MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-214D20
Chromosome	17 (Build37)
Map Location	24,793,300 - 24,808,747
singlet/doublet	doublet
Overlap gene	Npw, Zfp598
Upstream gene	BC038613, Thoc6, Hcfc1r1, Tnfrsf12a, Cldn6, Cldn9, EG666080, 1520401A03Rik, Pkmyt1, Paqr4, Kremen2, 9530082P21Rik, Flywch1, 2810417J12Rik, LOC100042865, Srrm2, Tceb2, Prss33, 4931440B09Rik, Prss32, Prss21, Dcpp1, LOC666157, Dcpp2, LOC620233, Dcpp3, Sbp, Sbpl, Tmprss8, Prss22, LOC100042414, LOC383225, Prss27, Kctd5, Pdpk1, Amdhd2, Atp6v0c, Tbc1d24, Ntn2l, 1600002H07Rik, Ccnf, Abca17, Abca3, Rnps1, Dci, Dnase1l2, E4f1, 1700012G19Rik, Gbl, 9930021D14Rik, LOC666299, Caskin1, Traf7, Rab26, Pkd1, Tsc2, Nthl1, Slc9a3r2
Downstream gene	Syngr3, Gfer, Noxo1, Tbl3, Rnf151, Rps2, Snora64, Ndufb10, Rpl3l, Sepx1, Hs3st6, 4930528F23Rik, Fahd1, Hagh, Igfals, Nubp2, Spsb3, Mrps34, Nme3, Mapk8ip3, Hn1l, Cramp1l, Ift140, BC054438, Telo2, 1110018H23Rik, Clcn7, Gm317, BC003965, Unkl, Gnptg, 0610007P22Rik, Ube2i, Prss34, Prss28, Prss29, LOC432543, LOC666472, Tpsab1, Mcpt6, Tpsg1, Cacna1h, Tekt4, Sstr5, LOC100042580, Sox8, Tmem112
Link	Open Mouse BAC browser

Click to get alignment info.

name	BC038613 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212733 MGI:2388267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thoc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386612 MGI:2677480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcfc1r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353502 MGI:2663619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf12a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27279 MGI:1351484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54419 MGI:1859284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56863 MGI:1913100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666080 MGI:3649130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	1520401A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320309 MGI:2443785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkmyt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268930 MGI:2137630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paqr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76498 MGI:1923748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kremen2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73016 MGI:1920266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9530082P21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638247 MGI:3603340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs

name	Flywch1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224613 MGI:2442638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810417J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76917 MGI:1924167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	Srrm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75956 MGI:1923206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tceb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67673 MGI:1914923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353130 MGI:2661234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931440B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71003 MGI:1918253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69814 MGI:1917064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57256 MGI:1916698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcpp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13184 MGI:105949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666157 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666157
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Dcpp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630537 MGI:3644062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 5 Proteins pseudo : _no_value

name	Dcpp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620253 MGI:3646420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20234 MGI:106021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sbpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638345 MGI:3694550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30943 MGI:1353645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70835 MGI:1918085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042414 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC383225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Prss27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213171 MGI:2450123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kctd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69259 MGI:1916509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdpk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18607 MGI:1338068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Amdhd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245847 MGI:2443978
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11984 MGI:88116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224617 MGI:2443456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ntn2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18209 MGI:1341188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1600002H07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72016 MGI:1919266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12449 MGI:102551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381072 MGI:3625331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27410 MGI:1351617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rnps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19826 MGI:97960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Dci (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13177 MGI:94871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnase1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66705 MGI:1913955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E4f1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13560 MGI:109530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700012G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67078 MGI:1914328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56716 MGI:1929514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9930021D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319259 MGI:2441766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Caskin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268932 MGI:2442952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224619 MGI:3042141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328778 MGI:2443284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 52 ESTs, 10 Proteins

name	Pkd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18763 MGI:97603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22084 MGI:102548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nthl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18207 MGI:1313275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc9a3r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65962 MGI:1890662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Npw (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381073 MGI:2685781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Zfp598 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213753 MGI:2670965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syngr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20974 MGI:1341881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfer (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11692 MGI:107757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Noxo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71893 MGI:1919143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213773 MGI:2384863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf151 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67504 MGI:1914754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16898 MGI:105110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Snora64 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104366 MGI:2148175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68342 MGI:1915592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66211 MGI:1913461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sepx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27361 MGI:1351642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hs3st6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328779 MGI:3580487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930528F23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75178 MGI:1922428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 2 Proteins

name	Fahd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68636 MGI:1915886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hagh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14651 MGI:95745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfals (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16005 MGI:107973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nubp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26426 MGI:1347072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spsb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79043 MGI:1891471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79044 MGI:1930188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nme3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79059 MGI:1930182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk8ip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30957 MGI:1353598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hn1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52009 MGI:1196260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cramp1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57354 MGI:1930190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 164 ESTs, 2 Proteins

name	Ift140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106633 MGI:2146906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC054438 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407831 MGI:3039635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Telo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71718 MGI:1918968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110018H23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68509 MGI:1915759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 12 ESTs, 6 Proteins

name	Clcn7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26373 MGI:1347048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm317 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207209 MGI:2685163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	BC003965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214489 MGI:2670966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 104 ESTs

name	Unkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74154 MGI:1921404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnptg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214505 MGI:2147006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610007P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68327 MGI:1915577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2i (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22196 MGI:107365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328780 MGI:2681414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114661 MGI:2149951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114662 MGI:2149952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 ESTs, 24 Proteins pseudo : _no_value

name	LOC666472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Tpsab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17230 MGI:96943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17229 MGI:96942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpsg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26945 MGI:1349391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna1h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58226 MGI:1928842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tekt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71840 MGI:1919090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sstr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20609 MGI:894282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Sox8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20681 MGI:98370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76483 MGI:1923733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC038613 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802304 GeneID:212733 MGI:2388267
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC038613 transcript_id : NM_153784.2

name	Thoc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56605679 GeneID:386612 MGI:2677480
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THO complex 6 homolog (Drosophila) transcript_id : NM_001008425.1

name	Hcfc1r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32451499 GeneID:353502 MGI:2663619
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : host cell factor C1 regulator 1 (XPO1-dependent) transcript_id : NM_181821.1

name	Tnfrsf12a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305058 GeneID:27279 MGI:1351484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 12a transcript_id : NM_013749.1

name	Cldn6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382484 GeneID:54419 MGI:1859284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 6 transcript_id : NM_018777.3

name	Cldn9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098101 GeneID:56863 MGI:1913100
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 9 transcript_id : NM_020293.2

name	EG666080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401762 GeneID:666080 MGI:3649130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : predicted gene, EG666080 transcript_id : XM_981456.1

name	1520401A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359763 GeneID:320309 MGI:2443785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1520401A03 gene transcript_id : NM_177132.3

name	Pkmyt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389041 GeneID:268930 MGI:2137630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, membrane associated tyrosine/threonine 1 transcript_id : NM_023058.3

name	Paqr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130648 GeneID:76498 MGI:1923748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progestin and adipoQ receptor family member IV transcript_id : NM_023824.3

name	Kremen2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703353 GeneID:73016 MGI:1920266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kringle containing transmembrane protein 2 transcript_id : NM_028416.1

name	9530082P21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401764 GeneID:638247 MGI:3603340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs product : RIKEN cDNA 9530082P21 gene transcript_id : XM_895607.1

name	Flywch1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418894 GeneID:224613 MGI:2442638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FLYWCH-type zinc finger 1 transcript_id : NM_153791.1

name	2810417J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372204 GeneID:76917 MGI:1924167
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810417J12 gene transcript_id : NM_029798.2

name	LOC100042865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268646 GeneID:100042865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : similar to SPAC23A1.17 transcript_id : XM_001478950.1

name	Srrm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157503 GeneID:75956 MGI:1923206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/arginine repetitive matrix 2 transcript_id : NM_175229.3

name	Tceb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368491 GeneID:67673 MGI:1914923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor B (SIII), polypeptide 2 transcript_id : NM_026305.2

name	Prss33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487128 GeneID:353130 MGI:2661234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 33 transcript_id : NM_001081399.1

name	4931440B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037228 GeneID:71003 MGI:1918253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931440B09 gene transcript_id : NM_027644.1

name	Prss32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037178 GeneID:69814 MGI:1917064
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 32 transcript_id : NM_027220.1

name	Prss21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349958 GeneID:57256 MGI:1916698
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 21 transcript_id : NM_020487.3

name	Dcpp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815810 GeneID:13184 MGI:105949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : demilune cell and parotid protein 1 transcript_id : NM_019910.2

name	Dcpp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647233 GeneID:630537 MGI:3644062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : demilune cell and parotid protein 2 transcript_id : NM_001039238.2

name	Dcpp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647231 GeneID:620253 MGI:3646420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : demilune cell and parotid protein 3 transcript_id : NM_001077633.1

name	Sbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116812645 GeneID:20234 MGI:106021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermine binding protein transcript_id : NM_011321.3

name	Sbpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116812641 GeneID:638345 MGI:3694550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermine binding protein-like transcript_id : NM_001077421.1

name	Tmprss8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24496767 GeneID:30943 MGI:1353645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 8 (intestinal) transcript_id : NM_013921.2

name	Prss22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526923 GeneID:70835 MGI:1918085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 22 transcript_id : NM_133731.1

name	LOC100042414 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268599 GeneID:100042414
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to ribosomal protein L32 transcript_id : XM_001478147.1

name	Prss27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359500 GeneID:213171 MGI:2450123
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine 27 transcript_id : NM_175440.3

name	Kctd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794419 GeneID:69259 MGI:1916509
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 5 transcript_id : NM_027008.1

name	Pdpk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107597 GeneID:18607 MGI:1338068
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-phosphoinositide dependent protein kinase-1 transcript_id : NM_001080773.1

name	Pdpk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124107593 GeneID:18607 MGI:1338068
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 3-phosphoinositide dependent protein kinase-1 transcript_id : NM_011062.2

name	Amdhd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802353 GeneID:245847 MGI:2443978
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amidohydrolase domain containing 2 transcript_id : NM_172935.3

name	Atp6v0c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802839 GeneID:11984 MGI:88116
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit C transcript_id : NM_009729.2

name	Tbc1d24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802039 GeneID:224617 MGI:2443456
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 24 transcript_id : NM_173186.3

name	Ntn2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62990172 GeneID:18209 MGI:1341188
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : netrin 2-like (chicken) transcript_id : NM_010947.3

name	1600002H07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037282 GeneID:72016 MGI:1919266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600002H07 gene transcript_id : NM_028056.1

name	Ccnf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365465 GeneID:12449 MGI:102551
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin F transcript_id : NM_007634.3

name	Abca17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83716005 GeneID:381072 MGI:3625331
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 17 transcript_id : NM_001031621.1

name	Abca3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759349 GeneID:27410 MGI:1351617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 3 transcript_id : NM_013855.2

name	Abca3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853070 GeneID:27410 MGI:1351617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 3 transcript_id : NM_001039581.1

name	Rnps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674792 GeneID:19826 MGI:97960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleic acid binding protein S1 transcript_id : NM_009070.2

name	Rnps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674789 GeneID:19826 MGI:97960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleic acid binding protein S1 transcript_id : NM_001080127.1

name	Rnps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121674798 GeneID:19826 MGI:97960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleic acid binding protein S1 transcript_id : NM_001080128.1

name	Dci (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379490 GeneID:13177 MGI:94871
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenyme A isomerase) transcript_id : NM_010023.3

name	Dnase1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803156 GeneID:66705 MGI:1913955
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyribonuclease 1-like 2 transcript_id : NM_025718.2

name	E4f1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922712 GeneID:13560 MGI:109530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E4F transcription factor 1 transcript_id : NM_007893.3

name	1700012G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129884 GeneID:67078 MGI:1914328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700012G19 gene transcript_id : NM_025954.3

name	Gbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367623 GeneID:56716 MGI:1929514
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein beta subunit-like transcript_id : NM_019988.3

name	9930021D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381781 GeneID:319259 MGI:2441766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9930021D14 gene transcript_id : NM_175682.3

name	LOC666299 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268603 GeneID:666299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC666299 transcript_id : XM_982880.2

name	Caskin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592862 GeneID:268932 MGI:2442952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CASK interacting protein 1 transcript_id : NM_027937.1

name	Traf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418904 GeneID:224619 MGI:3042141
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor-associated factor 7 transcript_id : NM_153792.1

name	Rab26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268664 GeneID:328778 MGI:2443284
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 52 ESTs, 10 Proteins product : RAB26, member RAS oncogene family, transcript variant 1 transcript_id : XM_283428.6

name	Pkd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487379 GeneID:18763 MGI:97603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease 1 homolog transcript_id : NM_013630.2

name	Tsc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439991 GeneID:22084 MGI:102548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuberous sclerosis 2 transcript_id : NM_001039363.1

name	Tsc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439986 GeneID:22084 MGI:102548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuberous sclerosis 2 transcript_id : NM_011647.2

name	Nthl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679145 GeneID:18207 MGI:1313275
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nth (endonuclease III)-like 1 (E.coli) transcript_id : NM_008743.1

name	Slc9a3r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12746431 GeneID:65962 MGI:1890662
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2 transcript_id : NM_023055.1

name	Slc9a3r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357121 GeneID:65962 MGI:1890662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2 transcript_id : NM_023449.2

name	Npw (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268608 GeneID:381073 MGI:2685781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : neuropeptide W transcript_id : XM_001478349.1

name	Zfp598 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147168 GeneID:213753 MGI:2670965
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 598 transcript_id : NM_183149.1

name	Syngr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370504 GeneID:20974 MGI:1341881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptogyrin 3 transcript_id : NM_011522.3

name	Gfer (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403593 GeneID:11692 MGI:107757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration) transcript_id : NM_023040.3

name	Noxo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363839 GeneID:71893 MGI:1919143
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADPH oxidase organizer 1 transcript_id : NM_027988.2

name	Tbl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802154 GeneID:213773 MGI:2384863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin (beta)-like 3 transcript_id : NM_145396.4

name	Rnf151 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129829 GeneID:67504 MGI:1914754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 151 transcript_id : NM_026205.3

name	Rps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802378 GeneID:16898 MGI:105110
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S2 transcript_id : NM_008503.3

name	Ndufb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367767 GeneID:68342 MGI:1915592
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 transcript_id : NM_026684.2

name	Rpl3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802699 GeneID:66211 MGI:1913461
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L3-like transcript_id : NM_025425.2

name	Sepx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110832840 GeneID:27361 MGI:1351642
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenoprotein X 1 transcript_id : NM_013759.2

name	Hs3st6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60223080 GeneID:328779 MGI:3580487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate (glucosamine) 3-O-sulfotransferase 6 transcript_id : NM_001012402.1

name	4930528F23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268668 GeneID:75178 MGI:1922428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 2 Proteins product : RIKEN cDNA 4930528F23 gene transcript_id : XM_128478.6

name	Fahd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115311548 GeneID:68636 MGI:1915886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fumarylacetoacetate hydrolase domain containing 1 transcript_id : NM_023480.2

name	Hagh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21729785 GeneID:14651 MGI:95745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxyacyl glutathione hydrolase transcript_id : NM_024284.1

name	Igfals (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388344 GeneID:16005 MGI:107973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein, acid labile subunit transcript_id : NM_008340.3

name	Nubp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981334 GeneID:26426 MGI:1347072
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleotide binding protein 2 transcript_id : NM_011956.2

name	Spsb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252773 GeneID:79043 MGI:1891471
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splA/ryanodine receptor domain and SOCS box containing 3 transcript_id : NM_027141.1

name	Mrps34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385669 GeneID:79044 MGI:1930188
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S34 transcript_id : NM_023260.1

name	Nme3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790120 GeneID:79059 MGI:1930182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 3 transcript_id : NM_019730.1

name	Mapk8ip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353174 GeneID:30957 MGI:1353598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase 8 interacting protein 3 transcript_id : NM_013931.2

name	Hn1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130913 GeneID:52009 MGI:1196260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematological and neurological expressed 1-like transcript_id : NM_198937.2

name	Cramp1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401770 GeneID:57354 MGI:1930190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 161 ESTs, 2 Proteins product : Crm, cramped-like (Drosophila), transcript variant 1 transcript_id : XM_484614.4

name	Cramp1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401766 GeneID:57354 MGI:1930190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 160 ESTs, 2 Proteins product : Crm, cramped-like (Drosophila), transcript variant 5 transcript_id : XM_983827.1

name	Ift140 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993725 GeneID:106633 MGI:2146906
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intraflagellar transport 140 homolog (Chlamydomonas) transcript_id : NM_134126.2

name	BC054438 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47564089 GeneID:407831 MGI:3039635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC054438 transcript_id : NM_001001183.1

name	Telo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311991 GeneID:71718 MGI:1918968
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TEL2, telomere maintenance 2, homolog (S. cerevisiae) transcript_id : NM_027880.1

name	1110018H23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268669 GeneID:68509 MGI:1915759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins product : RIKEN cDNA 1110018H23 gene transcript_id : XM_128459.6

name	Clcn7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802324 GeneID:26373 MGI:1347048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 7 transcript_id : NM_011930.3

name	Gm317 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268610 GeneID:207209 MGI:2685163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : gene model 317, (NCBI) transcript_id : XM_139904.7

name	BC003965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401787 GeneID:214489 MGI:2670966
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 104 ESTs product : cDNA sequence BC003965 transcript_id : XM_128528.5

name	Unkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377990 GeneID:74154 MGI:1921404
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unkempt-like (Drosophila) transcript_id : NM_028789.2

name	Gnptg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892310 GeneID:214505 MGI:2147006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylglucosamine-1-phosphotransferase, gamma subunit transcript_id : NM_172529.3

name	0610007P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372926 GeneID:68327 MGI:1915577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610007P22 gene transcript_id : NM_026676.2

name	Ube2i (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379350 GeneID:22196 MGI:107365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2I transcript_id : NM_011665.3

name	Prss34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342000 GeneID:328780 MGI:2681414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 34 transcript_id : NM_178372.2

name	Prss28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299757 GeneID:114661 MGI:2149951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 28 transcript_id : NM_053259.2

name	Prss29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981507 GeneID:114662 MGI:2149952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 29 transcript_id : NM_053260.2

name	Tpsab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981623 GeneID:17230 MGI:96943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptase alpha/beta 1 transcript_id : NM_031187.2

name	Mcpt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130496075 GeneID:17229 MGI:96942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 6 transcript_id : NM_010781.3

name	Tpsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981315 GeneID:26945 MGI:1349391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptase gamma 1 transcript_id : NM_012034.2

name	Cacna1h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62739189 GeneID:58226 MGI:1928842
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, T type, alpha 1H subunit transcript_id : NM_021415.3

name	Tekt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625870 GeneID:71840 MGI:1919090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tektin 4 transcript_id : NM_027951.1

name	Sstr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803431 GeneID:20609 MGI:894282
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : somatostatin receptor 5 transcript_id : NM_011425.2

name	Sox8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364470 GeneID:20681 MGI:98370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 8 transcript_id : NM_011447.2

name	Tmem112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981341 GeneID:76483 MGI:1923733
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 112 transcript_id : NM_029624.2

name	BC038613 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418887 CCDS:CCDS28453.1 GeneID:212733 MGI:2388267
definition	codon_start : 1 product : hypothetical protein LOC212733 protein_id : NP_722479.1

name	Thoc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605680 CCDS:CCDS28454.1 GeneID:386612 MGI:2677480
definition	codon_start : 1 product : WD repeat domain 58 protein_id : NP_001008425.1

name	Hcfc1r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32451500 CCDS:CCDS28455.1 GeneID:353502 MGI:2663619
definition	codon_start : 1 product : host cell factor C1 regulator 1 protein_id : NP_861542.1

name	Tnfrsf12a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305059 CCDS:CCDS28456.1 GeneID:27279 MGI:1351484
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007155 - cell adhesion [Evidence IDA]; GO:0008219 - cell death [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045773 - positive regulation of axon extension [Evidence IDA]; GO:0006931 - substrate-bound cell migration, cell attachment to substrate [Evidence IDA] codon_start : 1 exception : mismatches in translation function : modulates adhesion and migration note : fibroblast growth factor regulated protein 2; type I transmembrane protein Fn14 product : tumor necrosis factor receptor superfamily, member 12a protein_id : NP_038777.1

name	Cldn6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055190 CCDS:CCDS28457.1 GeneID:54419 MGI:1859284
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : tight junction molecule claudin 6 product : claudin 6 protein_id : NP_061247.1

name	Cldn9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098102 CCDS:CCDS28458.1 GeneID:56863 MGI:1913100
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : claudin-9 product : claudin 9 protein_id : NP_064689.2

name	EG666080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401763 GeneID:666080 MGI:3649130
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986550.1

name	1520401A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893093 GeneID:320309 MGI:2443785
definition	codon_start : 1 product : hypothetical protein LOC320309 protein_id : NP_796106.1

name	Pkmyt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625699 CCDS:CCDS28460.1 GeneID:268930 MGI:2137630
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : MYT1 kinase product : membrane-associated tyrosine-and threonine-specific cdc2-inhibitory kinase protein_id : NP_075545.2

name	Paqr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963841 CCDS:CCDS28461.1 GeneID:76498 MGI:1923748
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : progestin and adipoQ receptor family member IV protein_id : NP_076313.1

name	Kremen2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703354 CCDS:CCDS28462.1 GeneID:73016 MGI:1920266
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : kringle-containing transmembrane protein 2 protein_id : NP_082692.1

name	9530082P21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401765 GeneID:638247 MGI:3603340
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900700.1

name	Flywch1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418895 CCDS:CCDS28463.1 GeneID:224613 MGI:2442638
definition	codon_start : 1 exception : mismatches in translation product : FLYWCH-type zinc finger 1 protein_id : NP_722486.1

name	2810417J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553307 CCDS:CCDS28464.1 GeneID:76917 MGI:1924167
definition	codon_start : 1 product : hypothetical protein LOC76917 protein_id : NP_084074.1

name	LOC100042865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268647 GeneID:100042865
definition	codon_start : 1 product : similar to SPAC23A1.17 protein_id : XP_001479000.1

name	Srrm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157504 GeneID:75956 MGI:1923206
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : serine/arginine repetitive matrix 2 protein_id : NP_780438.2

name	Tceb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385800 GeneID:67673 MGI:1914923
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : 18 kDa, elongin B; transcription elongation factor B (SIII), polypeptide 2 (18 kDa, elongin B) product : transcription elongation factor B (SIII), polypeptide 2 protein_id : NP_080581.1

name	Prss33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487129 GeneID:353130 MGI:2661234
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IEA] [Evidence IC] codon_start : 1 note : tryptase 6; serine protease EOS product : protease, serine, 33 protein_id : NP_001074868.1

name	4931440B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037229 CCDS:CCDS28466.1 GeneID:71003 MGI:1918253
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : testis-specific serine protease 1 protein_id : NP_081920.1

name	Prss32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037179 GeneID:69814 MGI:1917064
definition	GO_component : GO:0016020 - membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IC] codon_start : 1 exception : unclassified translation discrepancy note : testisin; eosinophil serine protease product : tryptase 5 protein_id : NP_081496.1

name	Prss21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11055972 CCDS:CCDS28468.1 GeneID:57256 MGI:1916698
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IDA]; GO:0008236 - serine-type peptidase activity [Evidence ISS] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence TAS] codon_start : 1 note : testicular serine protease 5; protease, serine, 21 (testisin) product : tryptase 4 protein_id : NP_065233.2

name	Dcpp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815811 GeneID:13184 MGI:105949
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0001824 - blastocyst development [Evidence IDA] codon_start : 1 note : common salivary protein 1 product : demilune cell and parotid protein protein_id : NP_064294.2

name	Dcpp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647234 GeneID:630537 MGI:3644062
definition	codon_start : 1 note : sublingual parotid tongue-2 salivary protein product : demilune cell and parotid protein 2 protein_id : NP_001034327.2

name	Dcpp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647232 GeneID:620253 MGI:3646420
definition	codon_start : 1 note : sublingual parotid tongue-3 salivary protein product : demilune cell and parotid protein 3 protein_id : NP_001071101.1

name	Sbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755402 GeneID:20234 MGI:106021
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : spermine binding protein precursor protein_id : NP_035451.1

name	Sbpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116812642 GeneID:638345 MGI:3694550
definition	codon_start : 1 product : spermine binding protein like protein_id : NP_001070889.1

name	Tmprss8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24496768 CCDS:CCDS28470.1 GeneID:30943 MGI:1353645
definition	GO_component : GO:0046658 - anchored to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence ISS]; GO:0017080 - sodium channel regulator activity [Evidence ISS]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006508 - proteolysis [Evidence ISS]; GO:0006814 - sodium ion transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : distal intestinal serine protease product : transmembrane protease, serine 8 (intestinal) protein_id : NP_038949.2

name	Prss22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526924 GeneID:70835 MGI:1918085
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : protease, serine, 22 protein_id : NP_598492.1

name	LOC100042414 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268600 GeneID:100042414
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478197.1

name	Prss27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202035 CCDS:CCDS28472.1 GeneID:213171 MGI:2450123
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : pancreasin; channel-activating protease 2-like protein product : protease, serine 27 protein_id : NP_780649.1

name	Kctd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794420 CCDS:CCDS28473.1 GeneID:69259 MGI:1916509
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : potassium channel tetramerisation domain containing 5 protein_id : NP_081284.1

name	Pdpk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107598 GeneID:18607 MGI:1338068
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004676 - 3-phosphoinositide-dependent protein kinase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006972 - hyperosmotic response [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform B is encoded by transcript variant 2; Pkb kinase product : 3-phosphoinositide dependent protein kinase-1 isoform B protein_id : NP_001074242.1

name	Pdpk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124107594 CCDS:CCDS28474.1 GeneID:18607 MGI:1338068
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004676 - 3-phosphoinositide-dependent protein kinase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006972 - hyperosmotic response [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : isoform A is encoded by transcript variant 1; Pkb kinase product : 3-phosphoinositide dependent protein kinase-1 isoform A protein_id : NP_035192.2

name	Amdhd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982133 CCDS:CCDS28475.1 GeneID:245847 MGI:2443978
definition	codon_start : 1 product : amidohydrolase domain containing 2 protein_id : NP_766523.2

name	Atp6v0c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753144 CCDS:CCDS28476.1 GeneID:11984 MGI:88116
definition	GO_component : GO:0016471 - hydrogen-translocating V-type ATPase complex [Evidence TAS]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence ISS]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0007042 - lysosomal lumen acidification [Evidence TAS]; GO:0006810 - transport [Evidence IEA]; GO:0007035 - vacuolar acidification [Evidence TAS] codon_start : 1 note : ATPase, H+ transporting, lysosomal 2; H(+)-ATPase (mvp); proteolipid; lysosomal 16kDa; ATPase, H+ transporting, lysosomal (vacuolar proton pump) 16 kDa; ATPase, H+ transporting, lysosomal 16kD, V0 subunit C product : ATPase, H+ transporting, V0 subunit C protein_id : NP_033859.1

name	Tbc1d24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982145 CCDS:CCDS28477.1 GeneID:224617 MGI:2443456
definition	codon_start : 1 exception : mismatches in translation product : TBC1 domain family, member 24 protein_id : NP_775278.2

name	Ntn2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754904 CCDS:CCDS28478.1 GeneID:18209 MGI:1341188
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005576 - extracellular region [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0005102 - receptor binding [Evidence IPI] [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence ISS] GO_process : GO:0007409 - axonogenesis [Evidence TAS]; GO:0007520 - myoblast fusion [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence ISS] codon_start : 1 note : netrin 3 product : netrin 2-like protein_id : NP_035077.1

name	1600002H07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037283 CCDS:CCDS28479.1 GeneID:72016 MGI:1919266
definition	codon_start : 1 product : hypothetical protein LOC72016 protein_id : NP_082332.1

name	Ccnf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560724 GeneID:12449 MGI:102551
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0001890 - placenta development [Evidence IMP]; GO:0000320 - re-entry into mitotic cell cycle [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cyclin F protein_id : NP_031660.2

name	Abca17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83716006 GeneID:381072 MGI:3625331
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0003913 - DNA photolyase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006638 - neutral lipid metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : ATP-binding cassette, sub-family A (ABC1), member 17 protein_id : NP_001026792.1

name	Abca3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853071 GeneID:27410 MGI:1351617
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0042599 - lamellar body [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence ISS] codon_start : 1 product : ATP-binding cassette, sub-family A (ABC1), member 3 protein_id : NP_001034670.1

name	Abca3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88759350 GeneID:27410 MGI:1351617
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0042599 - lamellar body [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence ISS] codon_start : 1 product : ATP-binding cassette, sub-family A (ABC1), member 3 protein_id : NP_038883.2

name	Rnps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674799 GeneID:19826 MGI:97960
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 3 product : ribonucleic acid binding protein S1 isoform 2 protein_id : NP_001073597.1

name	Rnps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674790 GeneID:19826 MGI:97960
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 2 product : ribonucleic acid binding protein S1 isoform 1 protein_id : NP_001073596.1

name	Rnps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121674793 GeneID:19826 MGI:97960
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : ribonucleic acid binding protein S1 isoform 1 protein_id : NP_033096.2

name	Dci (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981810 CCDS:CCDS28480.1 GeneID:13177 MGI:94871
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence TAS] [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004165 - dodecenoyl-CoA delta-isomerase activity [Evidence IDA]; GO:0016853 - isomerase activity [Evidence IEA] GO_process : GO:0006635 - fatty acid beta-oxidation [Evidence IMP]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenyme A isomerase) protein_id : NP_034153.2

name	Dnase1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385174 GeneID:66705 MGI:1913955
definition	GO_function : GO:0004536 - deoxyribonuclease activity [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006308 - DNA catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : deoxyribonuclease 1-like 2 protein_id : NP_079994.1

name	E4f1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719296 CCDS:CCDS28481.1 GeneID:13560 MGI:109530
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IMP]; GO:0009790 - embryonic development [Evidence IMP]; GO:0009794 - regulation of progression through embryonic mitotic cell cycle [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence TAS] codon_start : 1 product : E4F transcription factor 1 protein_id : NP_031919.2

name	1700012G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254507 CCDS:CCDS28482.1 GeneID:67078 MGI:1914328
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67078 protein_id : NP_080230.2

name	9930021D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316786 CCDS:CCDS28483.1 GeneID:319259 MGI:2441766
definition	codon_start : 1 product : hypothetical protein LOC319259 protein_id : NP_783613.1

name	Gbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542885 CCDS:CCDS28484.1 GeneID:56716 MGI:1929514
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : transducin (beta)-like 4 product : G protein beta subunit-like protein_id : NP_064372.2

name	LOC666299 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94401775 GeneID:666299
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987974.1

name	Caskin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46592863 GeneID:268932 MGI:2442952
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : CASK interacting protein 1 protein_id : NP_082213.1

name	Traf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418905 GeneID:224619 MGI:3042141
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] GO_process : GO:0000185 - activation of MAPKKK activity [Evidence ISS]; GO:0006915 - apoptosis [Evidence ISS]; GO:0043410 - positive regulation of MAPKKK cascade [Evidence ISS]; GO:0016567 - protein ubiquitination [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ring finger and WD repeat domain 1 product : Tnf receptor-associated factor 7 protein_id : NP_722487.1

name	Rab26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268665 GeneID:328778 MGI:2443284
definition	codon_start : 1 product : RAB26, member RAS oncogene family isoform 1 protein_id : XP_283428.6

name	Pkd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487380 CCDS:CCDS28485.1 GeneID:18763 MGI:97603
definition	GO_component : GO:0005929 - cilium [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IPI] GO_function : GO:0005262 - calcium channel activity [Evidence TAS]; GO:0005261 - cation channel activity [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0001502 - cartilage condensation [Evidence IMP]; GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0050982 - detection of mechanical stimulus [Evidence IDA]; GO:0007507 - heart development [Evidence IMP]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0050954 - sensory perception of mechanical stimulus [Evidence IMP] codon_start : 1 product : polycystin 1 protein_id : NP_038658.2

name	Tsc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86439992 CCDS:CCDS28486.1 GeneID:22084 MGI:102548
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0046626 - regulation of insulin receptor signaling pathway [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; tuberin product : tuberous sclerosis 2 isoform 2 protein_id : NP_001034452.1

name	Tsc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86439987 GeneID:22084 MGI:102548
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0046626 - regulation of insulin receptor signaling pathway [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; tuberin product : tuberous sclerosis 2 isoform 1 protein_id : NP_035777.2

name	Nthl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679146 CCDS:CCDS28487.1 GeneID:18207 MGI:1313275
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0019104 - DNA N-glycosylase activity [Evidence IDA] [Evidence TAS]; GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IDA] [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA]; GO:0006296 - nucleotide-excision repair, DNA incision, 5'-to lesion [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : thymine glycol DNA glycosylase/AP lyase product : nth (endonuclease III)-like 1 protein_id : NP_032769.1

name	Slc9a3r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746432 CCDS:CCDS28488.1 GeneID:65962 MGI:1890662
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform A is encoded by transcript variant A; sodium/hydrogen exchanger product : solute carrier family 9 isoform 3 regulator 2 isoform A protein_id : NP_075542.1

name	Slc9a3r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21264334 CCDS:CCDS28489.1 GeneID:65962 MGI:1890662
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform B is encoded by transcript variant B; sodium/hydrogen exchanger product : solute carrier family 9 isoform 3 regulator 2 isoform B protein_id : NP_075938.1

name	Npw (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268609 GeneID:381073 MGI:2685781
definition	codon_start : 1 product : similar to prepro-Neuropeptide W polypeptide protein_id : XP_001478399.1

name	Zfp598 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147169 CCDS:CCDS28490.1 GeneID:213753 MGI:2670965
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 598 protein_id : NP_898972.1

name	Syngr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560541 CCDS:CCDS28491.1 GeneID:20974 MGI:1341881
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : Sgyr III; synaptogryin III product : synaptogyrin 3 protein_id : NP_035652.2

name	Gfer (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909575 CCDS:CCDS28492.1 GeneID:11692 MGI:107757
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 note : augmenter of liver regeneration product : growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration) protein_id : NP_075527.2

name	Noxo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26080420 GeneID:71893 MGI:1919143
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016176 - superoxide-generating NADPH oxidase activator activity [Evidence IDA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006801 - superoxide metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : NADPH oxidase organizer 1 protein_id : NP_082264.1

name	Tbl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30102935 CCDS:CCDS28493.1 GeneID:213773 MGI:2384863
definition	codon_start : 1 product : transducin (beta)-like 3 protein_id : NP_663371.2

name	Rnf151 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385712 GeneID:67504 MGI:1914754
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : ring finger protein 151 protein_id : NP_080481.1

name	Rps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087805 GeneID:16898 MGI:105110
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : repeat family 3 product : ribosomal protein S2 protein_id : NP_032529.2

name	Ndufb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037109 CCDS:CCDS28494.1 GeneID:68342 MGI:1915592
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10 protein_id : NP_080960.1

name	Rpl3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384820 GeneID:66211 MGI:1913461
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L3-like protein_id : NP_079701.1

name	Sepx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305479 CCDS:CCDS28495.1 GeneID:27361 MGI:1351642
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0000318 - protein-methionine-R-oxide reductase activity [Evidence IDA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence IDA] GO_process : GO:0030091 - protein repair [Evidence IDA] codon_start : 1 note : selenoprotein R; methionine-R-sulfoxide reductase product : selenoprotein X 1 protein_id : NP_038787.1 transl_except : (pos:24877103..24877105,aa:Sec)

name	Hs3st6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60223081 CCDS:CCDS28496.1 GeneID:328779 MGI:3580487
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008467 - heparin-glucosamine 3-O-sulfotransferase activity [Evidence IDA]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : heparan sulfate 3-O-sulfotransferase 6 product : heparan sulfate (glucosamine) 3-O-sulfotransferase 6 protein_id : NP_001012402.1

name	4930528F23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770106 GeneID:75178 MGI:1922428
definition	codon_start : 1 product : hypothetical protein LOC75178 protein_id : XP_128478.3

name	Fahd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963697 GeneID:68636 MGI:1915886
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : Similar to homoprotocatechuate catabolism bifunctional isomerase/decarboxylase homolog (UniProt\|Q8BLJ7, evidence: FASTY, 100%ID, 100%length, match=663); putative product : fumarylacetoacetate hydrolase domain containing 1 protein_id : NP_075969.1

name	Hagh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729786 CCDS:CCDS28499.1 GeneID:14651 MGI:95745
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004416 - hydroxyacylglutathione hydrolase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glyoxalase II; round spermatid protein RSP29; glyoxylase 2 product : hydroxyacyl glutathione hydrolase protein_id : NP_077246.1

name	Igfals (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982258 GeneID:16005 MGI:107973
definition	GO_function : GO:0005520 - insulin-like growth factor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : insulin-like growth factor binding protein, acid labile subunit protein_id : NP_032366.2

name	Nubp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754908 CCDS:CCDS28500.1 GeneID:26426 MGI:1347072
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : nucleotide binding protein 2 protein_id : NP_036086.1

name	Spsb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252774 CCDS:CCDS28501.1 GeneID:79043 MGI:1891471
definition	codon_start : 1 exception : mismatches in translation note : SPRY domain-containing SOCS box protein SSB-3 product : splA/ryanodine receptor domain and SOCS box containing 3 protein_id : NP_081417.1

name	Mrps34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385670 CCDS:CCDS28502.1 GeneID:79044 MGI:1930188
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : T-complex expressed gene 2 product : mitochondrial ribosomal protein S34 protein_id : NP_075749.1

name	Nme3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790121 CCDS:CCDS28503.1 GeneID:79059 MGI:1930182
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0009209 - pyrimidine ribonucleoside triphosphate biosynthesis [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nucleoside diphosphate kinase DR-nm23 protein_id : NP_062704.1

name	Mapk8ip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305255 GeneID:30957 MGI:1353598
definition	GO_component : GO:0030673 - axolemma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] [Evidence IEP]; GO:0030425 - dendrite [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005790 - smooth endoplasmic reticulum [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0019894 - kinesin binding [Evidence IPI]; GO:0005078 - MAP-kinase scaffold activity [Evidence IPI] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IPI] GO_process : GO:0007257 - activation of JNK activity [Evidence IDA]; GO:0007411 - axon guidance [Evidence IMP]; GO:0030900 - forebrain development [Evidence IMP]; GO:0007254 - JNK cascade [Evidence IDA]; GO:0008104 - protein localization [Evidence IMP]; GO:0046328 - regulation of JNK cascade [Evidence IDA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0016192 - vesicle-mediated transport [Evidence IDA] codon_start : 1 exception : mismatches in translation function : JNK MAP kinase signal transduction pathway molecular scaffold note : JNK-interacting protein 3; JUN/SAPK-associated protein 1; c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1; sunday driver 2 product : mitogen-activated protein kinase 8 interacting protein 3 protein_id : NP_038959.1

name	Hn1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39573709 CCDS:CCDS28504.1 GeneID:52009 MGI:1196260
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : hematopoietic- and neurologic-expressed sequence 1-like product : HN1-like protein protein_id : NP_945175.1

name	Cramp1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770109 GeneID:57354 MGI:1930190
definition	codon_start : 1 product : Crm, cramped-like isoform 1 protein_id : XP_484614.1

name	Cramp1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401767 GeneID:57354 MGI:1930190
definition	codon_start : 1 product : Crm, cramped-like isoform 5 protein_id : XP_988921.1

name	Ift140 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993726 CCDS:CCDS28505.1 GeneID:106633 MGI:2146906
definition	GO_component : GO:0019861 - flagellum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : WD and tetratricopeptide repeats 2 product : intraflagellar transport 140 protein_id : NP_598887.2

name	BC054438 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564090 CCDS:CCDS28506.1 GeneID:407831 MGI:3039635
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : cDNA sequence BC054438 protein_id : NP_001001183.1

name	Telo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311992 CCDS:CCDS28507.1 GeneID:71718 MGI:1918968
definition	codon_start : 1 exception : mismatches in translation product : TEL2, telomere maintenance 2, homolog protein_id : NP_082156.1

name	1110018H23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268670 GeneID:68509 MGI:1915759
definition	codon_start : 1 product : neuronal pentraxin II-like protein_id : XP_128459.3

name	Clcn7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753436 CCDS:CCDS28509.1 GeneID:26373 MGI:1347048
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : chloride channel 7 protein_id : NP_036060.1

name	Gm317 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268611 GeneID:207209 MGI:2685163
definition	codon_start : 1 product : hypothetical protein LOC207209 protein_id : XP_139904.6

name	BC003965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401788 GeneID:214489 MGI:2670966
definition	codon_start : 1 product : hypothetical protein LOC214489 protein_id : XP_128528.4

name	Unkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794158 CCDS:CCDS28510.1 GeneID:74154 MGI:1921404
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : Grailexp predicted product : unkempt-like protein_id : NP_083065.1

name	Gnptg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49457855 CCDS:CCDS28511.1 GeneID:214505 MGI:2147006
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] codon_start : 1 note : M6PR domain containing protein 1; M6PR domain-containing protein 1; mannose-6-phosphate receptor domain; T-complex expressed 7 product : M6PR domain-containing protein 1 precursor protein_id : NP_766117.2

name	0610007P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489947 CCDS:CCDS28512.1 GeneID:68327 MGI:1915577
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68327 protein_id : NP_080952.1

name	Ube2i (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7549799 CCDS:CCDS28513.1 GeneID:22196 MGI:107365
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2I protein_id : NP_035795.1

name	Prss34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410030 CCDS:CCDS28514.1 GeneID:328780 MGI:2681414
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IC] codon_start : 1 note : mast cell protease-11; mast cell protease 11 product : protease, serine, 34 protein_id : NP_848459.1

name	Prss28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299758 CCDS:CCDS28515.1 GeneID:114661 MGI:2149951
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IMP] GO_process : GO:0007566 - embryo implantation [Evidence IMP] codon_start : 1 note : implantation serine protease 1 product : protease, serine, 28 protein_id : NP_444489.2

name	Prss29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716593 CCDS:CCDS28516.1 GeneID:114662 MGI:2149952
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : implantation serine protease 2 protein_id : NP_444490.1

name	Tpsab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981624 GeneID:17230 MGI:96943
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0030019 - tryptase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mast cell protease 7 protein_id : NP_112464.2

name	Mcpt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130496076 CCDS:CCDS28517.1 GeneID:17229 MGI:96942
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0008201 - heparin binding [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0030019 - tryptase activity [Evidence IDA] GO_process : GO:0006954 - inflammatory response [Evidence TAS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 6 protein_id : NP_034911.3

name	Tpsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755819 CCDS:CCDS28518.1 GeneID:26945 MGI:1349391
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence ISS] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transmembrane tryptase product : tryptase gamma 1 protein_id : NP_036164.1

name	Cacna1h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62739190 GeneID:58226 MGI:1928842
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence ISS] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0008332 - low voltage-gated calcium channel activity [Evidence ISS]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : T-type Cav3.2; low-voltage-activated calcium channel alpha13.2 subunit product : calcium channel alpha13.2 subunit protein_id : NP_067390.3

name	Tekt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625871 CCDS:CCDS28519.1 GeneID:71840 MGI:1919090
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : testicular microtubules-related protein 4 product : tektin 4 protein_id : NP_082227.1

name	Sstr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315983 CCDS:CCDS28520.1 GeneID:20609 MGI:894282
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004994 - somatostatin receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0050796 - regulation of insulin secretion [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : somatostatin receptor 5 protein_id : NP_035555.1

name	Sox8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563276 CCDS:CCDS28521.1 GeneID:20681 MGI:98370
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence IEA] GO_process : GO:0045165 - cell fate commitment [Evidence IGI]; GO:0048469 - cell maturation [Evidence IGI] [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SRY-box containing gene 8 protein_id : NP_035577.1

name	Tmem112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981342 GeneID:76483 MGI:1923733
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76483 protein_id : NP_083900.2

name	LOC383225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383225
definition	number : 1 pseudo : _no_value

name	LOC383225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383225
definition	number : 2 pseudo : _no_value

name	LOC432543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:432543
definition	number : 2 pseudo : _no_value

name	LOC432543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:432543
definition	number : 1 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 1 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 2 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 3 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 4 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 5 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 6 pseudo : _no_value

name	LOC100042580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042580
definition	number : 2 pseudo : _no_value

name	LOC100042580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042580
definition	number : 1 pseudo : _no_value

name	LOC666157 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268597 GeneID:666157
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Ribosomal protein L7a pseudo : _no_value transcript_id : XR_033542.1

name	LOC620233 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268598 GeneID:620233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 5 Proteins product : similar to Ribosomal protein L7a pseudo : _no_value transcript_id : XR_035691.1

name	Snora64 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604684 GeneID:104366 MGI:2148175
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, H/ACA box 64 transcript_id : NR_002897.1

clone name	MSMg01-047A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454E09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-405M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-214F15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-214G15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-062H04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-214D20.b	B6Ng01-214D20.g
ACC	GA031542	GA031543
length	1,013	193
definition	B6Ng01-214D20.b	B6Ng01-214D20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(24,807,743 - 24,808,747)	(24,793,300 - 24,793,492)
sequence	gaattctggaattcaggacatattcaaagggtaatacaagactcagtaag ggacaagggtgaaggcgctaggttacaagtggagggaatcaggataaacg gtgaggctgagctggacagctaccatctcaccccacttcccaaagagctc ctgctgcccagcatggtggtacaagtctaagaggacgcccaggcttagcc aggggcacagagtgtcaaaccacatcccagccagggcaagctaacagctc atgtcaaaagcccctgccacagagctcttagaggtgtgaggctcaggaag actgagggagggcagacactggctacagctgacatatgtatgtatgttca ctcacttcctgagtgagacccagagcccaggccaggacgacgtacataag gacctacaaaatgtctcccttcctagaaggaagctacaggtatgtgtgct caaaacccgtgtcagaccttcccatcagcgtgtgcacgactggccagcaa agccccagcaagaccctgagtaggacaccagccaaaagcttccagagatg tttctaaaccccagatctcatccagtagggtaaggctccttccaccacac tatgtctggggtcttctagtccctcttccccagtatgacatagatgctta gggaatgttccagattccagctgagtcttttgacataaatatcaagaaag aaaagctgggtgtgctgggtatggtggagaatgaccttagccctcaggag gtagaggcaggtggatctgtgtgacttcaaggccagtctggttctagaga atgagttccaggactgccagagctacaggccctgtctcaaatacgggata tggtggtgcactgcctttaatctcagaaatcaggaagctagaatactggt ttctatattaaaagtttctaggccagttctgtgattttatagtgagaccc tatcttctcaagaaagaaaaaaggtcataatgaaatgaatataaaaaaaa aaactcaaaattt	caacagcagatggggagggagatttgaggagtcccagcacttaggtctga gaaaagacagatgctagaagtttggagatgcagcagagggtgaggggtct agttgtgtgaagctggatgaagcccaaagatgtgcatgcatgggtgtgag tgtggtctctctgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg
quality values	Open. Hide. 52 29 35 32 58 54 36 38 38 45 30 41 62 41 31 52 62 47 56 56 62 62 54 62 41 51 62 62 62 62 62 49 49 62 62 56 62 56 59 59 59 62 62 59 59 62 62 62 62 62 62 62 59 51 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 62 62 62 62 62 62 54 62 62 62 54 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 59 62 54 62 54 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 49 51 62 62 54 47 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 51 47 47 62 62 62 62 62 62 62 62 56 46 56 56 62 56 37 62 62 62 62 62 62 62 62 54 42 56 62 54 39 62 62 56 62 62 56 62 56 62 62 62 62 62 56 47 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 47 62 46 56 50 56 56 56 62 62 47 50 44 47 52 51 41 45 62 62 62 54 46 52 62 62 35 47 41 62 62 62 42 54 22 62 62 62 62 45 62 42 62 62 41 39 52 62 43 52 52 44 43 42 58 58 52 58 52 39 54 45 58 58 37 45 45 42 32 54 38 52 23 28 41 45 49 58 58 54 58 58 52 42 58 54 54 28 41 47 52 58 58 54 54 54 54 52 52 54 54 39 41 52 52 52 54 58 46 58 42 58 24 58 54 50 52 37 19 14 8 15 34 35 47 31 33 36 36 32 35 58 32 10 38 35 52 40 51 29 41 31 19 7 31 20 51 33 37 34 32 33 41 33 49 53 46 45 25 33 40 40 24 35 27 38 9 19 19 41 25 41 39 51 19 8 8 33 28 22 17 46 19 51 19 25 37 39 22 51 19 36 32 34 7 37 16 11 40 46 50 35 24 17 58 25 40 50 27 35 22 16 15 7 19 22 12 50 49 32 39 21 31 24 35 32 30 30 13 19 10 24 11 9 12 19 31 39 26 16 19 32 31 14 21 35 50 28 43 40 44 40 22 12 21 33 35 30 32 17 46 19 17 20 21 12 11 23 19 15 22 6 9 11 15 23 17 9 9 24 30 37 33 9 32 35 15 9 9 7 9 13 13 10 6 6 9 9 13 24 13 20 8 13 12 18 7 13 9 6 9 6 15 9 13 9 8 18 12 12 9 15 9 11 5 16 27 31 17 14 15 11 11 15 14 24 40 32 24 9 6 10 11 6 12 6 9 23 9 9 24 30 11 6 17 5 10 13 31 17 6 13 14 19 6 6 10 6 11 8 6 11 18 13 15 5 19 9 11 10 12 13 7 9 13 12 14 13 16 11 5 6 13 45 18 40 22	Open. Hide. 59 17 62 59 59 18 24 11 13 28 30 59 54 48 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 24 46 28 28 28 34 49 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 56 62 56 37 37 46 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 27 13 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_24807743_24808747
seq2: B6Ng01-214D20.b_50_1062 (reverse)

seq1  AAATTTTGAGTTTTTTTTTTTTTTTTTCTTTTCTTTCTGACC-TTTTTCT  49
      |||||||||| ||||||||||| | ||| |||| || ||||| |||||||
seq2  AAATTTTGAG-TTTTTTTTTTTATATTCATTTCATTATGACCTTTTTTCT  49

seq1  TTCTCGTTGAGATAGGGTCTCACTATGTAGTCCTGG--CTGGCCT-GGAA  96
      |||| |   |||||||||||||||||  | ||   |  ||||||| | ||
seq2  TTCTTGAGAAGATAGGGTCTCACTATAAAATCACAGAACTGGCCTAGAAA  99

seq1  CTTGTTATGTAG-AACCAGTA-TCT-GCCTCCTGATTTCTGAGATTAAAG  143
      ||| | || ||| |||||||| ||| || |||||||||||||||||||||
seq2  CTTTTAATATAGAAACCAGTATTCTAGCTTCCTGATTTCTGAGATTAAAG  149

seq1  GCAGTGCACCACCATATCCCGTATTTGAGACAGGGCCTGTAGCTCTGGCA  193
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTGCACCACCATATCCCGTATTTGAGACAGGGCCTGTAGCTCTGGCA  199

seq1  GTCCTGGAACTCATTCTCTAG-ACCAGACTGGCCTTGAAGTCACACAGAT  242
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GTCCTGGAACTCATTCTCTAGAACCAGACTGGCCTTGAAGTCACACAGAT  249

seq1  CCACCTGCCTCTACCTCCTGAGGGCT-AGGTCATTCTCCACCATACCCAG  291
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  CCACCTGCCTCTACCTCCTGAGGGCTAAGGTCATTCTCCACCATACCCAG  299

seq1  CACACCCAGCTTTTCTTTCTTGATATTTATGTCAAAAGACTCAGCTGGAA  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACCCAGCTTTTCTTTCTTGATATTTATGTCAAAAGACTCAGCTGGAA  349

seq1  TCTGGAACATTCCCTAAGCATCTATGTCATACTGGGGAAGAGGGACTAGA  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGAACATTCCCTAAGCATCTATGTCATACTGGGGAAGAGGGACTAGA  399

seq1  AGACCCCAGACATAGTGTGGTGGAAGGAGCCTTACCCTACTGGATGAGAT  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCCCAGACATAGTGTGGTGGAAGGAGCCTTACCCTACTGGATGAGAT  449

seq1  CTGGGGTTTAGAAACATCTCTGGAAGCTTTTGGCTGGTGTCCTACTCAGG  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGGTTTAGAAACATCTCTGGAAGCTTTTGGCTGGTGTCCTACTCAGG  499

seq1  GTCTTGCTGGGGCTTTGCTGGCCAGTCGTGCACACGCTGATGGGAAGGTC  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTGCTGGGGCTTTGCTGGCCAGTCGTGCACACGCTGATGGGAAGGTC  549

seq1  TGACACGGGTTTTGAGCACACATACCTGTAGCTTCCTTCTAGGAAGGGAG  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACACGGGTTTTGAGCACACATACCTGTAGCTTCCTTCTAGGAAGGGAG  599

seq1  ACATTTTGTAGGTCCTTATGTACGTCGTCCTGGCCTGGGCTCTGGGTCTC  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTTGTAGGTCCTTATGTACGTCGTCCTGGCCTGGGCTCTGGGTCTC  649

seq1  ACTCAGGAAGTGAGTGAACATACATACATATGTCAGCTGTAGCCAGTGTC  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCAGGAAGTGAGTGAACATACATACATATGTCAGCTGTAGCCAGTGTC  699

seq1  TGCCCTCCCTCAGTCTTCCTGAGCCTCACACCTCTAAGAGCTCTGTGGCA  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCTCCCTCAGTCTTCCTGAGCCTCACACCTCTAAGAGCTCTGTGGCA  749

seq1  GGGGCTTTTGACATGAGCTGTTAGCTTGCCCTGGCTGGGATGTGGTTTGA  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGCTTTTGACATGAGCTGTTAGCTTGCCCTGGCTGGGATGTGGTTTGA  799

seq1  CACTCTGTGCCCCTGGCTAAGCCTGGGCGTCCTCTTAGACTTGTACCACC  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCTGTGCCCCTGGCTAAGCCTGGGCGTCCTCTTAGACTTGTACCACC  849

seq1  ATGCTGGGCAGCAGGAGCTCTTTGGGAAGTGGGGTGAGATGGTAGCTGTC  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTGGGCAGCAGGAGCTCTTTGGGAAGTGGGGTGAGATGGTAGCTGTC  899

seq1  CAGCTCAGCCTCACCGTTTATCCTGATTCCCTCCACTTGTAACCTAGCGC  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTCAGCCTCACCGTTTATCCTGATTCCCTCCACTTGTAACCTAGCGC  949

seq1  CTTCACCCTTGTCCCTTACTGAGTCTTGTATTACCCTTTGAATATGTCCT  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCACCCTTGTCCCTTACTGAGTCTTGTATTACCCTTTGAATATGTCCT  999

seq1  GAATTCCAGAATTC  1005
      ||||||||||||||
seq2  GAATTCCAGAATTC  1013

seq1: chr17_24793300_24793492
seq2: B6Ng01-214D20.g_71_263

seq1  CAACAGCAGATGGGGAGGGAGATTTGAGGAGTCCCAGCACTTAGGTCTGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAGCAGATGGGGAGGGAGATTTGAGGAGTCCCAGCACTTAGGTCTGA  50

seq1  GAAAAGACAGATGCTAGAAGTTTGGAGATGCAGCAGAGGGTGAGGGGTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAGACAGATGCTAGAAGTTTGGAGATGCAGCAGAGGGTGAGGGGTCT  100

seq1  AGTTGTGTGAAGCTGGATGAAGCCCAAAGATGTGCATGCATGGGTGTGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGTGTGAAGCTGGATGAAGCCCAAAGATGTGCATGCATGGGTGTGAG  150

seq1  TGTGGTCTCTCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG  193
      |||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGTCTCTCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG  193

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information