MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-026C24
Chromosome	17 (Build37)
Map Location	33,919,359 - 34,040,155
singlet/doublet	doublet
Overlap gene	Ankrd47, Rps28, Ndufa7, Cd320, LOC100042967, LOC630219, LOC100042970
Upstream gene	9030612M13Rik, Zfp811, 6030490I01Rik, LOC631266, BC066107, Cyp4f14, Cyp4f13, 6030422M01Rik, Zfp472, C920016K16Rik, 1700065O13Rik, 4921501E09Rik, Zfp563, Morc2b, LOC100038859, LOC100038860, LOC100043474, Zfp422-rs1, Olfr63, LOC100043468, Zfp81, Zfp101, 1700029I08Rik, LOC100042953, Adamts10, Myo1f, Zfp414, Pram1, Hnrpm, March2, Rab11b, Angptl4
Downstream gene	BC051226, Daxx, Zbtb22, Tapbp, Rgl2, H2-Ke2, Wdr46, B3galt4, Rps18, Vps52, EG630499, LOC100042989, AA388235, H2-K1, LOC654352, Ring1, H2-Ke6, Slc39a7, Rxrb, Col11a2, LOC672505, H2-Pa, H2-Oa, Brd2, LOC100043003, LOC100043522, H2-DMa, H2-DMb2, H2-DMb1, Psmb9, Tap1, Psmb8, Tap2, H2-Ob, H2-Ab1, H2-Aa, H2-Eb1, H2-Eb2, H2-Ea, Btnl2, LOC100038862, LOC667442, BC051142, EG632126, Btnl5, LOC624681, Btnl7, Notch4, Gpsm3, Pbx2, Ager, Rnf5, Agpat1, Egfl8, Ppt2, Prrt1, Fkbpl, Crebl1, Tnxb, EG632302, C4b, Stk19-ps1, Skiv2l-ps1, LOC100043024, Cyp21a2-ps, Cyp21a1, C4a, Stk19, Dom3z, Skiv2l, Rdbp, Cfb, C2, Zbtb12, Ehmt2
Link	Open Mouse BAC browser

Click to get alignment info.

name	9030612M13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208292 MGI:1921793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp811 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240063 MGI:2682944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030490I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240064 MGI:2443934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631266 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 10 Proteins pseudo : _no_value

name	BC066107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240066 MGI:3029586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4f14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64385 MGI:1927669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4f13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170716 MGI:2158641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030422M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77875 MGI:1925125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Zfp472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224691 MGI:2385049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C920016K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240067 MGI:2441928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700065O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73451 MGI:1920701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921501E09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74042 MGI:1921292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp563 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240068 MGI:2677168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morc2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240069 MGI:3045293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038860 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1110 Proteins

name	Zfp422-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77652 MGI:3028594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 108 ESTs

name	Olfr63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258939 MGI:1335096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs

name	Zfp81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224694 MGI:1890752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22643 MGI:107547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700029I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69481 MGI:1916731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Adamts10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224697 MGI:2449112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17916 MGI:107711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328801 MGI:1915641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pram1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378460 MGI:3576625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76936 MGI:1926465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	March2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224703 MGI:1925915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab11b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19326 MGI:99425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angptl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57875 MGI:1888999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80880 MGI:1098615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54127 MGI:1859516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66416 MGI:1913666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd320 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54219 MGI:1860083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042967 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC630219 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100042970 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 34 Proteins

name	BC051226 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407803 MGI:3039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Daxx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13163 MGI:1197015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81630 MGI:1931870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tapbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21356 MGI:1201689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rgl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19732 MGI:107483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Ke2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14976 MGI:95908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57315 MGI:1931871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3galt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54218 MGI:1859517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20084 MGI:98146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224705 MGI:1330304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG630499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630499 MGI:3644203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042989 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	AA388235 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433100 MGI:3035178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-K1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14972 MGI:95904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC654352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654352
definition	note : Casitas B-lineage lymphoma pseudogene pseudo : _no_value

name	Ring1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19763 MGI:1101770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Ke6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14979 MGI:95911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14977 MGI:95909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rxrb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20182 MGI:98215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col11a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12815 MGI:88447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672505 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	H2-Pa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15003 MGI:105314
definition	gene_synonym : H2-Pa-ps note : histocompatibility 2, P region alpha locus pseudo : _no_value

name	H2-Oa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15001 MGI:95924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14312 MGI:99495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043003 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs

name	LOC100043522 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	H2-DMa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14998 MGI:95921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-DMb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15000 MGI:95923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-DMb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14999 MGI:95922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16912 MGI:1346526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21354 MGI:98483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16913 MGI:1346527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21355 MGI:98484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Ob (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15002 MGI:95925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Ab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14961 MGI:103070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Aa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14960 MGI:95895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Eb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14969 MGI:95901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Eb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381091 MGI:95902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Ea (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14968 MGI:95900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btnl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547431 MGI:1859549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038862 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	BC051142 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407788 MGI:3039565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG632126 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632126 MGI:3648221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btnl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81497 MGI:1932037
definition	gene_synonym : NG12 note : butyrophilin-like 5 pseudo : _no_value

name	LOC624681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	Btnl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195349 MGI:2388054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Notch4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18132 MGI:107471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpsm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106512 MGI:2146785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pbx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18515 MGI:1341793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ager (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11596 MGI:893592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54197 MGI:1860076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agpat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55979 MGI:1932075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egfl8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81701 MGI:1932094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54397 MGI:1860075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prrt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260297 MGI:1932118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56299 MGI:1932127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crebl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12915 MGI:105121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnxb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81877 MGI:1932137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG632302 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632302 MGI:3645529
definition	gene_synonym : Cyp21a2-p note : predicted gene, EG632302 pseudo : _no_value

name	C4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12268 MGI:88228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk19-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114241 MGI:2148500
definition	gene_synonym : RP2 note : serine/threonine kinase 19, pseudogene 1 pseudo : _no_value

name	Skiv2l-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114240 MGI:2148492
definition	gene_synonym : Ski2w2 note : superkiller viralicidic activity 2-like (S. cerevisiae), pseudogene 1 pseudo : _no_value

name	LOC100043024 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cyp21a2-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13080 MGI:88592
definition	gene_synonym : 21OHB; Cyp21-ps1; Cyp21a2ps; Cyp21B; Oh21-2 note : cytochrome P450, family 21, subfamily a, polypeptide 2, pseudogene pseudo : _no_value

name	Cyp21a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13079 MGI:88591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625018 MGI:98320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54402 MGI:1860085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dom3z (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112403 MGI:1890444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Skiv2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108077 MGI:1099835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rdbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27632 MGI:102744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Cfb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14962 MGI:105975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12263 MGI:88226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193736 MGI:88133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ehmt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110147 MGI:2148922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	9030612M13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140969611 GeneID:208292 MGI:1921793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030612M13 gene transcript_id : NM_172458.3

name	Zfp811 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147227 GeneID:240063 MGI:2682944
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 811 transcript_id : NM_183177.1

name	6030490I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793417 GeneID:240064 MGI:2443934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030490I01 gene transcript_id : NM_177359.3

name	BC066107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402246 GeneID:240066 MGI:3029586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC066107 transcript_id : NM_207245.1

name	Cyp4f14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11967964 GeneID:64385 MGI:1927669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 14 transcript_id : NM_022434.1

name	Cyp4f13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373154 GeneID:170716 MGI:2158641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 13 transcript_id : NM_130882.1

name	6030422M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401875 GeneID:77875 MGI:1925125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 6030422M01 gene transcript_id : XM_128564.4

name	Zfp472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377185 GeneID:224691 MGI:2385049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 472 transcript_id : NM_153063.2

name	C920016K16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930751 GeneID:240067 MGI:2441928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C920016K16 gene transcript_id : NM_001045559.1

name	1700065O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802452 GeneID:73451 MGI:1920701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700065O13 gene transcript_id : NM_028543.2

name	4921501E09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222273 GeneID:74042 MGI:1921292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921501E09 gene transcript_id : NM_001009544.1

name	Zfp563 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930757 GeneID:240068 MGI:2677168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 563 transcript_id : NM_001024950.2

name	Morc2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354229 GeneID:240069 MGI:3045293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microrchidia 2B transcript_id : NM_177719.3

name	LOC100038859 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268461 GeneID:100038859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038859 transcript_id : XM_001471659.1

name	LOC100038860 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268463 GeneID:100038860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038860 transcript_id : XM_001471916.1

name	LOC100043474 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268754 GeneID:100043474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1110 Proteins product : similar to olfactory receptor Olr1092 transcript_id : XM_001480594.1

name	Zfp422-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268744 GeneID:77652 MGI:3028594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 108 ESTs product : zinc finger protein 422, related sequence 1 transcript_id : XM_001480577.1

name	Olfr63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128642 GeneID:258939 MGI:1335096
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 63 transcript_id : NM_146937.1

name	LOC100043468 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268748 GeneID:100043468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs product : similar to Zinc finger protein 422, related sequence 1 transcript_id : XM_001480580.1

name	Zfp81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432559 GeneID:224694 MGI:1890752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 81 transcript_id : NM_207541.1

name	Zfp101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119120796 GeneID:22643 MGI:107547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 101 transcript_id : NM_009542.2

name	1700029I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662420 GeneID:69481 MGI:1916731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700029I08 gene transcript_id : NM_183282.2

name	LOC100042953 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268658 GeneID:100042953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to nuclear factor, interleukin 3 regulated transcript_id : XM_001479150.1

name	Adamts10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064868 GeneID:224697 MGI:2449112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10 transcript_id : NM_172619.2

name	Myo1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859762 GeneID:17916 MGI:107711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IF transcript_id : NM_053214.1

name	Zfp414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892660 GeneID:328801 MGI:1915641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 414 transcript_id : NM_026712.2

name	Pram1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50726895 GeneID:378460 MGI:3576625
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PML-RAR alpha-regulated adaptor molecule 1 transcript_id : NM_001002842.1

name	Hnrpm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803569 GeneID:76936 MGI:1926465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein M transcript_id : NM_029804.2

name	March2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349138 GeneID:224703 MGI:1925915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-associated ring finger (C3HC4) 2 transcript_id : NM_145486.3

name	Rab11b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431264 GeneID:19326 MGI:99425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11B, member RAS oncogene family transcript_id : NM_008997.3

name	Angptl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181163 GeneID:57875 MGI:1888999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin-like 4 transcript_id : NM_020581.1

name	Ankrd47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344046 GeneID:80880 MGI:1098615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 47 transcript_id : NM_030697.2

name	Rps28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426820 GeneID:54127 MGI:1859516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S28 transcript_id : NM_016844.1

name	Ndufa7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891825 GeneID:66416 MGI:1913666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) transcript_id : NM_023202.3

name	Cd320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853587 GeneID:54219 MGI:1860083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD320 antigen transcript_id : NM_019421.3

name	LOC100042967 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268660 GeneID:100042967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to EF hand domain family, member B transcript_id : XM_001479201.1

name	LOC630219 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268762 GeneID:630219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC630219 transcript_id : XM_001480651.1

name	LOC100042970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268662 GeneID:100042970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 34 Proteins product : similar to Kifc1 protein transcript_id : XM_001479207.1

name	BC051226 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268766 GeneID:407803 MGI:3039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : cDNA sequence BC051226 transcript_id : XM_001480654.1

name	Daxx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181184 GeneID:13163 MGI:1197015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas death domain-associated protein transcript_id : NM_007829.3

name	Zbtb22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560784 GeneID:81630 MGI:1931870
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 22 transcript_id : NM_020625.2

name	Tapbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778973 GeneID:21356 MGI:1201689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAP binding protein transcript_id : NM_001025313.1

name	Tapbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778724 GeneID:21356 MGI:1201689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAP binding protein transcript_id : NM_009318.2

name	Rgl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46195799 GeneID:19732 MGI:107483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ral guanine nucleotide dissociation stimulator-like 2 transcript_id : NM_009059.2

name	H2-Ke2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754127 GeneID:14976 MGI:95908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2-K region expressed gene 2 transcript_id : NM_010385.1

name	Wdr46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982691 GeneID:57315 MGI:1931871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 46 transcript_id : NM_020603.2

name	B3galt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506416 GeneID:54218 MGI:1859517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGalNAc beta 1,3-galactosyltransferase, polypeptide 4 transcript_id : NM_019420.1

name	Rps18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755367 GeneID:20084 MGI:98146
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S18 transcript_id : NM_011296.1

name	Vps52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375696 GeneID:224705 MGI:1330304
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 52 (yeast) transcript_id : NM_172620.2

name	EG630499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486607 GeneID:630499 MGI:3644203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG630499 transcript_id : NM_001081015.1

name	AA388235 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380530 GeneID:433100 MGI:3035178
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA388235 transcript_id : NM_001013793.2

name	H2-K1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922587 GeneID:14972 MGI:95904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, K1, K region transcript_id : NM_001001892.2

name	Ring1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982045 GeneID:19763 MGI:1101770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 1 transcript_id : NM_009066.2

name	H2-Ke6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305124 GeneID:14979 MGI:95911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2-K region expressed gene 6 transcript_id : NM_013543.1

name	Slc39a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118150667 GeneID:14977 MGI:95909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 7 transcript_id : NM_001077709.1

name	Slc39a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118150669 GeneID:14977 MGI:95909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 7 transcript_id : NM_008202.2

name	Rxrb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130198 GeneID:20182 MGI:98215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoid X receptor beta transcript_id : NM_011306.3

name	Col11a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753481 GeneID:12815 MGI:88447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XI, alpha 2 transcript_id : NM_009926.1

name	H2-Oa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680150 GeneID:15001 MGI:95924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, O region alpha locus transcript_id : NM_008206.1

name	Brd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100913022 GeneID:14312 MGI:99495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 2 transcript_id : NM_010238.3

name	Brd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100913023 GeneID:14312 MGI:99495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 2 transcript_id : NM_001025387.2

name	LOC100043003 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268666 GeneID:100043003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 ESTs product : similar to Col1a1 protein transcript_id : XM_001479277.1

name	LOC100043522 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268774 GeneID:100043522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043522 transcript_id : XM_001480724.1

name	H2-DMa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981712 GeneID:14998 MGI:95921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, class II, locus DMa transcript_id : NM_010386.2

name	H2-DMb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626089 GeneID:15000 MGI:95923
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, class II, locus Mb2 transcript_id : NM_010388.2

name	H2-DMb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981707 GeneID:14999 MGI:95922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, class II, locus Mb1 transcript_id : NM_010387.2

name	Psmb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129789 GeneID:16912 MGI:1346526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteosome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2) transcript_id : NM_013585.2

name	Tap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305538 GeneID:21354 MGI:98483
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) transcript_id : NM_013683.1

name	Psmb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755207 GeneID:16913 MGI:1346527
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteosome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) transcript_id : NM_010724.1

name	Tap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46399205 GeneID:21355 MGI:98484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transporter 2, ATP-binding cassette, sub-family B (MDR/TAP) transcript_id : NM_011530.2

name	H2-Ob (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861232 GeneID:15002 MGI:95925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, O region beta locus transcript_id : NM_010389.3

name	H2-Ab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227216 GeneID:14961 MGI:103070
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, class II antigen A, beta 1 transcript_id : NM_207105.2

name	H2-Aa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981715 GeneID:14960 MGI:95895
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, class II antigen A, alpha transcript_id : NM_010378.2

name	H2-Eb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431227 GeneID:14969 MGI:95901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, class II antigen E beta transcript_id : NM_010382.2

name	H2-Eb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345320 GeneID:381091 MGI:95902
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, class II antigen E beta2 transcript_id : NM_001033978.2

name	H2-Ea (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982788 GeneID:14968 MGI:95900
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, class II antigen E alpha transcript_id : NM_010381.2

name	Btnl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83721944 GeneID:547431 MGI:1859549
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : butyrophilin-like 2 transcript_id : NM_079835.1

name	LOC100038862 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268465 GeneID:100038862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038862 transcript_id : XM_001471911.1

name	BC051142 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47564077 GeneID:407788 MGI:3039565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC051142 transcript_id : NM_001001177.1

name	EG632126 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803297 GeneID:632126 MGI:3648221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG632126 transcript_id : NM_001039241.2

name	Btnl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157505 GeneID:195349 MGI:2388054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : butyrophilin-like 7 transcript_id : NM_001081663.1

name	Notch4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326468 GeneID:18132 MGI:107471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Notch gene homolog 4 (Drosophila) transcript_id : NM_010929.2

name	Gpsm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931665 GeneID:106512 MGI:2146785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein signalling modulator 3 (AGS3-like, C. elegans) transcript_id : NM_134116.3

name	Pbx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567383 GeneID:18515 MGI:1341793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre B-cell leukemia transcription factor 2 transcript_id : NM_017463.1

name	Ager (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225340 GeneID:11596 MGI:893592
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : advanced glycosylation end product-specific receptor transcript_id : NM_007425.2

name	Rnf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130759 GeneID:54197 MGI:1860076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 5 transcript_id : NM_019403.3

name	Agpat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560789 GeneID:55979 MGI:1932075
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha) transcript_id : NM_018862.2

name	Egfl8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098146 GeneID:81701 MGI:1932094
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like domain 8 transcript_id : NM_152922.2

name	Ppt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803551 GeneID:54397 MGI:1860075
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : palmitoyl-protein thioesterase 2 transcript_id : NM_019441.3

name	Prrt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13562101 GeneID:260297 MGI:1932118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich transmembrane protein 1 transcript_id : NM_030890.1

name	Fkbpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980974 GeneID:56299 MGI:1932127
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein-like transcript_id : NM_019873.2

name	Crebl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980863 GeneID:12915 MGI:105121
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cAMP responsive element binding protein-like 1 transcript_id : NM_017406.2

name	Tnxb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13928671 GeneID:81877 MGI:1932137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tenascin XB transcript_id : NM_031176.1

name	C4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753225 GeneID:12268 MGI:88228
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 4B (Childo blood group) transcript_id : NM_009780.1

name	Cyp21a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753569 GeneID:13079 MGI:88591
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 21, subfamily a, polypeptide 1 transcript_id : NM_009995.1

name	C4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126215531 GeneID:625018 MGI:98320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 4A (Rodgers blood group) transcript_id : NM_011413.2

name	Stk19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130750 GeneID:54402 MGI:1860085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 19 transcript_id : NM_019442.3

name	Dom3z (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15809031 GeneID:112403 MGI:1890444
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DOM-3 homolog Z (C. elegans) transcript_id : NM_033613.1

name	Skiv2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87252726 GeneID:108077 MGI:1099835
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : superkiller viralicidic activity 2-like (S. cerevisiae ) transcript_id : NM_021337.2

name	Rdbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052413 GeneID:27632 MGI:102744
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RD RNA-binding protein transcript_id : NM_001045864.1

name	Rdbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052227 GeneID:27632 MGI:102744
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RD RNA-binding protein transcript_id : NM_001045863.1

name	Rdbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052225 GeneID:27632 MGI:102744
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RD RNA-binding protein transcript_id : NM_138580.2

name	Cfb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6996918 GeneID:14962 MGI:105975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement factor B transcript_id : NM_008198.1

name	C2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304936 GeneID:12263 MGI:88226
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement component 2 (within H-2S) transcript_id : NM_013484.1

name	Zbtb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254419 GeneID:193736 MGI:88133
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 12 transcript_id : NM_198886.2

name	Ehmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22219431 GeneID:110147 MGI:2148922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : euchromatic histone lysine N-methyltransferase 2 transcript_id : NM_147151.1

name	Ehmt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164771 GeneID:110147 MGI:2148922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : euchromatic histone lysine N-methyltransferase 2 transcript_id : NM_145830.1

name	9030612M13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140969612 GeneID:208292 MGI:1921793
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208292 protein_id : NP_766046.3

name	Zfp811 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147228 GeneID:240063 MGI:2682944
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 811 protein_id : NP_899000.1

name	6030490I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793418 GeneID:240064 MGI:2443934
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein protein_id : NP_796333.2

name	BC066107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402247 GeneID:240066 MGI:3029586
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240066 protein_id : NP_997128.1

name	Cyp4f14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967965 CCDS:CCDS28621.1 GeneID:64385 MGI:1927669
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0050051 - leukotriene-B4 20-monooxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, subfamily IVF, polypeptide 14 (leukotriene B4 omega hydroxylase) product : cytochrome P450, family 4, subfamily f, polypeptide 14 protein_id : NP_071879.1

name	Cyp4f13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373155 CCDS:CCDS28622.1 GeneID:170716 MGI:2158641
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : cytochrome P450,subfamily IVF, polypeptide 13; cytochrome P450 CYP4F13; leukotriene B4 omega hydroxylase product : cytochrome P450, family 4, subfamily f, polypeptide 13 protein_id : NP_570952.1

name	6030422M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20899446 GeneID:77875 MGI:1925125
definition	codon_start : 1 product : hypothetical protein LOC77875 protein_id : XP_128564.1

name	Zfp472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346459 GeneID:224691 MGI:2385049
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : KRAB box containing zinc finger protein; Krab box proteins interacting with myc 1; zin finger protein 472 product : zinc finger protein 472 protein_id : NP_694703.1

name	C920016K16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930752 GeneID:240067 MGI:2441928
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240067 protein_id : NP_001039024.1

name	1700065O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037331 GeneID:73451 MGI:1920701
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : RIKEN cDNA 1700065O13 protein_id : NP_082819.1

name	4921501E09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222274 CCDS:CCDS28624.1 GeneID:74042 MGI:1921292
definition	codon_start : 1 note : KIAA1111-like protein product : PHD finger protein 8 protein_id : NP_001009544.1

name	Zfp563 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930758 GeneID:240068 MGI:2677168
definition	codon_start : 1 note : zinc finger protein NTfin7 product : zinc finger protein ZFP413 protein_id : NP_001020121.2

name	Morc2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244180 GeneID:240069 MGI:3045293
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Morc-like protein product : microrchidia 2B protein_id : NP_808387.1

name	LOC100038859 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268462 GeneID:100038859
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471709.1

name	LOC100038860 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268464 GeneID:100038860
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471966.1

name	LOC100043474 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268755 GeneID:100043474
definition	codon_start : 1 product : similar to olfactory receptor Olr1092 protein_id : XP_001480644.1

name	Zfp422-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268745 GeneID:77652 MGI:3028594
definition	codon_start : 1 product : zinc finger protein 422, related sequence 1 protein_id : XP_001480627.1

name	Olfr63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128643 GeneID:258939 MGI:1335096
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NTC5-9778-8828 product : olfactory receptor 63 protein_id : NP_667148.1

name	LOC100043468 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268749 GeneID:100043468
definition	codon_start : 1 product : similar to Zinc finger protein 422, related sequence 1 protein_id : XP_001480630.1

name	Zfp81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432560 GeneID:224694 MGI:1890752
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : ZFP-36 zinc finger protein product : zinc finger protein 81 protein_id : NP_997424.1

name	Zfp101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119120797 GeneID:22643 MGI:107547
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 101 protein_id : NP_033568.2

name	1700029I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662421 GeneID:69481 MGI:1916731
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69481 protein_id : NP_899105.2

name	LOC100042953 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268659 GeneID:100042953
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479200.1

name	Adamts10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064869 GeneID:224697 MGI:2449112
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc metalloendopeptidase product : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10 protein_id : NP_766207.2

name	Myo1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859763 GeneID:17916 MGI:107711
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : myosin-1F-like protein product : myosin IF protein_id : NP_444444.1

name	Zfp414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34850068 GeneID:328801 MGI:1915641
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger, C2H2 type containing protein product : zinc finger protein 414 protein_id : NP_080988.1

name	Pram1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50726896 GeneID:378460 MGI:3576625
definition	codon_start : 1 exception : mismatches in translation product : PML-RARA regulated adaptor molecule 1 protein_id : NP_001002842.1

name	Hnrpm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313308 GeneID:76936 MGI:1926465
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein M protein_id : NP_084080.1

name	March2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542053 CCDS:CCDS28627.1 GeneID:224703 MGI:1925915
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : membrane-associated ring finger (C3HC4) 2 protein_id : NP_663461.2

name	Rab11b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679583 CCDS:CCDS28628.1 GeneID:19326 MGI:99425
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB11B, member RAS oncogene family protein_id : NP_033023.1

name	Angptl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181164 CCDS:CCDS28629.1 GeneID:57875 MGI:1888999
definition	GO_component : GO:0005576 - extracellular region [Evidence IEP]; GO:0005615 - extracellular space [Evidence ISS] [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IDA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0009267 - cellular response to starvation [Evidence NAS]; GO:0043066 - negative regulation of apoptosis [Evidence IDA] [Evidence ISS]; GO:0051005 - negative regulation of lipoprotein lipase activity [Evidence IDA]; GO:0045766 - positive regulation of angiogenesis [Evidence IDA]; GO:0045834 - positive regulation of lipid metabolism [Evidence NAS]; GO:0001666 - response to hypoxia [Evidence ISS] codon_start : 1 exception : mismatches in translation note : major histocompatibility complex region NG27 product : fibrinogen/angiopoietin-related protein protein_id : NP_065606.1

name	Ankrd47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507632 CCDS:CCDS28630.1 GeneID:80880 MGI:1098615
definition	codon_start : 1 product : ankyrin repeat domain 47 protein_id : NP_109622.1

name	Rps28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426821 GeneID:54127 MGI:1859516
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein S28 protein_id : NP_058540.1

name	Ndufa7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963571 CCDS:CCDS28631.1 GeneID:66416 MGI:1913666
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0042773 - ATP synthesis coupled electron transport [Evidence IEA] codon_start : 1 note : NADH oxidoreductase product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) protein_id : NP_075691.1

name	Cd320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853588 CCDS:CCDS28632.1 GeneID:54219 MGI:1860083
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : putative VLDL lipoprotein receptor product : putative VLDL lipoprotein receptor precursor protein_id : NP_062294.3

name	LOC100042967 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268661 GeneID:100042967
definition	codon_start : 1 product : similar to EF hand domain family, member B protein_id : XP_001479251.1

name	LOC630219 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268763 GeneID:630219
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480701.1

name	LOC100042970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268663 GeneID:100042970
definition	codon_start : 1 product : similar to Kifc1 protein protein_id : XP_001479257.1

name	BC051226 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268767 GeneID:407803 MGI:3039585
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480704.1

name	Daxx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181185 CCDS:CCDS28633.1 GeneID:13163 MGI:1197015
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0016605 - PML body [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : death-domain associated protein product : Fas death domain-associated protein protein_id : NP_031855.3

name	Zbtb22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181180 CCDS:CCDS28634.1 GeneID:81630 MGI:1931870
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 297 protein_id : NP_065650.1

name	Tapbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778974 GeneID:21356 MGI:1201689
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA] GO_process : GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA]; GO:0006952 - defense response [Evidence IMP]; GO:0050823 - peptide antigen stabilization [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Tapasin product : TAP binding protein isoform 1 protein_id : NP_001020484.1

name	Tapbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678219 GeneID:21356 MGI:1201689
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA] GO_process : GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA]; GO:0006952 - defense response [Evidence IMP]; GO:0050823 - peptide antigen stabilization [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Tapasin product : TAP binding protein isoform 2 protein_id : NP_033344.1

name	Rgl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195800 CCDS:CCDS28635.1 GeneID:19732 MGI:107483
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : ral guanine nucleotide dissociation stimulator,-like 2; RalGDS-like; RalGDS-like factor product : RAB2, member RAS oncogene family-like protein_id : NP_033085.2

name	H2-Ke2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754128 CCDS:CCDS28636.1 GeneID:14976 MGI:95908
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : H2-K region expressed gene 2 protein_id : NP_034515.1

name	Wdr46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181122 CCDS:CCDS28637.1 GeneID:57315 MGI:1931871
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : WD repeat domain 46 protein_id : NP_065628.1

name	B3galt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506417 CCDS:CCDS28638.1 GeneID:54218 MGI:1859517
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0047915 - ganglioside galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 function : ganglioside glycosyltransferase note : UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 product : UDP-Gal:betaGalNAc beta 1,3-galactosyltransferase, polypeptide 4 protein_id : NP_062293.1

name	Rps18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755368 GeneID:20084 MGI:98146
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0019843 - rRNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein S18 protein_id : NP_035426.1

name	Vps52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60687520 GeneID:224705 MGI:1330304
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : SAC2 product : vacuolar protein sorting 52 protein_id : NP_766208.1

name	EG630499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486608 GeneID:630499 MGI:3644203
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 product : predicted gene, EG630499 protein_id : NP_001074484.1

name	AA388235 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701480 GeneID:433100 MGI:3035178
definition	codon_start : 1 product : hypothetical protein LOC433100 protein_id : NP_001013815.1

name	H2-K1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922588 GeneID:14972 MGI:95904
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence TAS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; MHC class I H2-K-b-alpha-2 cell surface glycoprotein; MHC H2-K transplantation antigen; MHC K-bm6 transplantation antigen; MHC class I heavy chain H2-K; H-2Kd homolog; class I major histocompatibility antigen H-2Kd; MHC class Ia H2-K antigen; MHC (A.CA/J(H-2K-f) class I antigen product : histocompatibility 2, K1, K region isoform 1 protein_id : NP_001001892.2

name	Ring1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982046 GeneID:19763 MGI:1101770
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0031519 - PcG protein complex [Evidence IDA]; GO:0001739 - sex chromatin [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP] [Evidence IGI]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IGI]; GO:0016574 - histone ubiquitination [Evidence IDA] [Evidence IGI]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ring finger protein 1 protein_id : NP_033092.2

name	H2-Ke6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305125 GeneID:14979 MGI:95911
definition	EC_number : 1.1.1.62 GO_component : GO:0005624 - membrane fraction [Evidence IDA]; GO:0005740 - mitochondrial envelope [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004303 - estradiol 17-beta-dehydrogenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0050327 - testosterone 17-beta-dehydrogenase activity [Evidence IDA] GO_process : GO:0008209 - androgen metabolism [Evidence IDA]; GO:0008210 - estrogen metabolism [Evidence IDA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : 17-beta-hydroxysteroid dehydrogenase 8; 17-beta-HSD 8; Estrogen 17-oxidoreductase product : estradiol 17 beta-dehydrogenase 8 protein_id : NP_038571.1

name	Slc39a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118150668 GeneID:14977 MGI:95909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006829 - zinc ion transport [Evidence IEA] codon_start : 1 note : H2-K region expressed gene 4 product : solute carrier family 39, member 7 protein_id : NP_001071177.1

name	Slc39a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118150670 GeneID:14977 MGI:95909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006829 - zinc ion transport [Evidence IEA] codon_start : 1 note : H2-K region expressed gene 4 product : solute carrier family 39, member 7 protein_id : NP_032228.2

name	Rxrb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13489062 GeneID:20182 MGI:98215
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : retinoid X receptor beta protein_id : NP_035436.1

name	Col11a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753482 CCDS:CCDS28640.1 GeneID:12815 MGI:88447
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type XI, alpha 2 protein_id : NP_034056.1

name	H2-Oa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680151 GeneID:15001 MGI:95924
definition	GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0045012 - MHC class II receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IMP]; GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0045580 - regulation of T cell differentiation [Evidence IMP] codon_start : 1 exception : mismatches in translation function : unknown product : histocompatibility 2, O region alpha locus protein_id : NP_032232.1

name	Brd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067345 CCDS:CCDS28641.1 GeneID:14312 MGI:99495
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; female sterile homeotic-related gene 1 product : bromodomain containing 2 isoform a protein_id : NP_034368.2

name	Brd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067347 GeneID:14312 MGI:99495
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; female sterile homeotic-related gene 1 product : bromodomain containing 2 isoform b protein_id : NP_001020558.1

name	LOC100043003 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268667 GeneID:100043003
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479327.1

name	LOC100043522 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268775 GeneID:100043522
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480774.1

name	H2-DMa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981713 GeneID:14998 MGI:95921
definition	GO_component : GO:0010008 - endosome membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA]; GO:0005765 - lysosomal membrane [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005771 - multivesicular body [Evidence IDA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0045012 - MHC class II receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019882 - antigen processing and presentation [Evidence IDA] [Evidence IMP]; GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IDA] [Evidence IMP]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IMP] [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0050778 - positive regulation of immune response [Evidence IMP]; GO:0045582 - positive regulation of T cell differentiation [Evidence IMP]; GO:0045059 - positive thymic T cell selection [Evidence IMP]; GO:0006461 - protein complex assembly [Evidence IDA]; GO:0015031 - protein transport [Evidence IDA] codon_start : 1 exception : mismatches in translation note : histocompatibility 2, class II, locus Ma product : histocompatibility 2, class II, locus DMa protein_id : NP_034516.2

name	H2-DMb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754124 GeneID:15000 MGI:95923
definition	GO_component : GO:0010008 - endosome membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA]; GO:0005765 - lysosomal membrane [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005771 - multivesicular body [Evidence IDA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0045012 - MHC class II receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019882 - antigen processing and presentation [Evidence ISS] [Evidence IDA]; GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IDA]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IDA] codon_start : 1 product : histocompatibility 2, class II, locus Mb2 protein_id : NP_034518.1

name	H2-DMb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981708 GeneID:14999 MGI:95922
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0045012 - MHC class II receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IDA]; GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IDA]; GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IDA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : histocompatibility 2, class II, locus Mb1 protein_id : NP_034517.2

name	Psmb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567394 CCDS:CCDS28642.1 GeneID:16912 MGI:1346526
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IDA] [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : large multifunctional protease 2 product : proteosome (prosome, macropain) subunit, beta type 9 (large multifunctional protease 2) protein_id : NP_038613.1

name	Tap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305539 CCDS:CCDS28643.1 GeneID:21354 MGI:98483
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0015198 - oligopeptide transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0006857 - oligopeptide transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : histocompatibility antigen modifier 1; transporter 1, ABC (ATP binding cassette); ATP dependent transport protein family member; ATP-binding cassette, sub-family B (MDR/TAP), member 2; ABC transporter, MHC, 1; peptide supply factor 1; peptide transporter PSF1; transporter, ABC, MHC, 1; antigen peptide transporter 1; transporter associated with antigen processing 1; ATP-binding cassette transporter, major histocompatibility complex, 1; transporter, ATP-binding cassette, major histocompatibility complex, 1 product : transporter 1, ATP-binding cassette, sub-family B protein_id : NP_038711.1

name	Psmb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755208 GeneID:16913 MGI:1346527
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : large multifunctional protease 7; MC13 (LMP7); proteasome subunit MC13 product : proteosome (prosome, macropain) subunit, beta type 8 (large multifunctional protease 7) protein_id : NP_034854.1

name	Tap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46399206 CCDS:CCDS28644.1 GeneID:21355 MGI:98484
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005788 - endoplasmic reticulum lumen [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0042825 - TAP complex [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0004409 - homoaconitate hydratase activity [Evidence ISS]; GO:0042288 - MHC class I protein binding [Evidence ISS]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0015198 - oligopeptide transporter activity [Evidence IEA]; GO:0042605 - peptide antigen binding [Evidence ISS]; GO:0015433 - peptide antigen-transporting ATPase activity [Evidence ISS]; GO:0042301 - phosphate binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0046980 - tapasin binding [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence ISS]; GO:0046967 - cytosol to ER transport [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence ISS]; GO:0006857 - oligopeptide transport [Evidence IEA]; GO:0015833 - peptide transport [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : histocompatibility antigen modifier 2; transporter 2, ABC (ATP binding cassette); ATP dependent transport protein family member; ATP-binding cassette, sub-family B (MDR/TAP), member 3 product : transporter 2, ATP-binding cassette, sub-family B protein_id : NP_035660.2

name	H2-Ob (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29788774 GeneID:15002 MGI:95925
definition	GO_component : GO:0005622 - intracellular [Evidence IDA]; GO:0005764 - lysosome [Evidence ISS] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0045012 - MHC class II receptor activity [Evidence IEA] GO_process : GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IEA] codon_start : 1 note : H2-IA-beta-2 antigen product : histocompatibility 2, O region beta locus protein_id : NP_034519.2

name	H2-Ab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358078 GeneID:14961 MGI:103070
definition	GO_component : GO:0005769 - early endosome [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0005622 - intracellular [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0042613 - MHC class II protein complex [Evidence IDA]; GO:0005771 - multivesicular body [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0045012 - MHC class II receptor activity [Evidence IDA]; GO:0042605 - peptide antigen binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019882 - antigen processing and presentation [Evidence IDA]; GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IDA] [Evidence IEA]; GO:0048002 - antigen processing and presentation of peptide antigen [Evidence IDA]; GO:0006952 - defense response [Evidence IMP]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : response to metastatic cancers 1; MHC H2-IA-beta-1 (bm12) chain; A beta; I-A^b; H-2 I-A beta p; MHC class II H2-IA-beta-psi; major histocompatibility complex class II beta chain; lymphocyte antigen; MHC class II beta chain A-beta-7; MHC class II beta chain A-beta-5; MHC class II antigen A beta; MHC-II I-A(d) beta; H-2 class II histocompatibility antigen, A-D beta chain; I-A beta MHC class II product : histocompatibility 2, class II antigen A, beta 1 protein_id : NP_996988.1

name	H2-Aa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981716 CCDS:CCDS28645.1 GeneID:14960 MGI:95895
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0042613 - MHC class II protein complex [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0045012 - MHC class II receptor activity [Evidence IDA]; GO:0042605 - peptide antigen binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019882 - antigen processing and presentation [Evidence IDA]; GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IEA] [Evidence IDA]; GO:0048002 - antigen processing and presentation of peptide antigen [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0045582 - positive regulation of T cell differentiation [Evidence IDA] codon_start : 1 note : A alpha; major histocompatibility protein class II alpha chain; MHC-II I-A(d) alpha; H-2 class II histocompatibility antigen, A-D alpha chain; MHC class II antigen product : histocompatibility 2, class II antigen A, alpha protein_id : NP_034508.2

name	H2-Eb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114431228 GeneID:14969 MGI:95901
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0045012 - MHC class II receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IDA] [Evidence IEA]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : MHC class II IE-b; MHC class II E beta; MHC class II protein; MHC E-beta-f; MHC II H2-IE-beta; cell surface glycoprotein; I-E beta MHC class II; MHC H2-IE-beta cell surface glycoprotein; major histocompatibility complex H-2E beta chain'; MHC class II antigen; I-E beta-chain product : histocompatibility 2, class II antigen E beta protein_id : NP_034512.2

name	H2-Eb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702171 CCDS:CCDS28646.1 GeneID:381091 MGI:95902
definition	GO_function : GO:0003823 - antigen binding [Evidence IEA] codon_start : 1 note : H-2 class II histocompatibility antigen E-a/k beta-2; MHC class II E-beta-2 product : histocompatibility 2, class II antigen E beta2 protein_id : NP_001029150.1

name	H2-Ea (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982789 GeneID:14968 MGI:95900
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005764 - lysosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0045012 - MHC class II receptor activity [Evidence IDA] GO_process : GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IEA] [Evidence IDA]; GO:0006952 - defense response [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence IGI] [Evidence IDA]; GO:0050778 - positive regulation of immune response [Evidence IDA] [Evidence IGI] codon_start : 1 exception : unclassified translation discrepancy note : MHC class II protein; MHC class II antigen E alpha; I-E alpha MHC class II product : histocompatibility 2, class II antigen E alpha protein_id : NP_034511.2

name	Btnl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83721945 GeneID:547431 MGI:1859549
definition	codon_start : 1 note : butyrophylin-like MHC class II associated product : butyrophilin-like 2 protein_id : NP_524574.1

name	LOC100038862 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268466 GeneID:100038862
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471961.1

name	BC051142 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564078 GeneID:407788 MGI:3039565
definition	codon_start : 1 exception : mismatches in translation note : testis specific basic protein product : hypothetical protein LOC407788 protein_id : NP_001001177.1

name	EG632126 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986641 GeneID:632126 MGI:3648221
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC632126 protein_id : NP_001034330.1

name	Btnl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157506 GeneID:195349 MGI:2388054
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : butyrophilin-like 7 protein_id : NP_001075132.1

name	Notch4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326469 CCDS:CCDS28647.1 GeneID:18132 MGI:107471
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence ISS]; GO:0001709 - cell fate determination [Evidence ISS]; GO:0007275 - development [Evidence IEA]; GO:0009790 - embryonic development [Evidence IMP]; GO:0030097 - hemopoiesis [Evidence ISS]; GO:0001763 - morphogenesis of a branching structure [Evidence IMP]; GO:0045602 - negative regulation of endothelial cell differentiation [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence TAS] [Evidence IEA]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0050793 - regulation of development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Notch gene homolog 4 protein_id : NP_035059.2

name	Gpsm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527346 GeneID:106512 MGI:2146785
definition	codon_start : 1 product : G-protein signalling modulator 3 (AGS3-like, C. elegans) protein_id : NP_598877.1

name	Pbx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567384 CCDS:CCDS28648.1 GeneID:18515 MGI:1341793
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : pre B-cell leukemia transcription factor 2 protein_id : NP_059491.1

name	Ager (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225341 CCDS:CCDS28649.1 GeneID:11596 MGI:893592
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IDA] codon_start : 1 product : advanced glycosylation end product-specific receptor protein_id : NP_031451.2

name	Rnf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507059 CCDS:CCDS28650.1 GeneID:54197 MGI:1860076
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ring finger protein 5 protein_id : NP_062276.1

name	Agpat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560790 GeneID:55979 MGI:1932075
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003841 - 1-acylglycerol-3-phosphate O-acyltransferase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 1-acyl-sn-glycerol-3-phosphate acyltransferase; Lpaat-alpha product : 1-acylglycerol-3-phosphate O-acyltransferase 1 protein_id : NP_061350.2

name	Egfl8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098147 CCDS:CCDS28651.1 GeneID:81701 MGI:1932094
definition	GO_function : GO:0005509 - calcium ion binding [Evidence NAS] [Evidence IEA] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IEP] codon_start : 1 exception : mismatches in translation product : EGF-like domain 8 protein_id : NP_690886.2

name	Ppt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506985 CCDS:CCDS28652.1 GeneID:54397 MGI:1860075
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008474 - palmitoyl-(protein) hydrolase activity [Evidence IMP] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : palmitoyl-protein thioesterase 2 protein_id : NP_062314.1

name	Prrt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13562102 CCDS:CCDS28653.1 GeneID:260297 MGI:1932118
definition	codon_start : 1 product : NG5 protein protein_id : NP_112152.1

name	Fkbpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845275 CCDS:CCDS28654.1 GeneID:56299 MGI:1932127
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : immunophilin-like protein NG7 product : WAF-1/CIP1 stabilizing protein 39 protein_id : NP_063926.1

name	Crebl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393190 CCDS:CCDS28655.1 GeneID:12915 MGI:105121
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence ISS]; GO:0005769 - early endosome [Evidence ISS]; GO:0012505 - endomembrane system [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence ISS]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0016458 - gene silencing [Evidence ISS]; GO:0007076 - mitotic chromosome condensation [Evidence ISS]; GO:0045749 - negative regulation of S phase of mitotic cell cycle [Evidence ISS]; GO:0045014 - negative regulation of transcription by glucose [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : cAMP response element binding protein-related protein product : cAMP responsive element binding protein-like 1 protein_id : NP_059102.1

name	Tnxb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13928672 CCDS:CCDS28656.1 GeneID:81877 MGI:1932137
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008201 - heparin binding [Evidence IDA] GO_process : GO:0030199 - collagen fibril organization [Evidence IMP]; GO:0045785 - positive regulation of cell adhesion [Evidence IDA] codon_start : 1 product : tenascin XB protein_id : NP_112453.1

name	C4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753226 CCDS:CCDS28657.1 GeneID:12268 MGI:88228
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IMP] [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 exception : mismatches in translation product : complement component 4 (within H-2S) protein_id : NP_033910.1

name	Cyp21a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753570 CCDS:CCDS28658.1 GeneID:13079 MGI:88591
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004509 - steroid 21-monooxygenase activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 21, steroid 21 hydroxylase; 21-hydroxylase; cytochrome P450 hydroxylase A; cytochrome P-450; steroid 21-hydroxylase product : cytochrome P450, family 21, subfamily a, polypeptide 1 protein_id : NP_034125.1

name	C4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126215532 GeneID:625018 MGI:98320
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : sex-limited protein protein_id : NP_035543.2

name	Stk19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507153 CCDS:CCDS28659.1 GeneID:54402 MGI:1860085
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : serine threonine kinase 19 product : serine/threonine kinase 19 protein_id : NP_062315.1

name	Dom3z (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809032 CCDS:CCDS28660.1 GeneID:112403 MGI:1890444
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : DOM-3 homolog Z protein_id : NP_291091.1

name	Skiv2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87252727 CCDS:CCDS28661.1 GeneID:108077 MGI:1099835
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 product : superkiller viralicidic activity 2-like protein_id : NP_067312.2

name	Rdbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052228 GeneID:27632 MGI:102744
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : RD RNA-binding protein protein_id : NP_001039328.1

name	Rdbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052414 GeneID:27632 MGI:102744
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : RD RNA-binding protein protein_id : NP_001039329.1

name	Rdbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052226 CCDS:CCDS28662.1 GeneID:27632 MGI:102744
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : RD RNA-binding protein protein_id : NP_613046.2

name	Cfb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6996919 CCDS:CCDS28663.1 GeneID:14962 MGI:105975
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0003812 - alternative-complement-pathway C3/C5 convertase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence TAS]; GO:0006956 - complement activation [Evidence IEA]; GO:0006957 - complement activation, alternative pathway [Evidence TAS] [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 note : properdin; Factor B; alternative-complement pathway C3/C5 convertase product : histocompatibility 2, complement component factor B protein_id : NP_032224.1

name	C2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304937 CCDS:CCDS28664.1 GeneID:12263 MGI:88226
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0003813 - classical-complement-pathway C3/C5 convertase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006956 - complement activation [Evidence IEA]; GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : classical-complement pathway C3/C5 convertase; MHC complement component C2; complement factor; complement factor C2 product : complement component 2 (within H-2S) protein_id : NP_038512.1

name	Zbtb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254420 CCDS:CCDS28665.1 GeneID:193736 MGI:88133
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : HLA-B-associated transcript 9 product : zinc finger and BTB domain containing 12 protein_id : NP_942589.2

name	Ehmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22219432 CCDS:CCDS28666.1 GeneID:110147 MGI:2148922
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 note : isoform G9a short is encoded by transcript variant short; HLA-B associated transcript 8 product : euchromatic histone lysine N-methyltransferase 2 isoform G9a short protein_id : NP_671493.1

name	Ehmt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164772 CCDS:CCDS28667.1 GeneID:110147 MGI:2148922
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 note : isoform G9a long is encoded by transcript variant long; HLA-B associated transcript 8 product : euchromatic histone lysine N-methyltransferase 2 isoform G9a long protein_id : NP_665829.1

name	LOC100042989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042989
definition	number : 2 pseudo : _no_value

name	LOC100042989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042989
definition	number : 1 pseudo : _no_value

name	LOC672505 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672505
definition	number : 4 pseudo : _no_value

name	LOC672505 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672505
definition	number : 3 pseudo : _no_value

name	LOC672505 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672505
definition	number : 2 pseudo : _no_value

name	LOC672505 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672505
definition	number : 1 pseudo : _no_value

name	LOC667442 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667442
definition	number : 1 pseudo : _no_value

name	LOC624681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624681
definition	number : 9 pseudo : _no_value

name	LOC624681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624681
definition	number : 8 pseudo : _no_value

name	LOC624681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624681
definition	number : 7 pseudo : _no_value

name	LOC624681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624681
definition	number : 6 pseudo : _no_value

name	LOC624681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624681
definition	number : 5 pseudo : _no_value

name	LOC624681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624681
definition	number : 4 pseudo : _no_value

name	LOC624681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624681
definition	number : 3 pseudo : _no_value

name	LOC624681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624681
definition	number : 2 pseudo : _no_value

name	LOC624681 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624681
definition	number : 1 pseudo : _no_value

name	LOC100043024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043024
definition	number : 1 pseudo : _no_value

name	LOC100043024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043024
definition	number : 2 pseudo : _no_value

name	LOC100043024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043024
definition	number : 3 pseudo : _no_value

name	LOC100043024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043024
definition	number : 4 pseudo : _no_value

name	H2-Pa (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : H2-Pa-ps note : H2-Pa sequence after removal of the inserted nucleotide g at the position 136, insertion of a deleted nucleotide after the position 835, and deletion of B1 repeat plus 15 duplicated nucleotides pseudo : _no_value

name	(CDS detail)
type	misc_feature
link
xref
definition	note : copy 2 of a locus-specific repeat containing a butyrophilin-like gene

name	(CDS detail)
type	misc_feature
link
xref
definition	note : this span duplicates the region between 80946 and 99794; it contains the C4 gene and a copy of the 3' end of the G7 gene, exons 5-7

name	Stk19-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : RP2 note : this span duplicates the region from 105857-107756; it contains a copy of exons 3 and 4 of the G11 gene pseudo : _no_value

name	Skiv2l-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : Ski2w2 note : this span duplicates the region between 118458 and 120322; it contains a copy of exons 13 through 17 of the SKI gene pseudo : _no_value

name	LOC631266 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268752 GeneID:631266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 10 Proteins product : similar to ribosomal protein L7 pseudo : _no_value transcript_id : XR_034756.1

clone name	MSMg01-046F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359P08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-420H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-395N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-293P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064G01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-055M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294N04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-026C24.b	B6Ng01-026C24.g
ACC	DH857303	DH857304
length	1,174	793
definition	DH857303\|Mus musculus domesticus DNA, BAC clone: B6Ng01-026C24, 5' end.	DH857304\|Mus musculus domesticus DNA, BAC clone: B6Ng01-026C24, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(33,919,359 - 33,920,548)	(34,039,599 - 34,040,155)
sequence	gaattcatcttgagctacacaagtgagtttaagagagcctgggctactct gagccaggtctccaaacaacaacagcaacaacaaaactggtggcacgcac ctgtaaacccatcacgcaggacacaggggaatagtacaagctacaagcta gcctgctctacatagtaagttacagaccagtcaacgctgaaacagcaaga ccttgtttcaaaacaaaacaaaaacaattcatagttatgcatactttaac tcccagcactgcagagcaagaagcaattggaggaagctctgtgagtttga ggtcagcctggtctacatagtgaagttccaggccatccaggaagaagacc ttgtcacaaaacaacaacaacaacaactaaaaaagccaggaggaactgga aatctatcttaccagttaagagcatttacatcttttgcaggggatctaag tccaacagctcacagtcacctataattccagctccaggagctatggtgac tttgacctcctcaggcactcacacacatgcacacaatttaaaacagtcat ttaaacatttaaaaagcaggctggagagatggttcagcagttaagagtac tgactgctcttccaaaggtcctgagttaattcccagcaaccacatggtgg cttacaaccatctgtaataggatctgataccctcttccggtgtgtctgaa gacagctacaatgtactcatataaataaaataaatacatcttttttaaaa aaaatttaaaaagcaaacaatctagagaacatcagcaaagatttcccttc cacacccatccattcattcactcattccatacagcctagatcctgtactg agttttttagtttgtgtataaatcctacctttgagcacgggagagggaca aggcagagacaaagaggactggggtggggcagacagctttccttgtttat gctgcctggttaagtttttattcaacaagtttgcattggtgttctttttc tgacagttccctgaagctggcacagaaaacctgtctgacaagaagaacct taggcaattgactgaaaaacctcaagttgagtcagcaaggctggagcagc agcaaccttggatctgaaactgcatgcctcaggctgacatgcagccactg cttgtaccttgaccacttggcctt	gaattccaaatgccacacaaatacagaaactatcagctgctgtcacaacc atgcctctgctagagccgcggcaaatcctagtcagctgctgtggacagtc tgaaacaaccctctatccccacctggggttaaaatggaaaacattccctt ttctctttttgtaattttatttttatttgatgtgtattggtgttttacct acatgttgtgtgagaccatcagacccccaggaactggagttacaggaagt tatgagctgccatatgggtgctgagaatagaacccagggcctctggaaga gcagccagtgctcttaactgctgggtcacagttcactccagccctgaagt cacactcttataataacttctgggttttttttttttttttttttaagaaa ccaaaattccagaattctcggtggccggtggcgcacgcctttaatcccag catttgggaagtagaggcaggcggatttctgagttcaaggccaccctgct ccacaaagtgagttccaggacagtcagggctatacagagaaaccctgtct cgaaaaaccaaaaggaaaaaaaaaaaaaaaaaaaaaaaagaattctcact acagtggagcccaccattaagggcactaccagggagaaagaggcaggtgg atctttgaattcaaggccagcctggtctacatagagagttcccaggccaa gaatggagaaacagagaagttaacttgagtcacagttataataatgttgc acagagataaacaggatggaagccgggggcgggagggcggagg
quality values	Open. Hide. 61 41 27 30 61 38 35 43 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 55 61 61 41 49 28 28 28 30 37 55 30 55 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 59 61 59 59 55 55 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 44 35 55 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 53 61 61 61 43 61 61 61 61 61 61 61 61 42 52 61 61 61 50 57 57 57 57 53 57 57 53 43 57 46 34 57 57 53 53 57 57 53 57 53 43 57 53 57 53 53 53 53 57 57 57 53 57 57 53 57 57 53 53 53 47 38 42 53 47 46 28 53 53 53 57 57 42 57 47 40 53 38 53 42 47 42 50 52 53 52 53 46 47 50 53 42 53 57 57 47 47 47 52 57 52 52 50 32 53 47 47 35 57 50 53 57 42 52 53 52 52 52 57 41 33 45 41 52 46 42 47 43 46 46 53 53 50 53 45 46 37 57 52 57 57 57 42 42 47 53 57 53 45 38 31 33 53 53 53 38 46 16 47 37 53 27 39 36 53 32 29 38 53 52 36 57 53 50 50 57 57 53 40 50 57 39 39 36 53 31 52 42 29 57 57 57 57 32 29 57 57 57 57 57 57 45 29 57 53 37 57 57 57 57 40 37 37 52 43 38 28 40 39 33 34 34 37 40 25 37 39 24 27 41 33 25 32 33 27 53 53 40 39 26 57 48 35 53 44 28 44 27 37 28 39 34 30 45 30 26 32 19 31 27 31 43 29 24 30 34 30 31 32 47 30 25 24 44 32 34 32 30 31 29 32 31 38 33 32 31 23 35 29 29 48 28 48 20 29 29 29 39 34 24 30 51 51 51 51 32 37 24 28 51 31 33 22 28 18 28 33 35 51 29 28 29 29 29 35 28 29 25 51 43 23 30 24 35 11 5 31 51 29 36 19 43 25 41 24 19 14 19 20 25 39 9 29 15 46 15 28 11 21 41 46 14 31 33 14 30 12 31 28 51 51 43 20 39 51 44 33 14 29 20 41 15 15 16 28 31 46 30 15 26 22 18 30 11 46 22 18 21 20 28 28 34 14 28 33 35 33 12 21 32 29 17 28 51 51 51 28 31 34 26 24 19 23 29 24 23 29 28 51 14 22 22 25 33 27 34 28 13 19 8 22 23 6 32 36 51 19 8 7 9 11 7 10 21 21 22 16 31 30 18 22 16 30 8 16 6 16 26 10 6 6 6 8 21 39 38 28 8 14 22 14 7 7 24 31 30 8 10 15 13 20 17 4 6 21 11 23 9 26 4 4 9 14 23 11 5 12 29 25 22 16 28 23 36 42 33 5 12 13 8 26 5 15 21 19 22 12 8 5 7 6 9 7 5 5 5 17 18 11 4 4 2 3 4 18 11 11 12 5 4 5 13 8 6 10 6 3 3 7 13 3 4 15 15 21 32 24 11 13 13 14 9 11 6 7 7 11 8 17 18 9 5 14 13 10 7 5 14 5 4 6 22 5 11 4 6 5 6 4 17 4 8 3 2 3 6 20 20 7 12 10 6 12 6 4 7 16 9 1 10 14 13	Open. Hide. 61 61 31 47 61 49 38 19 32 43 52 31 28 25 37 49 49 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 55 61 61 61 61 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 55 37 59 59 59 59 55 55 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 59 61 61 59 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 41 55 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 41 43 52 32 55 52 55 52 52 41 52 55 55 55 55 55 55 41 43 61 52 43 50 49 49 49 49 55 43 55 55 41 50 50 55 37 55 55 43 37 50 37 50 43 55 55 55 55 61 37 43 49 49 49 49 35 35 50 50 53 53 53 53 53 50 50 50 43 43 43 24 50 39 47 42 38 38 50 35 35 38 43 43 45 38 39 47 32 50 17 35 35 31 45 46 39 53 33 42 31 39 45 50 43 47 38 47 47 47 35 47 53 57 53 53 35 52 52 45 45 43 39 39 32 27 47 47 34 43 43 45 50 47 47 57 42 42 53 38 45 41 52 37 42 53 36 53 53 38 42 34 30 45 50 47 39 47 42 42 50 53 52 38 28 38 47 27 42 45 39 31 52 43 43 43 43 57 57 47 50 47 43 43 47 36 37 46 46 53 46 43 41 26 52 53 52 39 52 28 34 53 35 44 41 24 31 37 33 37 33 37 27 52 50 50 30 41 38 41 16 15 21 17 40 37 36 37 35 57 53 31 24 37 40 33 38 38 25 37 40 37 33 9 53 45 45 24 35 24 34 19 24 36 53 12 40 34 18 15 19 29 41 26 21 40 39 30 45 29 32 13 11 44 32 32 29 30 30 28 19 47 10 14 30 17 18 30 25 30 23 16 44 31 48 25 16 47 13 44 29 18 16 30 29 31 17 31 14 48 26 18 30 29 25 16 29 47 38 29 23 7 30 13 40 46 28 35 33 20 30 34 29 26 12 16 25 28 34 26 33 24 14 31 38 18 20 10 37 19 25 43 28 27 22 41 26 28 18 27 23 18 41 9 7 10 27 46 27 22 13 24 23 27 15 20 29 14 10 23 6 19 30 46 36 32 34 14 19 36 18 26 6 31 20 21 21 6 8 6 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_33919359_33920548
seq2: B6Ng01-026C24.b_37_1210

seq1  GAATTCATCTTGAGCTACACAAGTGAGTTTAAGAGAGCCTGGGCTACTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCTTGAGCTACACAAGTGAGTTTAAGAGAGCCTGGGCTACTCT  50

seq1  GAGCCAGGTCTCCAAACAACAACAGCAACAACAAAACTGGTGGCACGCAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCAGGTCTCCAAACAACAACAGCAACAACAAAACTGGTGGCACGCAC  100

seq1  CTGTAAACCCATCACGCAGGACACAGGGGAATAGTACAAGCTACAAGCTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTAAACCCATCACGCAGGACACAGGGGAATAGTACAAGCTACAAGCTA  150

seq1  GCCTGCTCTACATAGTAAGTTACAGACCAGTCAACGCTGAAACAGCAAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGCTCTACATAGTAAGTTACAGACCAGTCAACGCTGAAACAGCAAGA  200

seq1  CCTTGTTTCAAAACAAAACAAAAACAATTCATAGTTATGCATACTTTAAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGTTTCAAAACAAAACAAAAACAATTCATAGTTATGCATACTTTAAC  250

seq1  TCCCAGCACTGCAGAGCAAGAAGCAATTGGAGGAAGCTCTGTGAGTTTGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGCACTGCAGAGCAAGAAGCAATTGGAGGAAGCTCTGTGAGTTTGA  300

seq1  GGTCAGCCTGGTCTACATAGTGAAGTTCCAGGCCATCCAGGAAGAAGACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCAGCCTGGTCTACATAGTGAAGTTCCAGGCCATCCAGGAAGAAGACC  350

seq1  TTGTCACAAAACAACAACAACAACAACTAAAAAAGCCAGGAGGAACTGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTCACAAAACAACAACAACAACAACTAAAAAAGCCAGGAGGAACTGGA  400

seq1  AATCTATCTTACCAGTTAAGAGCATTTACATCTTTTGCAGGGGATCTAAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTATCTTACCAGTTAAGAGCATTTACATCTTTTGCAGGGGATCTAAG  450

seq1  TCCAACAGCTCACAGTCACCTATAATTCCAGCTCCAGGAGCTATGGTGAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAACAGCTCACAGTCACCTATAATTCCAGCTCCAGGAGCTATGGTGAC  500

seq1  TTTGACCTCCTCAGGCACTCACACACATGCACACAATTTAAAACAGTCAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGACCTCCTCAGGCACTCACACACATGCACACAATTTAAAACAGTCAT  550

seq1  TTAAACATTTAAAAAGCAGGCTGGAGAGATGGTTCAGCAGTTAAGAGTAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAACATTTAAAAAGCAGGCTGGAGAGATGGTTCAGCAGTTAAGAGTAC  600

seq1  TGACTGCTCTTCCAAAGGTCCTGAGTTAATTCCCAGCAACCACATGGTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTGCTCTTCCAAAGGTCCTGAGTTAATTCCCAGCAACCACATGGTGG  650

seq1  CTTACAACCATCTGTAATAGGATCTGATACCCTCTTCCGGTGTGTCTGAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACAACCATCTGTAATAGGATCTGATACCCTCTTCCGGTGTGTCTGAA  700

seq1  GACAGCTACAATGTACTCATATAAATAAAATAAATACATCTTTTTTAAAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGCTACAATGTACTCATATAAATAAAATAAATACATCTTTTTTAAAA  750

seq1  AAAATTTAAAAAGCAAACAATCTAGAGAACATCAGCAAAGATTTCCCTTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTTAAAAAGCAAACAATCTAGAGAACATCAGCAAAGATTTCCCTTC  800

seq1  CACACCCATCCATTCATTCACTCATTCCATACAGCCTAGATCCTGTACTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACCCATCCATTCATTCACTCATTCCATACAGCCTAGATCCTGTACTG  850

seq1  AGTTTTTTAGTTTGTGTATAAATCCTACCTTTGAGCAGGGGAGAGGGACA  900
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  AGTTTTTTAGTTTGTGTATAAATCCTACCTTTGAGCACGGGAGAGGGACA  900

seq1  AGGCAGAGACAAAAGAGGACTGGGGTGGGGCAGACAGCTTTCCTTGTTTA  950
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGAGAC-AAAGAGGACTGGGGTGGGGCAGACAGCTTTCCTTGTTTA  949

seq1  TGCTGCCTGGTTAAGTTTTTATTCAACAAGTTTGCATTGGTGTTCCTTTT  1000
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  TGCTGCCTGGTTAAGTTTTTATTCAACAAGTTTGCATTGGTGTT-CTTTT  998

seq1  TCTGACAGTTCCCCTGAAGCCTGGCACAGAAAACCTGTCTGACAAGAAGA  1050
      |||||||||| |||||||| ||||||||||||||||||||||||||||||
seq2  TCTGACAGTT-CCCTGAAG-CTGGCACAGAAAACCTGTCTGACAAGAAGA  1046

seq1  CCCTTAGGGCAAATTGACTGAAAAACCCCCAAGTTGAGTCAGCAGGGCTG  1100
       |||||||   |||||||||||||| || ||||||||||||||| |||| 
seq2  ACCTTAGG--CAATTGACTGAAAAA-CCTCAAGTTGAGTCAGCAAGGCT-  1092

seq1  GGAGCCAGCAGCAAACCTCTGGAATCTGAAACTGCATGCCTCAAGGCTGA  1150
      |||| ||||||| ||||| ||| ||||||||||||||||||| |||||||
seq2  GGAG-CAGCAGC-AACCT-TGG-ATCTGAAACTGCATGCCTC-AGGCTGA  1137

seq1  CATGCAGGCCACTGCTTGTACACTTGACCAGCTGGGCCTT  1190
      |||||| |||||||||||||| |||||||| || ||||||
seq2  CATGCA-GCCACTGCTTGTAC-CTTGACCA-CTTGGCCTT  1174

seq1: chr17_34039599_34040155
seq2: B6Ng01-026C24.g_297_855 (reverse)

seq1  CCTCCGCCCTCCCGCCCCC-GCCTCCATCCTGTTTATCTCTGTGCAACAT  49
      ||||||||||||||||||| || |||||||||||||||||||||||||||
seq2  CCTCCGCCCTCCCGCCCCCGGCTTCCATCCTGTTTATCTCTGTGCAACAT  50

seq1  TATTATAACTGTGACTCAAGTTAACTTCTCTGTTTCTCCATTCTTGGCCT  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTATAACTGTGACTCAAGTTAACTTCTCTGTTTCTCCATTCTTGGCCT  100

seq1  -GGAACTCTCTATGTAGACCAGGCTGGCCTTGAATTCAAAGATCCACCTG  148
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAACTCTCTATGTAGACCAGGCTGGCCTTGAATTCAAAGATCCACCTG  150

seq1  CCTCTTTCTCCCTGGTAGTGCCCTTAATGGTGGGCTCCACTGTAGTGAGA  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTTTCTCCCTGGTAGTGCCCTTAATGGTGGGCTCCACTGTAGTGAGA  200

seq1  ATTCTTTTTTTTTTTTTTTTTTTTTTTTCCTTTTGGTTTTTCGAGACAGG  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCTTTTTTTTTTTTTTTTTTTTTTTTCCTTTTGGTTTTTCGAGACAGG  250

seq1  GTTTCTCTGTATAGCCCTGACTGTCCTGGAACTCACTTTGTGGAGCAGGG  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCTCTGTATAGCCCTGACTGTCCTGGAACTCACTTTGTGGAGCAGGG  300

seq1  TGGCCTTGAACTCAGAAATCCGCCTGCCTCTACTTCCCAAATGCTGGGAT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCTTGAACTCAGAAATCCGCCTGCCTCTACTTCCCAAATGCTGGGAT  350

seq1  TAAAGGCGTGCGCCACCGGCCACCGAGAATTCTGGAATTTTGGTTTCTTA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGGCGTGCGCCACCGGCCACCGAGAATTCTGGAATTTTGGTTTCTTA  400

seq1  AAAAAAAAAAAAAAAAAAACCCAGAAGTTATTATAAGAGTGTGACTTCAG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAAAAAAAAAAAAAACCCAGAAGTTATTATAAGAGTGTGACTTCAG  450

seq1  GGCTGGAGTGAACTGTGACCCAGCAGTTAAGAGCACTGGCTGCTCTTCCA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGGAGTGAACTGTGACCCAGCAGTTAAGAGCACTGGCTGCTCTTCCA  500

seq1  GAGGCCCTGGGTTCTATTCTCAGCACCCATATGGCAGCTCATAACTTCCT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCCCTGGGTTCTATTCTCAGCACCCATATGGCAGCTCATAACTTCCT  550

seq1  GTAACTCCA  557
      |||||||||
seq2  GTAACTCCA  559

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information