctcgaagatatgggcacaggggaaaatttcctgaatagaacag caaggcttgtgctgtaagatcaagaatcgacaaatgggacctcataaaat tgcaaagcttctgtaaggcaaaagaaaccttcaataagacaaaaaggcca ccaaaagattgggaaaggatctttacctatcctaaatcagataggggact aatatccaatatatatataaagaactcaagaaagtggactccagaaaatc aaataaccccagtaaaaaatggggctcagagctaaacaaagaattctcac ctgaggaataccgaatggctgagaagcacctgaaaaaatgttcaacatcc ttaatcatcagggaaatgcaaatcaaagcaaccctgagattccacctcac accagtcaaaatcgctaagatcaaagcctcaactgacagcagatgctggc aaggatgtggagaaagaggaacactcttccattgttgttgggattgcaag cttgtacaaccactctggaaatcagtccggcggttcctcagaaattggac atagtactaccgaaggatcccgaaatacctctcctgggcacatatccata agatgttccaactggtaagaaggacacatgctccactatgttcatagcag ccttatttataaaagccagaagctggagagaacccagatgcccctcaaca gaggaatggatacagaaaatgtggtacatttacacagtggagtactactc agctattaaaaggaatgaatttatgaaattcctaggtaaatggatggacc tggaggatatcatcctgagtgaggtaacccaatcacaaaagaactcacat gatatgtactcactgttaagtgggatattagcccagaaacttagaatact caagatgcaaggtacaatctgtaaaacacatgaaactcagagacgagacc aaaatgtggacactttgcctttctagactgggaacaaaacactcatgaga gttacagagacaaagttgaagctgagacgaaagaatggaccatctaggac ctgccatacccgagattcaattcccataattcagtccttcgaag
quality values	Open. Hide. 62 47 31 33 62 62 62 44 42 62 62 62 62 59 56 62 62 62 62 62 62 62 59 59 62 62 62 62 62 51 48 45 43 38 32 34 56 56 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 54 54 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 56 54 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 49 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 54 58 58 58 58 58 58 58 58 54 58 54 58 58 44 58 49 47 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 49 58 58 58 50 58 58 58 58 58 58 58 49 51 58 53 58 58 46 58 51 42 58 51 58 54 53 51 58 53 51 58 58 58 58 58 58 52 49 51 50 51 53 58 58 58 58 58 51 58 58 58 58 58 58 58 58 58 53 58 51 58 51 58 58 58 58 58 51 58 52 58 50 58 58 44 44 58 58 49 50 53 39 58 50 58 51 58 41 58 53 58 50 54 40 58 41 49 38 58 50 58 49 46 58 58 39 51 58 58 50 50 41 36 39 58 54 50 49 33 38 49 25 54 38 39 53 54 47 54 53 53 53 53 52 54 45 39 54 54 51 33 49 39 54 32 52 37 39 53 52 52 53 45 41 54 37 42 46 42 49 23 54 46 46 32 46 54 45 53 33 37 37 53 39 54 54 37 42 53 45 51 54 41 54 39 53 23 33 38 38 32 32 53 24 46 46 26 45 39 53 52 53 53 35 31 21 52 31 32 32 40 45 41 32 40 30 18 34 34 32 37 43 45 46 47 28 28 31 31 42 42 34 38 31 31 37 42 31 27 28 42 30 51 51 31 31 18 27 31 30 18 45 45 31 28 26 38 31 32 23 31 51 31 26 38 17 43 33 26 42 33 42 26 46 46 47 48 48 48 48 33 27 26 32 32 34 29 35 28 32 26 48 46 31 31 32 24 31 21 26 47 27 30 34 25 18 48 36 33 31 21 30 29 41 31 36 31 33 31 48 31 25 48 48 33 30 32 32 46 46 46 31 24 30 34 25 41 31 32 27 41 41 36 38 14 17 31 19 31 48 32 25 15 18 27 25 44 29 19 19 44 29 23 24 24 31 17 23 33 31 48 34 33 21 18 21 44 11 21 44 17 17 22 44 14 10 26 20 17 34 43 21 7 19 15 28 24 21 18 12 5 25 34 19 19 32 28 30 10 32 13 10 6 11 19 21 26 19 21 23 28 32 39 9 34 15 33 11 6 15 7 16 7 9 24 31 28 28 20 9 23 14 21 11 14 6 10 10 22 3 8 6 24 5 16 8 12 7 15 14 26 16 33 14 12 11 22 11 9 16 13 7 5 3 7 12 14 23 11 7 22 27 13 26 7 10 5 5 4 6 18 27 6 13 20 23 21 10 16 6 9 6 5 8 4 18 25 20 22 5 9 15 30 10 9 15 5 22 12 10 16 23 10 8 21 15 16 21 13 7 7 25 21 8 5 1 4 11 15 4 10 5 5	Open. Hide. 62 47 51 47 62 62 35 28 62 43 43 30 27 27 28 28 28 20 36 46 59 46 50 59 62 62 59 54 62 62 59 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 54 62 51 59 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 41 49 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 54 62 62 62 62 62 62 62 62 62 58 54 54 58 58 58 54 58 58 54 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 36 54 58 58 58 58 58 54 58 58 58 54 58 45 58 58 54 54 54 58 58 58 54 54 52 44 52 54 58 58 54 58 58 54 58 58 58 58 38 37 58 58 49 51 58 58 58 58 51 58 54 52 58 45 58 54 58 42 58 58 58 58 58 58 58 58 54 53 51 47 50 52 51 54 49 58 49 58 58 49 47 47 50 51 51 51 53 58 58 42 47 58 58 49 58 37 50 58 54 53 53 51 51 51 50 38 27 44 58 42 26 58 29 37 44 28 38 50 58 58 37 53 41 31 52 53 52 51 50 44 50 58 58 44 50 31 44 40 51 47 47 42 34 35 51 50 49 47 51 37 54 42 49 41 50 25 51 54 50 54 54 38 54 54 40 54 50 26 54 38 27 40 44 42 53 54 51 51 44 42 40 49 38 42 52 54 51 47 45 40 53 52 47 47 45 36 44 44 47 52 53 52 54 51 41 44 20 49 51 52 32 40 40 32 53 53 53 32 47 52 47 49 46 28 46 42 51 34 31 40 40 32 35 35 32 52 32 36 33 32 42 35 38 38 38 31 43 37 28 42 51 32 31 51 40 30 30 28 33 26 38 42 51 46 32 30 51 31 51 42 31 30 32 28 31 47 33 31 42 16 40 26 43 23 37 32 30 15 31 32 37 31 30 31 42 36 31 29 40 34 28 30 42 31 46 46 41 28 46 30 24 23 32 31 31 42 48 30 21 32 27 31 47 39 31 41 31 30 31 38 32 46 27 31 46 39 31 31 30 30 27 37 39 23 15 29 28 31 32 26 28 32 20 15 14 28 32 33 32 31 31 32 37 31 27 31 25 22 30 37 24 31 31 17 28 10 7 14 26 35 21 19 27 38 48 38 31 27 25 32 34 32 27 30 27 32 29 22 21 18 32 34 30 19 28 30 31 17 21 31 26 16 14 22 22 25 12 13 34 8 19 12 8 13 33 32 27 33 33 11 23 31 34 47 18 30 21 24 19 18 26 22 13 19 19 28 20 13 10 27 27 16 27 20 9 8 11 17 16 20 16 16 24 18 16 16 20 17 28 38 30 14 12 9 14 16 28 8 19 30 13 14 28 15 14 6 16 5 5 3 3 5 4 7 7 3 3 20 25 21 17 22 7 5 3 2 3 8 13 10 29 25 17 23 10 14 28 23 10 16 8 6 13 8 16 11 11 14 13 10 11 18 28 28 14 14 12 13 7 16 17 12 2 3 5 2 4 9 11 12 11 6 7 8 5 9 12 5 23 16 6 15 9 7 3 5 4 10 15 11 11 5 19 14 8 17 28 17 18 4 6 16 5 13 4 6 15 9 6 12 14 12 5 4 8 4 5 13 6 3 6 5 4 4 12 11 11 9 7 2 2 3 5 24 4 4 11 5 11 7 5 5 5 4 9 2 3 3 4 3 1 3 3 2 2 2 1 3 5 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr16_37426620_37427766
seq2: B6Ng01-348L12.b_49_1194 (reverse)

seq1  CTGTAGCTGTCTTCAGATGCA-CCAGAAGAGGGCATCAAATCT--CATTA  47
      ||||||| ||||||||||||| |||||||||||||||||||||  |||||
seq2  CTGTAGC-GTCTTCAGATGCACCCAGAAGAGGGCATCAAATCTTCCATTA  49

seq1  CGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCT  97
      | ||||  ||||||||||||||||  |||||||||||||||||  |||| 
seq2  CCGATG--TGTGAGCCACCATGTG--TGCTGGGATTTGAACTCCAGACC-  94

seq1  TCAGAAGAGCACTCAGT-GCTCTT-AACCACTGAGATATCTCTCAGCCCC  145
      |||| |||||||||||| |||||| |||||||||||||||||||||||||
seq2  TCAG-AGAGCACTCAGTGGCTCTTAAACCACTGAGATATCTCTCAGCCCC  143

seq1  TTAGTACAGGGGAACG-CCAGGG-CCAAGAAATGGTAGTGGGTGGGTAGG  193
      |||||||| ||||||| |||||| ||||||||||||||||||||||||||
seq2  TTAGTACA-GGGAACGCCCAGGGCCCAAGAAATGGTAGTGGGTGGGTAGG  192

seq1  AAAGTTGGGGGGAGGGTATGGGGGACTTTTGGGATAGCATTGGAAATGTA  243
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTGGGGGGAGGGTATGGGGGACTTTTGGGATAGCATTGGAAATGTA  242

seq1  AATGAAGAAAATACCTAATTAAAAAAAAACACATAACATTTAAGATGGCA  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAAGAAAATACCTAATTAAAAAAAAACACATAACATTTAAGATGGCA  292

seq1  TGTAAGTTTTCATGTCATGTGATGATCAAGTATAATAACCGATAAATAAA  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTAAGTTTTCATGTCATGTGATGATCAAGTATAATAACCGATAAATAAA  342

seq1  ATTGCTTCTCTGGACTCCAAAATAATTAGATATATTACAAACATTAAATA  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGCTTCTCTGGACTCCAAAATAATTAGATATATTACAAACATTAAATA  392

seq1  TATAATAAATATTTTAAATATAGATTAAAATCCTAAAATTATTTTAGGAT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAATAAATATTTTAAATATAGATTAAAATCCTAAAATTATTTTAGGAT  442

seq1  ATATATGTGTATATGTATGTGTAAATGGGTGTATGTGTGTGTGTGTGTGT  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATGTGTATATGTATGTGTAAATGGGTGTATGTGTGTGTGTGTGTGT  492

seq1  GTGTGTGTGTATTACTTTTTCCTCACTAGCATTCTTCTTAGAAGAAGACA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTGTGTATTACTTTTTCCTCACTAGCATTCTTCTTAGAAGAAGACA  542

seq1  AACAAGAAAGTGATTTTACCATTCTACTATAAGGAAAACAAAGAAAAATA  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAGAAAGTGATTTTACCATTCTACTATAAGGAAAACAAAGAAAAATA  592

seq1  TAGATAATTGGCTAGTTTGCATATAAATGTCAGCCCACGGTATAGAACTA  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATAATTGGCTAGTTTGCATATAAATGTCAGCCCACGGTATAGAACTA  642

seq1  TGGGGTTTATAGGTTGCCATAGAATTAAAAATAACTCTTTTTAGTTCTTC  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGTTTATAGGTTGCCATAGAATTAAAAATAACTCTTTTTAGTTCTTC  692

seq1  AAGCTTCACTTCACTGTCAAGGTTGAATTGCTGTTTAATACCAGATAAGA  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTTCACTTCACTGTCAAGGTTGAATTGCTGTTTAATACCAGATAAGA  742

seq1  TTTCAGTGGCAATTTATATAGGCTATGGAAATACAATAATGTAGATGAAA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAGTGGCAATTTATATAGGCTATGGAAATACAATAATGTAGATGAAA  792

seq1  TATAATCTAGTATTCTCATTTGTATATGTTTGAGCTCTAGTGTACCAACT  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAATCTAGTATTCTCATTTGTATATGTTTGAGCTCTAGTGTACCAACT  842

seq1  CTTATGTACCAATAATGATGTTTCAATATTTTTGTGGACCACAAAGAAGG  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTATGTACCAATAATGATGTTTCAATATTTTTGTGGACCACAAAGAAGG  892

seq1  CTCCTTTCTCCATCTTTTCCTACTATGTTTGAAAAATTGGGGCAATGTAC  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTTTCTCCATCTTTTCCTACTATGTTTGAAAAATTGGGGCAATGTAC  942

seq1  TTCTTGATTCTAGTCCCTAAGGGGGAGATGTTTATTATAACTGCCATGGA  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTGATTCTAGTCCCTAAGGGGGAGATGTTTATTATAACTGCCATGGA  992

seq1  CCCTTAGATTTCAAGGCCTAATCAGCAAAATTATAAAACTTCCCAACTTG  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTAGATTTCAAGGCCTAATCAGCAAAATTATAAAACTTCCCAACTTG  1042

seq1  TAAATTAGAAATCTATAGGCAAATAGATTTTTATTCCTTCTGCTATAGAC  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATTAGAAATCTATAGGCAAATAGATTTTTATTCCTTCTGCTATAGAC  1092

seq1  ATGGAAAATGGAAGTATATTTTAGAATTTAGCTTTCTTTTGTATTTGAGA  1143
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAAAATGGAAGTATATTTTAGAATTTAGCTTTCTTTTGTATTTGAGA  1142

seq1  ATTC  1147
      ||||
seq2  ATTC  1146

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information