MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-177B02
Chromosome	17 (Build37)
Map Location	28,869,350 - 29,056,463
singlet/doublet	doublet
Overlap gene	Mapk14, Mapk13, Brpf3, Pnpla1, 4930539E08Rik
Upstream gene	LOC100042744, D17Wsu92e, EG666682, Snrpc, F830021D11Rik, Taf11, Anks1, Tcp11, 4930526A20Rik, Scube3, LOC100042764, Zfp523, Def6, Ppard, 1810013A23Rik, Fance, Rpl10a, Tead3, Tulp1, Fkbp5, 4930511I11Rik, Gm749, Clps, Tmhs, Srpk1, Slc26a8, LOC100043318
Downstream gene	Pxt1, Kctd20, Stk38, Sfrs3, LOC100042815, Cdkn1a, 9830134C10Rik, LOC100043341, Cpne5, Ppil1, BC004004, LOC100043348, Pi16, Mtch1, Fgd2, Pim1, 4933413N12Rik, Tbc1d22b, Rnf8, 1300018I05Rik, Mdga1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042744 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	D17Wsu92e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224647 MGI:106281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG666682 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666682 MGI:3644037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 164 ESTs, 3 Proteins pseudo : _no_value

name	Snrpc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20630 MGI:109489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F830021D11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224648 MGI:3041238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68776 MGI:1916026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anks1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224650 MGI:2446180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcp11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21463 MGI:98544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930526A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622485 MGI:3612449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 mRNAs, 158 ESTs, 3 Proteins

name	Scube3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268935 MGI:3045253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042764 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 1 Protein

name	Zfp523 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224656 MGI:2687278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Def6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23853 MGI:1346328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppard (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19015 MGI:101884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810013A23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69050 MGI:1916300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Fance (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72775 MGI:1920025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs, 1 Protein

name	Rpl10a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19896 MGI:1343877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tead3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21678 MGI:109241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tulp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22157 MGI:109571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14229 MGI:104670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930511I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67645 MGI:1914895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm749 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328788 MGI:2685595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109791 MGI:88421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmhs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328789 MGI:1915382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srpk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20815 MGI:106908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc26a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224661 MGI:2385046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26416 MGI:1346865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 147 ESTs, 2 Proteins

name	Mapk13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26415 MGI:1346864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brpf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268936 MGI:2146836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnpla1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433091 MGI:3617850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930539E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207819 MGI:1925441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pxt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69307 MGI:1916557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kctd20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66989 MGI:1914239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106504 MGI:2442572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20383 MGI:98285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042815 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Cdkn1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12575 MGI:104556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9830134C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442827 MGI:3045302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043341 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 255 ESTs, 3 Proteins

name	Cpne5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240058 MGI:2385908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68816 MGI:1916066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC004004 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80748 MGI:2136782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043348 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1103 ESTs, 9 Proteins

name	Pi16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74116 MGI:1921366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtch1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56462 MGI:1929261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26382 MGI:1347084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18712 MGI:97584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933413N12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71138 MGI:1918388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 2 Proteins

name	Tbc1d22b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381085 MGI:2681867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58230 MGI:1929069
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300018I05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74157 MGI:1921407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdga1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74762 MGI:1922012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042744 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268636 GeneID:100042744
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042744 transcript_id : XM_001478737.1

name	D17Wsu92e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461985 GeneID:224647 MGI:106281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 17, Wayne State University 92, expressed transcript_id : NM_001044719.1

name	D17Wsu92e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461983 GeneID:224647 MGI:106281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 17, Wayne State University 92, expressed transcript_id : NM_001033279.2

name	Snrpc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044893 GeneID:20630 MGI:109489
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U1 small nuclear ribonucleoprotein C transcript_id : NM_011432.2

name	F830021D11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107590 GeneID:224648 MGI:3041238
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F830021D11 gene transcript_id : NM_001080769.1

name	Taf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802483 GeneID:68776 MGI:1916026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_026836.2

name	Anks1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130667 GeneID:224650 MGI:2446180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SAM domain containing 1 transcript_id : NM_181413.3

name	Tcp11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475950 GeneID:21463 MGI:98544
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex protein 11 transcript_id : NM_013687.2

name	Scube3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52138545 GeneID:268935 MGI:3045253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal peptide, CUB domain, EGF-like 3 transcript_id : NM_001004366.1

name	LOC100042764 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268638 GeneID:100042764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 1 Protein product : similar to collagen, type VIII, alpha 2 transcript_id : XM_001478777.1

name	Zfp523 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372958 GeneID:224656 MGI:2687278
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 523 transcript_id : NM_172617.2

name	Def6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375804 GeneID:23853 MGI:1346328
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : differentially expressed in FDCP 6 transcript_id : NM_027185.2

name	Ppard (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89001112 GeneID:19015 MGI:101884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferator activator receptor delta transcript_id : NM_011145.3

name	1810013A23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268706 GeneID:69050 MGI:1916300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1810013A23 gene transcript_id : XM_001480179.1

name	Fance (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268640 GeneID:72775 MGI:1920025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs, 1 Protein product : Fanconi anemia, complementation group E transcript_id : XM_986338.2

name	Rpl10a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755349 GeneID:19896 MGI:1343877
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L10A transcript_id : NM_011287.1

name	Tead3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117414171 GeneID:21678 MGI:109241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TEA domain family member 3 transcript_id : NM_011566.2

name	Tulp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468972 GeneID:22157 MGI:109571
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubby like protein 1 transcript_id : NM_021478.1

name	Fkbp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560586 GeneID:14229 MGI:104670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 5 transcript_id : NM_010220.2

name	4930511I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802254 GeneID:67645 MGI:1914895
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930511I11 gene transcript_id : NM_026290.2

name	Gm749 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702210 GeneID:328788 MGI:2685595
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 749, (NCBI) transcript_id : NM_001034871.1

name	Clps (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371729 GeneID:109791 MGI:88421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colipase, pancreatic transcript_id : NM_025469.2

name	Tmhs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311920 GeneID:328789 MGI:1915382
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspan transmembrane protein, hair cell stereocilia transcript_id : NM_026571.1

name	Srpk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803405 GeneID:20815 MGI:106908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/arginine-rich protein specific kinase 1 transcript_id : NM_016795.3

name	Slc26a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122572 GeneID:224661 MGI:2385046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 26, member 8 transcript_id : NM_146076.1

name	Mapk14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367641 GeneID:26416 MGI:1346865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 14 transcript_id : NM_011951.2

name	LOC100043318 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268713 GeneID:100043318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 147 ESTs, 2 Proteins product : similar to G protein gamma-5 subunit transcript_id : XM_001480225.1

name	Mapk13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13994135 GeneID:26415 MGI:1346864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 13 transcript_id : NM_011950.1

name	Brpf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486782 GeneID:268936 MGI:2146836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain and PHD finger containing, 3 transcript_id : NM_001081315.1

name	Pnpla1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802640 GeneID:433091 MGI:3617850
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : patatin-like phospholipase domain containing 1 transcript_id : NM_001034885.2

name	4930539E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350764 GeneID:207819 MGI:1925441
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930539E08 gene transcript_id : NM_172450.2

name	Pxt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510246 GeneID:69307 MGI:1916557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal, testis specific 1 transcript_id : NM_153390.1

name	Kctd20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803135 GeneID:66989 MGI:1914239
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 20 transcript_id : NM_025888.4

name	Stk38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129944 GeneID:106504 MGI:2442572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 38 transcript_id : NM_134115.2

name	Sfrs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803005 GeneID:20383 MGI:98285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 3 (SRp20) transcript_id : NM_013663.4

name	LOC100042815 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268644 GeneID:100042815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100042815 transcript_id : XM_001478871.1

name	Cdkn1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368234 GeneID:12575 MGI:104556
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase inhibitor 1A (P21) transcript_id : NM_007669.3

name	9830134C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381743 GeneID:442827 MGI:3045302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9830134C10 gene transcript_id : NM_001002786.2

name	LOC100043341 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268717 GeneID:100043341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 255 ESTs, 3 Proteins product : similar to ribosomal protein L35a transcript_id : XM_001480264.1

name	Cpne5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346610 GeneID:240058 MGI:2385908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine V transcript_id : NM_153166.1

name	Ppil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361575 GeneID:68816 MGI:1916066
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase (cyclophilin)-like 1 transcript_id : NM_026845.2

name	BC004004 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254143 GeneID:80748 MGI:2136782
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC004004 transcript_id : NM_030561.2

name	LOC100043348 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268719 GeneID:100043348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1103 ESTs, 9 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001480280.1

name	Pi16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089319 GeneID:74116 MGI:1921366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidase inhibitor 16 transcript_id : NM_023734.3

name	Mtch1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130562 GeneID:56462 MGI:1929261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial carrier homolog 1 (C. elegans) transcript_id : NM_019880.3

name	Fgd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803019 GeneID:26382 MGI:1347084
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 2 transcript_id : NM_013710.3

name	Pim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254619 GeneID:18712 MGI:97584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proviral integration site 1 transcript_id : NM_008842.2

name	Tbc1d22b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348531 GeneID:381085 MGI:2681867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 22B transcript_id : NM_198647.1

name	Rnf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956111 GeneID:58230 MGI:1929069
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 8 transcript_id : NM_021419.1

name	1300018I05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802017 GeneID:74157 MGI:1921407
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300018I05 gene transcript_id : NM_028791.4

name	Mdga1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487208 GeneID:74762 MGI:1922012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAM domain containing glycosylphosphatidylinositol anchor 1 transcript_id : NM_001081160.1

name	LOC100042744 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268637 GeneID:100042744
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478787.1

name	D17Wsu92e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461986 GeneID:224647 MGI:106281
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC224647 isoform 2 protein_id : NP_001038184.1

name	D17Wsu92e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461984 CCDS:CCDS28569.1 GeneID:224647 MGI:106281
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC224647 isoform 1 protein_id : NP_001028451.2

name	Snrpc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755596 CCDS:CCDS28570.1 GeneID:20630 MGI:109489
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : U1 small nuclear ribonucleoprotein 1C protein_id : NP_035562.1

name	F830021D11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107591 GeneID:224648 MGI:3041238
definition	codon_start : 1 product : hypothetical protein LOC224648 protein_id : NP_001074238.1

name	Taf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794436 CCDS:CCDS28571.1 GeneID:68776 MGI:1916026
definition	GO_component : GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_081112.1

name	Anks1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088892 GeneID:224650 MGI:2446180
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Odin product : ankyrin repeat and sterile alpha motif domain containing 1 protein_id : NP_852078.1

name	Tcp11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305563 GeneID:21463 MGI:98544
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : t-complex protein 11 protein_id : NP_038715.1

name	Scube3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138546 GeneID:268935 MGI:3045253
definition	GO_component : GO:0048222 - glycoprotein network [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0051291 - protein heterooligomerization [Evidence ISS]; GO:0051260 - protein homooligomerization [Evidence ISS] codon_start : 1 product : signal peptide, CUB and EGF-like domain containing protein 3 protein_id : NP_001004366.1

name	LOC100042764 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268639 GeneID:100042764
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478827.1

name	Zfp523 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369882 CCDS:CCDS28573.1 GeneID:224656 MGI:2687278
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 523 protein_id : NP_766205.1

name	Def6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734752 CCDS:CCDS28574.1 GeneID:23853 MGI:1346328
definition	codon_start : 1 exception : mismatches in translation note : SWAP-70-like adapter of T-cells; IRF-4-binding protein product : differentially expressed in FDCP 6 protein_id : NP_081461.1

name	1810013A23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268707 GeneID:69050 MGI:1916300
definition	codon_start : 1 product : hypothetical protein LOC69050 protein_id : XP_001480229.1

name	Ppard (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859590 CCDS:CCDS28575.1 GeneID:19015 MGI:101884
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0008047 - enzyme activator activity [Evidence TAS]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence TAS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016501 - prostacyclin receptor activity [Evidence TAS]; GO:0046982 - protein heterodimerization activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0046965 - retinoid X receptor binding [Evidence TAS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042640 - anagen [Evidence IMP]; GO:0008366 - axon ensheathment [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IDA] [Evidence IMP]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0050875 - cellular physiological process [Evidence TAS]; GO:0007566 - embryo implantation [Evidence TAS]; GO:0008544 - epidermis development [Evidence TAS]; GO:0006635 - fatty acid beta-oxidation [Evidence IEP]; GO:0015908 - fatty acid transport [Evidence IEP]; GO:0006629 - lipid metabolism [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0014068 - positive regulation of phosphoinositide 3-kinase cascade [Evidence IDA]; GO:0050796 - regulation of insulin secretion [Evidence NAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : mPPAR(delta); PPARdelta/beta; Peroxisome proliferator-activated receptor beta product : peroxisome proliferator activator receptor delta protein_id : NP_035275.1

name	Fance (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401851 GeneID:72775 MGI:1920025
definition	codon_start : 1 product : Fanconi anemia, complementation group E protein_id : XP_991432.1

name	Rpl10a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755350 CCDS:CCDS28576.1 GeneID:19896 MGI:1343877
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ribospsmal protein L10A product : ribosomal protein L10A protein_id : NP_035417.1

name	Tead3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117414172 CCDS:CCDS28577.1 GeneID:21678 MGI:109241
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IGI] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IGI] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : TEA domain family member 3 isoform 1 protein_id : NP_035696.2

name	Tulp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468973 CCDS:CCDS28578.1 GeneID:22157 MGI:109571
definition	GO_function : GO:0008020 - G-protein coupled photoreceptor activity [Evidence IMP] GO_process : GO:0007602 - phototransduction [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : tubby like protein 1 like product : tubby like protein 1 protein_id : NP_067453.1

name	Fkbp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753884 GeneID:14229 MGI:104670
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : FK506 binding protein 5 (51 kDa) product : FK506 binding protein 5 protein_id : NP_034350.1

name	4930511I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385786 CCDS:CCDS28579.1 GeneID:67645 MGI:1914895
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67645 protein_id : NP_080566.1

name	Gm749 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702211 GeneID:328788 MGI:2685595
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008047 - enzyme activator activity [Evidence IEA] GO_process : GO:0007586 - digestion [Evidence IEA]; GO:0016042 - lipid catabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC328788 protein_id : NP_001030043.1

name	Clps (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384886 CCDS:CCDS28581.1 GeneID:109791 MGI:88421
definition	GO_process : GO:0007586 - digestion [Evidence IEA]; GO:0016042 - lipid catabolism [Evidence IEA] codon_start : 1 product : colipase, pancreatic protein_id : NP_079745.1

name	Tmhs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311921 GeneID:328789 MGI:1915382
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA] GO_process : GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy product : lipoma HMGIC fusion partner-like 5 protein_id : NP_080847.1

name	Srpk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982726 GeneID:20815 MGI:106908
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007059 - chromosome segregation [Evidence IEA] [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0050684 - regulation of mRNA processing [Evidence IDA] codon_start : 1 note : SR protein-specific kinase 1 product : serine/arginine-rich protein specific kinase 1 protein_id : NP_058075.2

name	Slc26a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122573 CCDS:CCDS28582.1 GeneID:224661 MGI:2385046
definition	GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 26, member 8 protein_id : NP_666188.1

name	Mapk14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10092590 CCDS:CCDS28583.1 GeneID:26416 MGI:1346865
definition	GO_component : GO:0005623 - cell [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA]; GO:0000922 - spindle pole [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0004708 - MAP kinase kinase activity [Evidence ISS]; GO:0008339 - MP kinase activity [Evidence ISS] [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0019735 - antimicrobial humoral response (sensu Vertebrata) [Evidence ISS]; GO:0006928 - cell motility [Evidence ISS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0006935 - chemotaxis [Evidence ISS]; GO:0000077 - DNA damage checkpoint [Evidence IMP]; GO:0019395 - fatty acid oxidation [Evidence IMP]; GO:0006006 - glucose metabolism [Evidence IMP]; GO:0045648 - positive regulation of erythrocyte differentiation [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence ISS] [Evidence IDA]; GO:0006950 - response to stress [Evidence ISS] [Evidence IDA]; GO:0007519 - striated muscle development [Evidence IMP] codon_start : 1 note : cytokine suppressive anti-inflammatory drug binding protein 1; p38 MAP Kinase; tRNA synthetase cofactor p38 product : mitogen activated protein kinase 14 protein_id : NP_036081.1

name	LOC100043318 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268714 GeneID:100043318
definition	codon_start : 1 product : similar to G protein gamma-5 subunit protein_id : XP_001480275.1

name	Mapk13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994136 CCDS:CCDS28584.1 GeneID:26415 MGI:1346864
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0008339 - MP kinase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0006445 - regulation of translation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : SAPK/Erk/kinase 4; p38 delta MAP kinase product : mitogen activated protein kinase 13 protein_id : NP_036080.1

name	Brpf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486783 GeneID:268936 MGI:2146836
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : bromodomain and PHD finger containing, 3 protein_id : NP_001074784.1

name	Pnpla1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702232 GeneID:433091 MGI:3617850
definition	GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 product : patatin-like phospholipase domain containing 1 protein_id : NP_001030057.1

name	4930539E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369611 CCDS:CCDS28586.1 GeneID:207819 MGI:1925441
definition	codon_start : 1 product : hypothetical protein LOC207819 protein_id : NP_766038.1

name	Pxt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510247 GeneID:69307 MGI:1916557
definition	codon_start : 1 product : small testis-specific peroxisomal protein protein_id : NP_700439.1

name	Kctd20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78486542 CCDS:CCDS28588.1 GeneID:66989 MGI:1914239
definition	GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005216 - ion channel activity [Evidence IEA] codon_start : 1 product : potassium channel tetramerisation domain containing 20 protein_id : NP_080164.2

name	Stk38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527344 CCDS:CCDS28589.1 GeneID:106504 MGI:2442572
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0004939 - beta-adrenergic receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS] [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 product : serine/threonine kinase 38 protein_id : NP_598876.1

name	Sfrs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567402 CCDS:CCDS28590.1 GeneID:20383 MGI:98285
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0006376 - mRNA splice site selection [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : splicing factor, arginine/serine-rich 3 (SRp20) protein_id : NP_038691.1

name	LOC100042815 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268645 GeneID:100042815
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478921.1

name	Cdkn1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671726 CCDS:CCDS28591.1 GeneID:12575 MGI:104556
definition	GO_component : GO:0000307 - cyclin-dependent protein kinase holoenzyme complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0030332 - cyclin binding [Evidence IPI]; GO:0004861 - cyclin-dependent protein kinase inhibitor activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004860 - protein kinase inhibitor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0045736 - negative regulation of cyclin-dependent protein kinase activity [Evidence IDA]; GO:0030890 - positive regulation of B cell proliferation [Evidence IGI]; GO:0043071 - positive regulation of non-apoptotic programmed cell death [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IMP]; GO:0009411 - response to UV [Evidence IMP] codon_start : 1 product : cyclin-dependent kinase inhibitor 1A (P21) protein_id : NP_031695.1

name	9830134C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50582589 GeneID:442827 MGI:3045302
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC442827 protein_id : NP_001002786.1

name	LOC100043341 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268718 GeneID:100043341
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480314.1

name	Cpne5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346611 CCDS:CCDS28592.1 GeneID:240058 MGI:2385908
definition	codon_start : 1 note : copine 5 product : copine V protein_id : NP_694806.1

name	Ppil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312784 CCDS:CCDS28593.1 GeneID:68816 MGI:1916066
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : peptidylprolyl isomerase-like 1 protein_id : NP_081121.1

name	BC004004 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254144 CCDS:CCDS28594.1 GeneID:80748 MGI:2136782
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GrailEXP prediction product : cDNA sequence BC004004 protein_id : NP_085038.2

name	LOC100043348 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268720 GeneID:100043348
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480330.1

name	Pi16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089320 CCDS:28595.1 GeneID:74116 MGI:1921366
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 note : cysteine-rich protease inhibitor product : protease inhibitor 16 protein_id : NP_076223.3

name	Mtch1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845273 CCDS:CCDS28596.1 GeneID:56462 MGI:1929261
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : mitochondrial carrier-like protein 1 product : mitochondrial carrier homolog 1 protein_id : NP_063933.1

name	Fgd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861174 GeneID:26382 MGI:1347084
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : faciogenital dysplasia homolog 2; Fgd1 family, member 2; Fgd2-like protein product : FYVE, RhoGEF and PH domain containing 2 protein_id : NP_038738.2

name	Pim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254620 GeneID:18712 MGI:97584
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IDA] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] [Evidence IEA] codon_start : 1 product : proviral integration site 1 protein_id : NP_032868.2

name	Tbc1d22b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348532 CCDS:CCDS28597.1 GeneID:381085 MGI:2681867
definition	codon_start : 1 product : TBC1 domain family, member 22B protein_id : NP_941049.1

name	Rnf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956112 GeneID:58230 MGI:1929069
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ActA binding protein 2 product : ring finger protein 8 protein_id : NP_067394.1

name	1300018I05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311939 GeneID:74157 MGI:1921407
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74157 protein_id : NP_083067.1

name	Mdga1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487209 GeneID:74762 MGI:1922012
definition	GO_component : GO:0045121 - lipid raft [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016163 - nitrogenase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0009399 - nitrogen fixation [Evidence IEA] codon_start : 1 product : MAM domain containing glycosylphosphatidylinositol anchor 1 protein_id : NP_001074629.1

name	EG666682 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94401830 GeneID:666682 MGI:3644037
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 164 ESTs, 3 Proteins product : predicted gene, EG666682 pseudo : _no_value transcript_id : XR_002050.1

name	4930526A20Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94401833 GeneID:622485 MGI:3612449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 mRNAs, 158 ESTs, 3 Proteins product : RIKEN cDNA 4930526A20 gene transcript_id : XR_001613.1

name	4933413N12Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94401861 GeneID:71138 MGI:1918388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : RIKEN cDNA 4933413N12 gene transcript_id : XR_001594.1

clone name	MSMg01-408N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-202M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011A02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-177B02.b	B6Ng01-177B02.g
ACC	GA004439	GA004440
length	804	845
definition	B6Ng01-177B02.b	B6Ng01-177B02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(29,055,667 - 29,056,463)	(28,869,350 - 28,870,192)
sequence	gaattctctctacttgtggatatactgtcgctattcattttcctgactgg atattccaaggtttggcaggttttgattattagaaattgtcctgacaata taatattctttttctttaatttttttttattcaccattgctcttttcaga cacaccagaagaaggtgtcagattctattacagatagttgtgagtcacca tgtggttgctgggaattgaactcaggacctctggaagagcagtcggtgct cttacccactgagccatctctccagccccatgacaacacattctttttgt tgttgtttgtttgtttctttgtttgtttgtttgtgtttttggagacaggg tttctctgtgtagccctggctgtcctggaactcactttgtagaccaggct ggcttgcaagtgttgcttgggcccctctggtggcactggtacccaggaat ggacctgctgaatgccagtgtcaggctatgccaggatcacgtttcagaga ccatgctgacatccttcctctcatcctaaacgtttccagctcaagagctc ccctctccctccccccatccctcctcaagcctacatttctccttataagc ctatatttttgtgctctctctctctctctctctgcctctactaccctctt gactcccctccccatgctcttaaataaactctgtgctatactataccttc gtgttggctggtccctcagggggaaggggatgccacagcatgggccagtt agaccccctccccccatgcttgggcctccgctcaagttctcgggatgagc gggc	gaattcagctgatagagattaatagcaaaagagggagcagggagccccag actgtctctccgggtggaacccttacttactttgattttgaaatgtgtgg ttagctaggtatggagtcactgatgccagcacgtcagcttcagctcaagg accgtaagctgtgtggccttttctttgctgtatccaatatagacaataca ttttcataccagagatcgcagacttgacttgttattttcctgtgtaatca agtataaatttccttcacgcataaaagacctttcccccattgtagtggat gtggtactcctaagacgtgacctatggtcaggagaggcaactcagcagtt aaagagcatagctgctcttccagtctccaggctggtgttcagattctagc acctgcaagatagttcatctgtaactccagtctcggggacccagtgtctt cttttggtctctgtgggcaccaggcacgcacatagtacagataagcacac aggcaaaacgctcgtacacataaaaataaatgattttttacagatgtgaa cagagggtggagggctttctggattacactgctgctgctgcactgatctg cgtactgtcctgggtatattagaacagtctcagagcagttcgtccttctt caaacatgctacggaacatcacagatagacagtaccgtgctcttagtgaa ccctgtgtctgctcttgcccaggagggttagtaaaatggtgggtggtgaa gctaacgcactggagtgcactagcatatctagctacccattgctctctca ttgttaagtttcccggctttcctcattttagttttctttccttaa
quality values	Open. Hide. 15 17 32 28 58 62 49 62 62 62 47 56 62 62 62 62 56 62 37 39 24 56 56 62 62 62 62 62 62 62 62 43 34 24 18 28 8 23 34 45 45 28 27 28 32 27 30 59 62 62 59 62 62 59 62 62 59 46 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 43 39 28 18 32 28 40 51 48 49 43 43 56 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 59 62 62 62 56 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 59 51 62 62 62 62 59 59 59 56 62 62 62 54 51 56 56 62 62 62 56 62 62 62 62 56 62 62 62 62 51 50 50 38 51 51 62 62 62 62 62 62 47 47 54 62 62 62 62 62 62 62 62 56 56 56 46 40 56 47 56 45 39 38 56 62 62 54 62 62 47 47 62 62 62 62 62 62 62 62 62 62 52 54 52 46 43 62 52 52 52 52 62 62 62 62 62 62 62 62 39 52 62 38 52 52 52 54 39 54 54 54 54 54 37 58 17 39 41 58 45 42 54 54 45 54 58 47 41 54 54 52 54 54 54 58 54 54 52 45 47 51 49 54 39 43 54 54 52 54 54 54 58 58 41 50 50 51 51 46 48 44 50 58 37 53 58 52 51 49 49 41 42 42 38 15 9 40 40 50 41 42 26 44 35 58 52 52 49 41 46 49 58 37 47 37 46 39 50 29 37 40 39 54 52 49 44 49 49 51 41 34 41 35 15 43 26 50 40 27 58 33 51 50 51 51 51 34 58 27 58 36 41 53 53 51 47 53 37 53 39 54 49 54 41 51 51 51 51 53 42 47 32 51 35 33 21 34 37 35 45 36 53 49 38 40 27 30 51 19 19 53 42 51 44 40 40 21 54 54 34 26 25 45 27 22 41 27 53 9 54 23 33 34 54 34 21 31 26 30 53 32 42 31 29 32 32 28 28 39 32 32 15 6 40 31 35 51 12 22 11 7 14 12 33 16 29 34 35 21 25 53 33 35 28 9 6 33 32 30 23 31 31 6 13 37 8 19 21 25 30 30 9 12 6 14 29 21 28 34 28 26 11 18 13 6 6 6 17 9 43 10 24 24 28 33 7 43 30 43 31 42 16 11 9 31 11 9 6 22 33 20 6 6 25 11 14 9 12 29 12 9 18 10 7 31 14 9 18 14 31 17 14 13 7 27 7 24 31 31 13 9	Open. Hide. 62 59 51 44 62 59 43 46 62 62 62 59 59 15 15 23 13 18 28 40 28 28 28 27 23 35 30 50 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 46 51 56 46 38 32 40 54 54 54 59 54 49 49 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 56 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 59 59 62 59 62 59 59 49 62 59 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 56 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 51 56 62 56 62 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 54 62 56 62 62 62 62 62 62 62 62 56 56 56 50 62 62 62 62 54 41 56 62 56 62 62 62 62 47 47 62 56 47 33 62 56 62 62 56 56 62 62 62 62 38 46 46 52 52 46 62 47 48 62 62 62 62 54 62 62 62 47 39 62 54 43 52 62 62 46 58 41 58 58 49 58 58 48 58 54 46 54 54 46 54 58 52 52 58 58 50 46 42 41 52 39 54 52 49 54 37 46 35 47 40 50 52 42 39 49 50 46 34 58 47 52 27 12 17 7 19 18 52 50 35 58 47 36 58 58 46 31 50 49 58 52 53 42 32 49 40 47 47 58 53 58 58 58 41 40 15 58 49 50 50 50 31 58 58 58 58 34 33 46 34 50 39 31 54 49 50 35 28 49 50 50 51 18 58 41 32 58 50 51 21 38 31 31 33 49 7 21 31 54 18 35 29 32 26 35 29 52 38 58 26 50 54 49 39 45 42 42 49 26 16 33 39 45 45 42 39 29 49 42 29 18 34 34 32 51 26 34 39 36 54 54 54 25 39 37 37 45 41 53 21 33 25 28 13 26 31 33 42 34 32 15 54 21 40 42 17 22 33 40 29 24 40 39 41 35 35 20 36 31 32 47 27 33 12 31 40 31 31 31 29 46 26 32 32 27 25 20 18 23 33 26 25 42 27 31 22 31 36 31 37 25 16 18 46 21 25 37 27 36 13 7 7 10 6 17 26 27 30 10 48 31 29 31 22 31 29 31 24 31 31 30 12 6 11 14 16 30 30 6 7 7 13 13 46 20 9 5 17 11 10 13 31 23 31 24 27 6 8 29 27 18 7 23 25 7 8 8 27 7 24 7 37 29 24 9 8 6 16 31 32 19 10 9 26 9 5 18 9 8 9 17 9 6 6 9 8 21 31 11 8 24 32 11 28 36 13 18 8 21 24 11 9 6 7 7 8 35 18 11 18 24 18 13 15 21 10 32 31 31 9 31 14 18 15 4 11 36 24 19 16 19 10 7 23 37 40 20 16 21 34 28 6 18 15 15 10 18 10 29 10 26 12 28

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_29055667_29056463
seq2: B6Ng01-177B02.b_46_849 (reverse)

seq1  GCCCGCTCATCCCG-GGACTTGAGCGGAGGCCC-AGCATGGGGGG-GGGG  47
      |||||||||||||| | |||||||||||||||| ||||||||||| ||||
seq2  GCCCGCTCATCCCGAGAACTTGAGCGGAGGCCCAAGCATGGGGGGAGGGG  50

seq1  GTCTTACTGGCCCATGCTGTGGCAT-CCCTTCCCCCTGAGGGACCAGCC-  95
      |||| |||||||||||||||||||| ||||||||||||||||||||||| 
seq2  GTCTAACTGGCCCATGCTGTGGCATCCCCTTCCCCCTGAGGGACCAGCCA  100

seq1  ACACGAAGGTATAGTATAGCACAGAGTTTA-TTAAGAGCATGGGGAGGGG  144
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  ACACGAAGGTATAGTATAGCACAGAGTTTATTTAAGAGCATGGGGAGGGG  150

seq1  AGTCAAGAGGGTAGTAGAGGCAGAGAGAGAGAGAGAGAGAGCAC-AAAAT  193
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  AGTCAAGAGGGTAGTAGAGGCAGAGAGAGAGAGAGAGAGAGCACAAAAAT  200

seq1  ATAGGCTTATAAGGAGAAATGTAGGCTTGAGGAGGGATGGGGGGAGGGAG  243
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGGCTTATAAGGAGAAATGTAGGCTTGAGGAGGGATGGGGGGAGGGAG  250

seq1  AGGGGAGCTCTTGAGCTGGAAACGTTTAGGATGAGAGGAAGGATGTCAGC  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGAGCTCTTGAGCTGGAAACGTTTAGGATGAGAGGAAGGATGTCAGC  300

seq1  ATGGTCTCTGAAACGTGATCCTGGCATAGCCTGACACTGGCATTCAGCAG  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTCTCTGAAACGTGATCCTGGCATAGCCTGACACTGGCATTCAGCAG  350

seq1  GTCCATTCCTGGGTACCAGTGCCACCAGAGGGGCCCAAGCAACACTTGCA  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCATTCCTGGGTACCAGTGCCACCAGAGGGGCCCAAGCAACACTTGCA  400

seq1  AGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGA  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGA  450

seq1  GAAACCCTGTCTCCAAAAACACAAACAAACAAACAAAGAAACAAACAAAC  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACCCTGTCTCCAAAAACACAAACAAACAAACAAAGAAACAAACAAAC  500

seq1  AACAACAAAAAGAATGTGTTGTCATGGGGCTGGAGAGATGGCTCAGTGGG  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAACAAAAAGAATGTGTTGTCATGGGGCTGGAGAGATGGCTCAGTGGG  550

seq1  TAAGAGCACCGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAAC  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAGCACCGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAAC  600

seq1  CACATGGTGACTCACAACTATCTGTAATAGAATCTGACACCTTCTTCTGG  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATGGTGACTCACAACTATCTGTAATAGAATCTGACACCTTCTTCTGG  650

seq1  TGTGTCTGAAAAGAGCAATGGTGAATAAAAAAAAATTAAAGAAAAAGAAT  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTCTGAAAAGAGCAATGGTGAATAAAAAAAAATTAAAGAAAAAGAAT  700

seq1  ATTATATTGTCAGGACAATTTCTAATAATCAAAACCTGCCAAACCTTGGA  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATATTGTCAGGACAATTTCTAATAATCAAAACCTGCCAAACCTTGGA  750

seq1  ATATCCAGTCAGGAAAATGAATAGCGACAGTATATCCACAAGTAGAGAGA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCCAGTCAGGAAAATGAATAGCGACAGTATATCCACAAGTAGAGAGA  800

seq1  ATTC  797
      ||||
seq2  ATTC  804

seq1: chr17_28869350_28870192
seq2: B6Ng01-177B02.g_69_913

seq1  GAATTCAGCTGATAGAGATTAATAGCAAAAGAGGGAGCAGGGAGCCCCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGCTGATAGAGATTAATAGCAAAAGAGGGAGCAGGGAGCCCCAG  50

seq1  ACTGTCTCTCCGGGTGGAACCCTTACTTACTTTGATTTTGAAATGTGTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTCTCTCCGGGTGGAACCCTTACTTACTTTGATTTTGAAATGTGTGG  100

seq1  TTAGCTAGGTATGGAGTCACTGATGCCAGCACGTCAGCTTCAGCTCAAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCTAGGTATGGAGTCACTGATGCCAGCACGTCAGCTTCAGCTCAAGG  150

seq1  ACCGTAAGCTGTGTGGCCTTTTCTTTGCTGTATCCAATATAGACAATACA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCGTAAGCTGTGTGGCCTTTTCTTTGCTGTATCCAATATAGACAATACA  200

seq1  TTTTCATACCAGAGATCGCAGACTTGACTTGTTATTTTCCTGTGTAATCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCATACCAGAGATCGCAGACTTGACTTGTTATTTTCCTGTGTAATCA  250

seq1  AGTATAAATTTCCTTCACGCATAAAAGACCTTTCCCCCATTGTAGTGGAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATAAATTTCCTTCACGCATAAAAGACCTTTCCCCCATTGTAGTGGAT  300

seq1  GTGGTACTCCTAAGACGTGACCTATGGTCAGGAGAGGCAACTCAGCAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTACTCCTAAGACGTGACCTATGGTCAGGAGAGGCAACTCAGCAGTT  350

seq1  AAAGAGCATAGCTGCTCTTCCAGTCTCCAGGCTGGTGTTCAGATTCTAGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAGCATAGCTGCTCTTCCAGTCTCCAGGCTGGTGTTCAGATTCTAGC  400

seq1  ACCTGCAAGATAGTTCATCTGTAACTCCAGTCTCGGGGACCCAGTGTCTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGCAAGATAGTTCATCTGTAACTCCAGTCTCGGGGACCCAGTGTCTT  450

seq1  CTTTTGGTCTCTGTGGGCACCAGGCACGCACATAGTACAGATAAGCACAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTGGTCTCTGTGGGCACCAGGCACGCACATAGTACAGATAAGCACAC  500

seq1  AGGCAAAACGCTCGTACACATAAAAATAAATGATTTTTTACAGATGTGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAAAACGCTCGTACACATAAAAATAAATGATTTTTTACAGATGTGAA  550

seq1  CAGAGGGTGGAGGGC-TTCTGGATTACACTGCTGCTGCTGCACTGATCTG  599
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  CAGAGGGTGGAGGGCTTTCTGGATTACACTGCTGCTGCTGCACTGATCTG  600

seq1  CGTACTGTCCTGGGTATATTAGAACAGTCTCAGAGCAGTTCGTCCTTCTT  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTACTGTCCTGGGTATATTAGAACAGTCTCAGAGCAGTTCGTCCTTCTT  650

seq1  CAAACATGCTACGGAACATCACAGATAGACAGTACCGTGCTC-TAGTGAA  698
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  CAAACATGCTACGGAACATCACAGATAGACAGTACCGTGCTCTTAGTGAA  700

seq1  CCCTGTGTCTGCTC-TGCCCA-GAGGGTGAAGTAAAAT-GTGGGTGGTTG  745
      |||||||||||||| |||||| ||||||  |||||||| |||||||||  
seq2  CCCTGTGTCTGCTCTTGCCCAGGAGGGT-TAGTAAAATGGTGGGTGGTGA  749

seq1  AGCAAACGCACTGGAGTGCAC-AGCATATCTAGCTACCCATTGCTCTC-C  793
      ||| ||||||||||||||||| |||||||||||||||||||||||||| |
seq2  AGCTAACGCACTGGAGTGCACTAGCATATCTAGCTACCCATTGCTCTCTC  799

seq1  ATTGTTAAGTTTCCGGTCTTTTCCTCATTTTTAGTTTTTTCTTTCCTTAA  843
      |||||||||||||| | | |||||||| ||||||  ||||||||||||||
seq2  ATTGTTAAGTTTCCCGGC-TTTCCTCA-TTTTAG--TTTTCTTTCCTTAA  845

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information