MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-215H02
Chromosome	17 (Build37)
Map Location	37,916,567 - 37,917,512
singlet/doublet	singlet
Overlap gene	none
Upstream gene	H2-M10.6, Trim26, Trim15, Trim10, LOC100043164, Trim40, Trim31, Ppp1r11, Znrd1, 1700022C21Rik, H2-M6-ps, 2410137M14Rik, H2-M4-ps, D130003B22Rik, Zfp57, Mog, Gabbr1, Olfr90, Olfr91, Olfr92, EG224763, LOC667973, Olfr93, Olfr753-ps1, LOC630355, Ubd, Olfr94, Olfr95, Olfr96, Olfr97, Olfr754-ps1, Olfr98, H2-M3, Olfr755-ps1, Olfr99, Olfr756-ps1, Olfr101, Olfr102, Olfr103, Olfr104, GA_x5J8B7W5KGR-1115818-1115257, Olfr105, Olfr758-ps1, Olfr106, Olfr107, Olfr759-ps1, Olfr108, Olfr760-ps1, Olfr109, H2-M2, Olfr110, Olfr111, Olfr112, Olfr113, Olfr114, Olfr115, Olfr116, Olfr117, Olfr118, Olfr119, Scocp, Olfr120, Olfr1558-ps1, Olfr121, Olfr122
Downstream gene	Olfr123, Olfr124, Olfr125, LOC672822, Olfr126, Olfr127, Olfr128, Ppia-ps17_697.1, Olfr761, Olfr1552-ps1, LOC100043265, Olfr129, Olfr130, Olfr131, Olfr132, Olfr133, Olfr134, Olfr135, Olfr138, Olfr137, Olfr762-ps1, Olfr136, LOC626985
Link	Open Mouse BAC browser

Click to get alignment info.

name	H2-M10.6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399549 MGI:2687364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22670 MGI:1337056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69097 MGI:1916347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19824 MGI:1338757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043164 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Trim40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195359 MGI:2684881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224762 MGI:2385051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76497 MGI:1923747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znrd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66136 MGI:1913386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76416 MGI:1923666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M6-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14994 MGI:95918
definition	gene_synonym : H-2M6; H2-M6 note : histocompatibility 2, M region locus 6, pseudogene pseudo : _no_value

name	2410137M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76797 MGI:1924047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M4-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14992 MGI:95916
definition	gene_synonym : H-2M4; H2-M4 note : histocompatibility 2, M region locus 4, pseudogene pseudo : _no_value

name	D130003B22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240095 MGI:3036265
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 144 Proteins

name	Zfp57 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22715 MGI:99204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17441 MGI:97435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabbr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54393 MGI:1860139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr90 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258469 MGI:2177473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr91 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258470 MGI:2177474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr92 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258448 MGI:2177475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG224763 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224763 MGI:3644619
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	LOC667973 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein pseudo : _no_value

name	Olfr93 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258051 MGI:2177476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr753-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258052 MGI:3030587
definition	gene_synonym : MOR256-38; Olfr92-L note : olfactory receptor 753, pseudogene 1 pseudo : _no_value

name	LOC630355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ubd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24108 MGI:1344410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr94 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258219 MGI:2177477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr95 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258506 MGI:2177478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr96 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258507 MGI:2177479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258505 MGI:2177480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr754-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258050 MGI:3030588
definition	gene_synonym : MOR121-2P note : olfactory receptor 754, pseudogene 1 pseudo : _no_value

name	Olfr98 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258503 MGI:2177481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14991 MGI:95915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr755-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258049 MGI:3030589
definition	gene_synonym : MOR121-3P note : olfactory receptor 755, pseudogene 1 pseudo : _no_value

name	Olfr99 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258508 MGI:2177482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr756-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404420 MGI:3030590
definition	note : olfactory receptor 756, pseudogene 1 pseudo : _no_value

name	Olfr101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258831 MGI:2177484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258218 MGI:2177485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258830 MGI:2177486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257948 MGI:2177487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W5KGR-1115818-1115257 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257807
definition	note : olfactory receptor GA_x5J8B7W5KGR-1115818-1115257 pseudo : _no_value

name	Olfr105 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257893 MGI:2177488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr758-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404422 MGI:3030592
definition	note : olfactory receptor 758, pseudogene 1 pseudo : _no_value

name	Olfr106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257925 MGI:2177489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258504 MGI:2177490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr759-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258048 MGI:3030593
definition	gene_synonym : MOR121-4P note : olfactory receptor 759, pseudogene 1 pseudo : _no_value

name	Olfr108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258457 MGI:2177491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr760-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404423 MGI:3030594
definition	gene_synonym : MOR121-5_p note : olfactory receptor 760, pseudogene 1 pseudo : _no_value

name	Olfr109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258832 MGI:2177492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-M2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14990 MGI:95914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258325 MGI:2177493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr111 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545205 MGI:2177494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258096 MGI:2177495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258286 MGI:2177496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258284 MGI:2177497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257908 MGI:2177498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258625 MGI:2177499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258263 MGI:2177500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr118 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404308 MGI:2177501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr119 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258095 MGI:2177502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scocp (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654468
definition	note : Scoc pseudogene pseudo : _no_value

name	Olfr120 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258624 MGI:2177503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1558-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257907 MGI:3031392
definition	gene_synonym : MOR263-11 note : olfactory receptor 1558, pseudogene 1 pseudo : _no_value

name	Olfr121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258622 MGI:2177504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr122 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258285 MGI:2177505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258623 MGI:2177506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259064 MGI:2177507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr125 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258287 MGI:2177508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Olfr126 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258892 MGI:2177509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258374 MGI:2177510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383243 MGI:2177511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps17_697.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546691
definition	note : peptidylprolyl isomerase A pseudogene 17_697.1 pseudo : _no_value

name	Olfr761 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258094 MGI:3030595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1552-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257966 MGI:3031386
definition	gene_synonym : MOR218-6P note : olfactory receptor 1552, pseudogene 1 pseudo : _no_value

name	LOC100043265 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043265
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr129 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258324 MGI:2177512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258480 MGI:2177513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258867 MGI:2177514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr132 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257889 MGI:2177515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258828 MGI:2177516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr134 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258829 MGI:2177517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr135 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258329 MGI:2177518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170648 MGI:2177521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr137 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258481 MGI:2177520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr762-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404424 MGI:3030596
definition	note : olfactory receptor 762, pseudogene 1 pseudo : _no_value

name	Olfr136 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258803 MGI:2177519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626985 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	H2-M10.6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475547 GeneID:399549 MGI:2687364
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 10.6 transcript_id : NM_201611.1

name	Trim26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485540 GeneID:22670 MGI:1337056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 26 transcript_id : NM_001025599.2

name	Trim15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131215 GeneID:69097 MGI:1916347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 15 transcript_id : NM_001024134.2

name	Trim10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755339 GeneID:19824 MGI:1338757
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 10 transcript_id : NM_011280.1

name	Trim40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802270 GeneID:195359 MGI:2684881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 40 transcript_id : NM_001033235.2

name	Trim31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130248 GeneID:224762 MGI:2385051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 31 transcript_id : NM_146077.2

name	Ppp1r11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18390326 GeneID:76497 MGI:1923747
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 11 transcript_id : NM_029632.1

name	Znrd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378639 GeneID:66136 MGI:1913386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc ribbon domain containing, 1 transcript_id : NM_023162.4

name	1700022C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095008 GeneID:76416 MGI:1923666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700022C21 gene transcript_id : NM_029602.1

name	2410137M14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369029 GeneID:76797 MGI:1924047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410137M14 gene transcript_id : NM_029747.2

name	D130003B22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268697 GeneID:240095 MGI:3036265
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 144 Proteins product : RIKEN cDNA D130003B22 gene transcript_id : XM_993503.2

name	Zfp57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000699 GeneID:22715 MGI:99204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 57 transcript_id : NM_001013745.1

name	Zfp57 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328160 GeneID:22715 MGI:99204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 57 transcript_id : NM_009559.2

name	Mog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199770 GeneID:17441 MGI:97435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin oligodendrocyte glycoprotein transcript_id : NM_010814.2

name	Gabbr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131888528 GeneID:54393 MGI:1860139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA-B) receptor, 1 transcript_id : NM_019439.3

name	Olfr90 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238945 GeneID:258469 MGI:2177473
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 90 transcript_id : NM_146477.1

name	Olfr91 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238943 GeneID:258470 MGI:2177474
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 91 transcript_id : NM_182714.1

name	Olfr92 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238933 GeneID:258448 MGI:2177475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 92 transcript_id : NM_146456.1

name	EG224763 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268699 GeneID:224763 MGI:3644619
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG224763 transcript_id : XM_139937.3

name	Olfr93 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801391 GeneID:258051 MGI:2177476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 93 transcript_id : NM_001011813.1

name	Ubd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13194204 GeneID:24108 MGI:1344410
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin D transcript_id : NM_023137.2

name	Olfr94 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372121 GeneID:258219 MGI:2177477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 94 transcript_id : NM_001011518.1

name	Olfr95 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238909 GeneID:258506 MGI:2177478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 95 transcript_id : NM_146513.1

name	Olfr96 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239319 GeneID:258507 MGI:2177479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 96 transcript_id : NM_146514.1

name	Olfr97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239263 GeneID:258505 MGI:2177480
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 97 transcript_id : NM_146512.1

name	Olfr98 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239259 GeneID:258503 MGI:2177481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 98 transcript_id : NM_146510.1

name	H2-M3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074554 GeneID:14991 MGI:95915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 3 transcript_id : NM_013819.2

name	Olfr99 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239261 GeneID:258508 MGI:2177482
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 99 transcript_id : NM_146515.1

name	Olfr101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129194 GeneID:258831 MGI:2177484
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 101 transcript_id : NM_146834.1

name	Olfr102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801499 GeneID:258218 MGI:2177485
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : olfactory receptor 102 transcript_id : NM_001011721.1

name	Olfr103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129192 GeneID:258830 MGI:2177486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 103 transcript_id : NM_146833.1

name	Olfr104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801335 GeneID:257948 MGI:2177487
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 104 transcript_id : NM_001011783.1

name	Olfr105 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801281 GeneID:257893 MGI:2177488
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 105 transcript_id : NM_001011744.1

name	Olfr106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801311 GeneID:257925 MGI:2177489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 106 transcript_id : NM_001011764.1

name	Olfr107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239257 GeneID:258504 MGI:2177490
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 107 transcript_id : NM_146511.1

name	Olfr108 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239253 GeneID:258457 MGI:2177491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 108 transcript_id : NM_146465.1

name	Olfr109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129188 GeneID:258832 MGI:2177492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 109 transcript_id : NM_146835.1

name	H2-M2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130900 GeneID:14990 MGI:95914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, M region locus 2 transcript_id : NM_008204.2

name	Olfr110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129642 GeneID:258325 MGI:2177493
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 110 transcript_id : NM_146328.1

name	Olfr111 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70794757 GeneID:545205 MGI:2177494
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 111 transcript_id : NM_001005485.1

name	Olfr112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665723 GeneID:258096 MGI:2177495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 112 transcript_id : NM_001013575.3

name	Olfr113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129710 GeneID:258286 MGI:2177496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 113 transcript_id : NM_146289.1

name	Olfr114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129714 GeneID:258284 MGI:2177497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 114 transcript_id : NM_146287.1

name	Olfr115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801293 GeneID:257908 MGI:2177498
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 115 transcript_id : NM_001011753.1

name	Olfr116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239075 GeneID:258625 MGI:2177499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 116 transcript_id : NM_146632.1

name	Olfr117 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391062 GeneID:258263 MGI:2177500
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 117 transcript_id : NM_207155.1

name	Olfr118 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47523371 GeneID:404308 MGI:2177501
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 118 transcript_id : NM_213721.1

name	Olfr119 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801423 GeneID:258095 MGI:2177502
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 119 transcript_id : NM_001011830.1

name	Olfr120 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238907 GeneID:258624 MGI:2177503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 120 transcript_id : NM_146631.1

name	Olfr121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593001 GeneID:258622 MGI:2177504
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 121 transcript_id : NM_146629.2

name	Olfr122 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953212 GeneID:258285 MGI:2177505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 122 transcript_id : NM_146288.2

name	Olfr123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238929 GeneID:258623 MGI:2177506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 123 transcript_id : NM_146630.1

name	Olfr124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128830 GeneID:259064 MGI:2177507
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 124 transcript_id : NM_147062.1

name	Olfr125 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129704 GeneID:258287 MGI:2177508
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 125 transcript_id : NM_146290.1

name	Olfr126 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112982876 GeneID:258892 MGI:2177509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 126 transcript_id : NM_146890.2

name	Olfr127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129546 GeneID:258374 MGI:2177510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 127 transcript_id : NM_146377.1

name	Olfr128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45592939 GeneID:383243 MGI:2177511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 128 transcript_id : NM_206816.1

name	Olfr761 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801421 GeneID:258094 MGI:3030595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 761 transcript_id : NM_001011829.1

name	Olfr129 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129639 GeneID:258324 MGI:2177512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 129 transcript_id : NM_146327.1

name	Olfr130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238949 GeneID:258480 MGI:2177513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 130 transcript_id : NM_146487.1

name	Olfr131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129142 GeneID:258867 MGI:2177514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 131 transcript_id : NM_146867.1

name	Olfr132 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828685 GeneID:257889 MGI:2177515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 132 transcript_id : NM_001005481.1

name	Olfr133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129196 GeneID:258828 MGI:2177516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 133 transcript_id : NM_146831.1

name	Olfr134 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129198 GeneID:258829 MGI:2177517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 134 transcript_id : NM_146832.1

name	Olfr135 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129629 GeneID:258329 MGI:2177518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 135 transcript_id : NM_146332.1

name	Olfr138 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828662 GeneID:170648 MGI:2177521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 138 transcript_id : NM_130868.1

name	Olfr137 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238947 GeneID:258481 MGI:2177520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 137 transcript_id : NM_146488.1

name	Olfr136 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129244 GeneID:258803 MGI:2177519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 136 transcript_id : NM_146807.1

name	H2-M10.6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475548 CCDS:CCDS28726.1 GeneID:399549 MGI:2687364
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 product : histocompatibility 2, M region locus 10.6 protein_id : NP_963905.1

name	Trim26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:128485541 GeneID:22670 MGI:1337056
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; tripartite motif protein TRIM26; zinc finger protein 173 product : tripartite motif protein 26 isoform a protein_id : NP_001020770.2

name	Trim15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66571295 GeneID:69097 MGI:1916347
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : tripartite motif protein 15 protein_id : NP_001019305.1

name	Trim10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755340 GeneID:19824 MGI:1338757
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ring finger protein 9 product : tripartite motif protein 10 protein_id : NP_035410.1

name	Trim40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794619 CCDS:CCDS28727.1 GeneID:195359 MGI:2684881
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : ring finger RNF35 product : tripartite motif-containing 40 protein_id : NP_001028407.1

name	Trim31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122567 CCDS:CCDS28728.1 GeneID:224762 MGI:2385051
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : tripartite motif-containing 31 protein_id : NP_666189.1

name	Ppp1r11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18390327 CCDS:CCDS28729.1 GeneID:76497 MGI:1923747
definition	GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence IEA] [Evidence IDA] codon_start : 1 note : t-complex testis-expressed 5 product : protein phosphatase 1, regulatory (inhibitor) subunit 11 protein_id : NP_083908.1

name	Znrd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963545 CCDS:CCDS28730.1 GeneID:66136 MGI:1913386
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : nuclear RNA polymerase I small specific subunit protein_id : NP_075651.1

name	1700022C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095009 CCDS:CCDS28731.1 GeneID:76416 MGI:1923666
definition	codon_start : 1 product : hypothetical protein LOC76416 protein_id : NP_083878.1

name	2410137M14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746171 GeneID:76797 MGI:1924047
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : novel Immunoglobulin C1 type protein (2410137M14Rik) product : hypothetical protein LOC76797 protein_id : NP_084023.1

name	D130003B22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268698 GeneID:240095 MGI:3036265
definition	codon_start : 1 product : hypothetical protein LOC240095 protein_id : XP_998597.2

name	Zfp57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000700 CCDS:CCDS28733.1 GeneID:22715 MGI:99204
definition	GO_component : GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 product : zinc finger protein 57 protein_id : NP_001013767.1

name	Zfp57 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328161 CCDS:CCDS28733.1 GeneID:22715 MGI:99204
definition	GO_component : GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 product : zinc finger protein 57 protein_id : NP_033585.2

name	Mog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199771 CCDS:CCDS28734.1 GeneID:17441 MGI:97435
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : myelin oligodendrocyte glycoprotein protein_id : NP_034944.2

name	Gabbr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131888529 GeneID:54393 MGI:1860139
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004965 - GABA-B receptor activity [Evidence IEA]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GABA-BR1b receptor; bM573K1.1.1 (gamma-aminobutyric acid (GABA) B receptor, 1a) product : gamma-aminobutyric acid (GABA-B) receptor, 1 protein_id : NP_062312.3

name	Olfr90 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238946 CCDS:CCDS28735.1 GeneID:258469 MGI:2177473
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1526227-1525295; olfactory receptor MOR256-21 product : olfactory receptor 90 protein_id : NP_666688.1

name	Olfr91 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238944 GeneID:258470 MGI:2177474
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1533927-1532989; olfactory receptor MOR256-20; bM573K1.3 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) protein); G-protein coupled receptor product : olfactory receptor 91 protein_id : NP_874373.1

name	Olfr92 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238934 GeneID:258448 MGI:2177475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PSCP-1552066-1551128; olfactory receptor MOR256-29 product : olfactory receptor 92 protein_id : NP_666667.1

name	EG224763 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268700 GeneID:224763 MGI:3644619
definition	codon_start : 1 product : similar to bM573K1.5 (novel Ulp1 protease family member) protein_id : XP_139937.3

name	Olfr93 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801392 CCDS:CCDS28736.1 GeneID:258051 MGI:2177476
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1592036-1591098; olfactory receptor MOR256-39P product : olfactory receptor 93 protein_id : NP_001011813.1

name	Ubd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963519 CCDS:CCDS28737.1 GeneID:24108 MGI:1344410
definition	GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : Diubiquitin product : ubiquitin D protein_id : NP_075626.1

name	Olfr94 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372122 CCDS:CCDS28738.1 GeneID:258219 MGI:2177477
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1637650-1636712; olfactory receptor MOR256-32P product : olfactory receptor 94 protein_id : NP_001011518.1

name	Olfr95 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238910 CCDS:CCDS28739.1 GeneID:258506 MGI:2177478
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1651760-1650822; olfactory receptor MOR263-6 product : olfactory receptor 95 protein_id : NP_666724.1

name	Olfr96 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239320 CCDS:CCDS28740.1 GeneID:258507 MGI:2177479
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1665046-1665987; olfactory receptor MOR121-1 product : olfactory receptor 96 protein_id : NP_666725.1

name	Olfr97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239264 CCDS:CCDS28741.1 GeneID:258505 MGI:2177480
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1672287-1671355; olfactory receptor MOR156-2 product : olfactory receptor 97 protein_id : NP_666723.1

name	Olfr98 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239260 CCDS:CCDS28742.1 GeneID:258503 MGI:2177481
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1703582-1702653; olfactory receptor MOR156-4 product : olfactory receptor 98 protein_id : NP_666721.1

name	H2-M3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305129 GeneID:14991 MGI:95915
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : MHC class I-b antigen M3 product : histocompatibility 2, M region locus 3 protein_id : NP_038847.1

name	Olfr99 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239262 CCDS:CCDS28743.1 GeneID:258508 MGI:2177482
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1720261-1719344; olfactory receptor MOR156-1 product : olfactory receptor 99 protein_id : NP_666726.1

name	Olfr101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129195 CCDS:CCDS28744.1 GeneID:258831 MGI:2177484
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1761617-1760691; olfactory receptor MOR250-2 product : olfactory receptor 101 protein_id : NP_667045.1

name	Olfr102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801500 CCDS:CCDS28745.1 GeneID:258218 MGI:2177485
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1775063-1774137; olfactory receptor MOR250-4 product : olfactory receptor 102 protein_id : NP_001011721.1

name	Olfr103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129193 CCDS:CCDS28746.1 GeneID:258830 MGI:2177486
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1798423-1797482; olfactory receptor MOR250-3 product : olfactory receptor 103 protein_id : NP_667044.1

name	Olfr104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801336 CCDS:CCDS28747.1 GeneID:257948 MGI:2177487
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1823235-1824161; olfactory receptor MOR250-5 product : olfactory receptor 104 protein_id : NP_001011783.1

name	Olfr105 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801282 CCDS:CCDS28748.1 GeneID:257893 MGI:2177488
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1843460-1844386; olfactory receptor MOR250-7 product : olfactory receptor 105 protein_id : NP_001011744.1

name	Olfr106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801312 CCDS:CCDS28749.1 GeneID:257925 MGI:2177489
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1855511-1856437; olfactory receptor MOR250-6 product : olfactory receptor 106 protein_id : NP_001011764.1

name	Olfr107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239258 CCDS:CCDS28750.1 GeneID:258504 MGI:2177490
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1867165-1868094; olfactory receptor MOR156-3 product : olfactory receptor 107 protein_id : NP_666722.1

name	Olfr108 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239254 CCDS:CCDS28751.1 GeneID:258457 MGI:2177491
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1893605-1894534; olfactory receptor MOR156-5 product : olfactory receptor 108 protein_id : NP_666676.1

name	Olfr109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129189 CCDS:CCDS28752.1 GeneID:258832 MGI:2177492
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1914078-1915022; olfactory receptor MOR250-1 product : olfactory receptor 109 protein_id : NP_667046.1

name	H2-M2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47887011 CCDS:CCDS28753.1 GeneID:14990 MGI:95914
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : histocompatibility 2, M region locus 2 protein_id : NP_032230.1

name	Olfr110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129643 CCDS:CCDS28754.1 GeneID:258325 MGI:2177493
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-1956307-1957260; olfactory receptor MOR249-2 product : olfactory receptor 110 protein_id : NP_666440.1

name	Olfr111 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794758 CCDS:CCDS28755.1 GeneID:545205 MGI:2177494
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-1989071-1990024; olfactory receptor MOR249-1P product : olfactory receptor 111 protein_id : NP_001005485.1

name	Olfr112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73663902 CCDS:CCDS28756.1 GeneID:258096 MGI:2177495
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2023769-2022807 product : olfactory receptor 112 protein_id : NP_001013593.2

name	Olfr113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129711 GeneID:258286 MGI:2177496
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2034880-2033942; olfactory receptor MOR218-9 product : olfactory receptor 113 protein_id : NP_666401.1

name	Olfr114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129715 CCDS:CCDS28757.1 GeneID:258284 MGI:2177497
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2049802-2048870; olfactory receptor MOR218-10 product : olfactory receptor 114 protein_id : NP_666399.1

name	Olfr115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801294 GeneID:257908 MGI:2177498
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-2070203-2069271; olfactory receptor MOR218-11P product : olfactory receptor 115 protein_id : NP_001011753.1

name	Olfr116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239076 CCDS:CCDS28758.1 GeneID:258625 MGI:2177499
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2084102-2083137; olfactory receptor MOR218-2 product : olfactory receptor 116 protein_id : NP_666843.1

name	Olfr117 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46391063 CCDS:CCDS28759.1 GeneID:258263 MGI:2177500
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-2119438-2118485; olfactory receptor MOR256-33 product : olfactory receptor 117 protein_id : NP_997038.1

name	Olfr118 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47523372 CCDS:CCDS28760.1 GeneID:404308 MGI:2177501
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-2131124-2132089; GA_x5J8B7TYMFE-883-533; GA_x5J8B7TVMCU-697-290 product : olfactory receptor 118 protein_id : NP_998886.1

name	Olfr119 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801424 CCDS:CCDS28761.1 GeneID:258095 MGI:2177502
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-2159633-2160598; olfactory receptor MOR263-7 product : olfactory receptor 119 protein_id : NP_001011830.1

name	Olfr120 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238908 CCDS:CCDS28762.1 GeneID:258624 MGI:2177503
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2184981-2185946; olfactory receptor MOR263-3 product : olfactory receptor 120 protein_id : NP_666842.1

name	Olfr121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593002 CCDS:CCDS28763.1 GeneID:258622 MGI:2177504
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2211113-2212078; olfactory receptor MOR263-4 product : olfactory receptor 121 protein_id : NP_666840.2

name	Olfr122 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953213 CCDS:CCDS28764.1 GeneID:258285 MGI:2177505
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2230932-2231897; olfactory receptor MOR263-10 product : olfactory receptor 122 protein_id : NP_666400.2

name	Olfr123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238930 CCDS:CCDS28765.1 GeneID:258623 MGI:2177506
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2255106-2256035; olfactory receptor MOR256-9 product : olfactory receptor 123 protein_id : NP_666841.1

name	Olfr124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128831 CCDS:CCDS28766.1 GeneID:259064 MGI:2177507
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2264806-2265753; olfactory receptor MOR256-3 product : olfactory receptor 124 protein_id : NP_667273.1

name	Olfr125 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129705 CCDS:CCDS28767.1 GeneID:258287 MGI:2177508
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PSCP-2291580-2292542; olfactory receptor MOR218-8 product : olfactory receptor 125 protein_id : NP_666402.1

name	Olfr126 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129107 CCDS:CCDS28768.1 GeneID:258892 MGI:2177509
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2307164-2308123; olfactory receptor MOR218-1 product : olfactory receptor 126 protein_id : NP_667101.1

name	Olfr127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129547 CCDS:CCDS28769.1 GeneID:258374 MGI:2177510
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2354126-2355093; olfactory receptor MOR218-7 product : olfactory receptor 127 protein_id : NP_666489.1

name	Olfr128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45592940 CCDS:CCDS28770.1 GeneID:383243 MGI:2177511
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : olfactory receptor 128 protein_id : NP_996552.1

name	Olfr761 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801422 CCDS:CCDS28771.1 GeneID:258094 MGI:3030595
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2403971-2403000; olfactory receptor MOR218-5P product : olfactory receptor 761 protein_id : NP_001011829.1

name	Olfr129 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129640 CCDS:CCDS28772.1 GeneID:258324 MGI:2177512
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2503741-2502776; olfactory receptor MOR263-9 product : olfactory receptor 129 protein_id : NP_666439.1

name	Olfr130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238950 CCDS:CCDS28773.1 GeneID:258480 MGI:2177513
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2515350-2516303; olfactory receptor MOR256-19 product : olfactory receptor 130 protein_id : NP_666698.1

name	Olfr131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129143 CCDS:CCDS28774.1 GeneID:258867 MGI:2177514
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2531299-2530355; olfactory receptor MOR256-4 product : olfactory receptor 131 protein_id : NP_667078.1

name	Olfr132 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828686 CCDS:CCDS28775.1 GeneID:257889 MGI:2177515
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2579687-2578746; olfactory receptor MOR256-49 product : olfactory receptor 132 protein_id : NP_001005481.1

name	Olfr133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129197 CCDS:CCDS28776.1 GeneID:258828 MGI:2177516
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2597192-2598130; olfactory receptor MOR256-6 product : olfactory receptor 133 protein_id : NP_667042.1

name	Olfr134 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129199 CCDS:CCDS28777.1 GeneID:258829 MGI:2177517
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2623613-2624551; olfactory receptor MOR256-5 product : olfactory receptor 134 protein_id : NP_667043.1

name	Olfr135 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129630 CCDS:CCDS28778.1 GeneID:258329 MGI:2177518
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2656648-2657586; olfactory receptor MOR256-48 product : olfactory receptor 135 protein_id : NP_666444.1

name	Olfr138 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828663 CCDS:CCDS28779.1 GeneID:170648 MGI:2177521
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2718585-2719523; olfactory receptor 89 product : olfactory receptor 138 protein_id : NP_570938.1

name	Olfr137 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238948 CCDS:CCDS28780.1 GeneID:258481 MGI:2177520
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2749525-2748587; olfactory receptor MOR256-18 product : olfactory receptor 137 protein_id : NP_666699.1

name	Olfr136 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129245 CCDS:CCDS28781.1 GeneID:258803 MGI:2177519
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PSCP-2779375-2780313; olfactory receptor MOR256-7 product : olfactory receptor 136 protein_id : NP_667018.1

name	LOC100043164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043164
definition	number : 1 pseudo : _no_value

name	LOC100043164 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043164
definition	number : 2 pseudo : _no_value

name	LOC630355 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630355
definition	number : 1 pseudo : _no_value

name	LOC630355 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:630355
definition	number : 2 pseudo : _no_value

name	LOC672822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672822
definition	number : 3 pseudo : _no_value

name	LOC672822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672822
definition	number : 2 pseudo : _no_value

name	LOC672822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672822
definition	number : 1 pseudo : _no_value

name	LOC100043265 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043265
definition	number : 1 pseudo : _no_value

name	LOC626985 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626985
definition	number : 1 pseudo : _no_value

name	H2-M6-ps (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : H-2M6; H2-M6 note : contains intron 3, exon 4, intron 4 pseudo : _no_value

name	LOC667973 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268825 GeneID:667973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : hypothetical LOC667973 pseudo : _no_value transcript_id : XR_034941.1

clone name	MSMg01-448A21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-113K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480K14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-422H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-445F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-482D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-111B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315D04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-188O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413G10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-388K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099M22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-144C03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-397C06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-323I02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-519L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-509N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404I15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-367H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-292O08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-141D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479F17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424L19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-351J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059P04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-491J22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-206E14
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-179P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168B10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-215H02.b	B6Ng01-215H02.g
ACC	GA032410	GA032411
length	1,204	971
definition	B6Ng01-215H02.b	B6Ng01-215H02.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcctaagaggaaaactcatagctctgagtgccgccaaaaagaagct agagagagtatacaccagcagcttgacagcacacttaaaagctcaatcaa aagaaagcaaattcacccaagaggtgtagacagcaggaaataatcaaact tagggctgaaatcaaccaagtggaaacaaaaagaactatacaaagaatca accaaccccggagctgtttttcttttgagaaaatcaacaagatagataaa accttagccaaactaactagagggcacaggaacagtatggtaattaacaa aatcagaaataaaaaaggagacataacaacagaacatgaggaaatccaaa acatcatcagatcctactacaaaaggctatactcaacaaaactggaaacc ttggatgcaatggacaattttgtagacagataccaggtaccatagttaaa tcaggatcagattaacaatctaaacaggcccatttcccctaaagaaataa aagctgtcattaatcatctccctaccaaaagaatatcccaggaccagatg ggtttagtgcagagttctatcagaccttcagagaagacctatttgcaata ctcctcaaactattccacaaaataaaaagagaaggtactctacccaattc attctatgaagccacattactctgatacctaaaccacaaaaagacccaac aaagaaagagaacttcagaccaatttcccttatgaacatccatgcaaaaa taataaaattctcacaaaccgaatccaagaacacatcaaaatgatcatcc aacatgatcaagtaggcttcatcccagggatgcacggatggtttaatata tggaaatctatcaacgcaatccagtatataaacaaacgcaaagacaaacc cacatgatcatctcattagatgatgagaaaccatttgacaaaattcaaca cccattcatgataaaaagtcttggaaagatcagaattcaaggctcatatc taaacataataaaagcaatatgcagccaacagttagtcacattcaaggta aatgggaggagagctgtagcatccacttaaaattcagggactagacaggc tgcccacttcctcttacctatccataagaacctgagcttatttgcgaatt gtgggattcttgccttaacttatgggagggaaactagagagcactatgag ctgg	gaattcaaagtacttttttagtttacagatgatattatttgacatataaa atgctctgaaacttctaccagaaaactcctacaggtaataaacattcctc caaggagcaggatgtaaaattattacacaaacaatagtaactttctctat acagatggcagatatactgagaaagaaatcatgaaaaataccattcacaa tagtccttaaactattatggaataaatctaaaaagtgatatatttttaca gtgaaaaatttaagacacagaggaaaaaaatgaagaaactaccagaagat gaaaagaccttatttcatattctgaaaaagccattctatcaaaagcaatc tccagatttaatgcaatttcaatcaagtatgtctttatacaaatctagca tatatattttgtgtttgctgttttcacagtttgcatacatattttatttc atgtaatgggtcaataaatattttatattgttttacatctatattttgct ttcctctttaaaccactctgctgaaatagtttattcagtttgttcttttt gattagttatattatctaaatttcttcttacagatataaagtcagaatta tcagtaaggatgactcaaagaaataatgaccaaatccaattttagcagcc caatatgttttcagattaccaggctttctctgaccatctttagctggact aaaactcttttttctggccacctcggtcattgacattgtgatgctgacac agaacacaatgatcatacttgtgtcattttttaaactccagacttccaaa acaccccatgtacttctttccttctccaattttttttcctagatttttgt ttttatgacaaaatgtttctttagaatagtctagactttccaaagggccc aagagaaagaatcactccatggctgtgcaatccatgtctaacatttggtt ctgtggactgggacttcacaa
quality values	Open. Hide. 58 38 20 32 58 54 58 52 54 45 38 58 58 49 23 46 62 62 51 54 47 42 62 54 62 62 62 62 54 62 14 14 10 7 8 10 6 8 6 9 11 10 10 11 13 62 43 44 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 56 22 34 16 23 27 18 23 25 21 23 23 25 23 18 34 34 50 54 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 59 49 49 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 38 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 47 54 54 62 58 58 58 58 58 58 58 54 54 58 58 58 58 54 52 58 52 58 58 58 58 58 58 58 54 52 58 46 58 58 58 58 52 49 54 54 58 58 42 54 31 58 58 54 54 58 58 58 58 54 54 54 58 58 58 58 58 58 54 58 58 58 54 54 54 58 58 58 49 50 53 51 58 58 58 53 58 58 58 58 58 52 58 52 58 58 34 38 27 51 48 58 54 58 50 47 58 45 26 58 54 58 51 49 36 51 58 54 58 51 58 58 58 47 46 49 46 52 50 51 39 41 48 58 58 58 58 58 52 40 48 58 51 58 58 58 48 54 49 50 50 44 58 58 58 50 41 29 54 44 35 50 51 40 50 54 50 58 58 50 51 58 38 58 40 39 58 58 53 34 39 46 22 47 29 44 50 54 52 40 34 44 53 39 40 40 49 54 40 44 30 39 33 49 32 53 53 49 40 54 54 54 51 49 45 52 52 52 54 54 35 31 33 45 53 40 37 52 45 51 49 44 54 44 54 47 52 37 53 26 49 39 51 42 37 38 44 37 53 37 29 54 54 51 42 53 41 32 40 34 41 33 41 32 46 34 31 34 45 41 29 32 32 52 40 45 39 16 35 29 41 33 31 22 39 31 40 29 31 43 52 46 27 29 31 26 13 18 31 46 29 32 31 33 28 51 31 26 24 22 31 42 35 31 30 46 32 47 30 34 34 31 24 31 31 29 22 32 31 31 25 21 31 31 24 24 31 15 30 43 28 27 29 46 29 32 18 46 28 28 26 42 21 46 32 34 31 26 31 46 22 16 37 33 19 22 20 31 37 33 32 34 26 30 26 38 32 25 22 31 33 20 38 32 33 33 33 30 28 15 31 46 26 19 22 24 31 48 33 31 31 21 13 44 47 30 25 26 29 17 26 31 16 12 10 8 10 21 32 23 16 26 33 34 24 18 48 44 44 32 21 23 33 32 24 32 33 22 48 32 26 26 28 31 31 9 16 10 5 22 23 12 7 18 15 9 23 21 15 32 21 27 32 19 25 33 7 20 10 32 14 32 32 33 39 43 28 31 32 25 9 13 9 6 11 28 7 5 6 9 8 10 4 3 11 13 9 11 16 20 15 20 4 9 24 20 11 19 25 6 13 22 16 30 18 17 16 13 6 6 7 6 8 5 14 5 14 18 8 3 3 18 9 7 6 15 25 6 19 7 20 12 38 28 17 7 5 6 12 17 28 16 10 10 11 13 6 7 6 22 9 15 13 10 8 16 25 8 10 3 5 1 5 4 3 4 2 4 4 6 15 12 7 20 5 5 18 5 7 5 6 10 25 5 5 24 8 13 5 19 4 8 27 8 12 5 6 3 1 8 6 11 3 2 1 5 17 3 5 3 6 8 4 8 7 6 4 17 7 6 3 1 5 22 12 7 17 11 5 7 21 11 4 6 20 5 6 4 16 3 4 3 6 6 21 4 5 5 6 9 6 4 2 2 2 6 3	Open. Hide. 62 47 51 47 62 51 42 32 22 20 9 10 22 12 18 17 22 13 11 18 13 13 18 17 27 44 49 59 62 62 62 59 62 62 62 59 59 62 62 54 62 59 59 59 62 59 59 59 62 62 54 54 54 33 28 36 34 34 28 28 25 34 38 28 28 29 39 36 46 49 43 54 54 54 54 62 62 62 59 59 59 59 49 48 62 59 56 62 56 59 59 54 48 50 46 54 54 62 62 62 59 59 62 54 54 54 48 59 56 48 62 54 59 62 59 59 59 59 59 62 62 62 62 62 62 62 59 59 59 59 62 62 59 62 54 62 56 54 56 59 62 59 62 54 54 59 62 59 62 59 59 62 59 59 62 62 62 62 59 62 51 62 59 56 59 56 62 59 62 54 54 59 62 62 59 62 59 62 59 62 56 59 62 62 59 59 62 62 59 59 59 59 59 59 59 59 62 62 62 54 56 62 50 50 54 59 59 46 59 56 56 59 62 62 62 49 59 59 59 56 56 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 59 59 59 59 59 59 62 62 62 62 62 62 62 62 59 56 54 50 62 51 49 59 49 43 54 59 62 59 59 62 62 62 54 59 59 62 62 59 39 62 56 56 59 56 51 59 50 50 43 62 59 50 62 59 56 62 62 62 62 59 62 59 59 59 59 59 59 48 38 31 36 56 59 56 48 62 62 62 62 62 54 54 56 56 59 59 59 56 59 56 50 48 56 51 43 43 48 48 46 49 46 56 59 62 62 59 59 59 56 62 59 62 62 62 62 62 62 50 49 46 56 59 62 62 59 59 59 59 56 59 59 62 62 59 62 62 62 59 59 59 46 56 59 59 56 59 59 59 62 62 62 59 56 59 59 59 59 49 59 59 62 59 62 62 62 59 62 62 59 56 62 59 59 62 56 59 59 46 62 59 62 62 59 59 62 54 62 59 59 62 59 59 51 62 62 62 62 62 62 62 62 62 59 59 49 59 62 51 51 59 46 62 59 62 59 59 59 59 59 59 62 62 59 62 59 24 18 17 25 21 18 21 23 43 56 59 56 59 59 59 49 59 59 54 48 56 59 59 59 59 59 62 56 59 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 49 43 35 23 46 43 54 59 62 62 62 54 59 59 49 59 49 62 59 59 62 30 25 16 23 34 51 59 59 59 62 62 62 62 62 62 62 56 59 59 39 34 51 45 51 51 51 56 46 56 46 38 46 56 59 59 59 59 59 50 46 59 45 44 46 59 39 43 59 24 24 19 18 28 30 43 20 36 30 24 59 26 17 19 18 18 17 21 16 14 19 29 24 50 44 39 35 44 34 41 41 30 18 37 24 45 39 38 36 26 38 45 51 51 37 38 35 38 44 44 24 10 7 11 22 30 38 51 51 11 24 20 10 25 32 39 24 28 39 30 56 45 35 51 32 51 51 51 35 62 29 42 51 42 44 50 31 56 21 27 24 14 24 20 31 56 21 24 7 6 10 18 51 62 56 26 26 22 13 38 42 51 42 17 18 15 42 51 18 24 47 56 42 56 62 56 56 16 50 39 38 47 22 50 39 39 37 32 14 11 10 9 16 10 24 27 56 56 25 39 37 38 47 17 32 47 42 34 21 47 38 26 12 20 26 12 9 41 24 23 22 27 23 52 23 31 27 42 34 31 35 34 28 21 19 39 34 35 18 10 11 18 26 28 18 18 14 16 18 12 14 10 15 13 10 10 31 14 14 14 13 17 21 17 34 9 17 13 20 32 32 20 18 24 33 17 13 26 32 42 23 11 23 12 11 17 14 8 10 15 12 8 8 15 19 33 54 9 9 8 9 14 8 29 21 25 7 33 25 20 20 9 9 19 10 35 17 13 18 13 9 13 17 9 16 11 14 10 15 27 13 13 16 22 25 52 18 33 11 11 19 13 12 11 18 25 14 22 12 23 11 30 32 26 26 27 15 37 22 7 20 29 7 25 25 8 11 9 16 7 25 34 10 12 32 13 7 12 10 13 17 15 10 18 15 24 10 18 27 31 20 21 13 25 23 12 7 33 19 39 26 12 16 16 8 10 6 6 15 24 16 23 22 34 24 10 22 16 18 18 10 11 13 7 39 18 18 16 10 6 16 13 9 12 18 19

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_37916567_37917512
seq2: B6Ng01-215H02.g_66_1036 (reverse)

seq1  TTGTGAAGT-CCAGT-CACAGAAC--AATG-TAGACATGGATTGCACAG-  44
      ||||||||| ||||| ||||||||  |||| |||||||||||||||||| 
seq2  TTGTGAAGTCCCAGTCCACAGAACCAAATGTTAGACATGGATTGCACAGC  50

seq1  CAT-GAGTGAT--CTTCTCT--GGGCCTTTGG-AAGTCTAGACTA-TCTA  87
      ||| |||||||   ||||||  || ||||||| |||||||||||| ||||
seq2  CATGGAGTGATTCTTTCTCTTGGGCCCTTTGGAAAGTCTAGACTATTCTA  100

seq1  AAG-AACA-TTTGTCAT-AAAACATAAATCTAGGAAGAAAAAATTGGAGA  134
      ||| |||| |||||||| |||||| ||||||||||| |||||||||||||
seq2  AAGAAACATTTTGTCATAAAAACAAAAATCTAGGAA-AAAAAATTGGAGA  149

seq1  --GGAAGAAGTACAT-GGGTGTTT--GGAGTCTGGAGTTT-AAAAATGAC  178
        | ||||||||||| ||||||||  | |||||||||||| |||||||||
seq2  AGGAAAGAAGTACATGGGGTGTTTTGGAAGTCTGGAGTTTAAAAAATGAC  199

seq1  ACAAGTATGATCATTGTGTTCTGTGTCAGCATCACAATGTCAATGACCGA  228
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTATGATCATTGTGTTCTGTGTCAGCATCACAATGTCAATGACCGA  249

seq1  GGTGGCCAG-AAAAAGAG-TTTAGTCCAGCTAAAGATGGTCAGAG-AAGC  275
      ||||||||| |||||||| |||||||||||||||||||||||||| ||||
seq2  GGTGGCCAGAAAAAAGAGTTTTAGTCCAGCTAAAGATGGTCAGAGAAAGC  299

seq1  CTGGTAATCTG-AAACATATTGGGCTGCTAAAATTGGATTTGGTCATTAT  324
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  CTGGTAATCTGAAAACATATTGGGCTGCTAAAATTGGATTTGGTCATTAT  349

seq1  TTCTTTGAGTCATCCTTACTGATAATTCTGACTTTATATCTGTAAGAAGA  374
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTGAGTCATCCTTACTGATAATTCTGACTTTATATCTGTAAGAAGA  399

seq1  AATTTAGATAATATAACTAATCAAAAAGAACAAACTGAATAAACTATTTC  424
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTAGATAATATAACTAATCAAAAAGAACAAACTGAATAAACTATTTC  449

seq1  AGCAGAGTGGTTTAAAGAGGAAAGCAAAATATAGATGTAAAACAATATAA  474
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGAGTGGTTTAAAGAGGAAAGCAAAATATAGATGTAAAACAATATAA  499

seq1  AATATTTATTGACCCATTACATGAAATAAAATATGTATGCAAACTGTGAA  524
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATTTATTGACCCATTACATGAAATAAAATATGTATGCAAACTGTGAA  549

seq1  AACAGCAAACACAAAATATATATGCTAGATTTGTATAAAGACATACTTGA  574
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGCAAACACAAAATATATATGCTAGATTTGTATAAAGACATACTTGA  599

seq1  TTGAAATTGCATTAAATCTGGAGATTGCTTTTGATAGAATGGCTTTTTCA  624
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAATTGCATTAAATCTGGAGATTGCTTTTGATAGAATGGCTTTTTCA  649

seq1  GAATATGAAATAAGGTCTTTTCATCTTCTGGTAGTTTCTTCATTTTTTTC  674
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATATGAAATAAGGTCTTTTCATCTTCTGGTAGTTTCTTCATTTTTTTC  699

seq1  CTCTGTGTCTTAAATTTTTCACTGTAAAAATATATCACTTTTTAGATTTA  724
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTGTCTTAAATTTTTCACTGTAAAAATATATCACTTTTTAGATTTA  749

seq1  TTCCATAATAGTTTAAGGACTATTGTGAATGGTATTTTTCATGATTTCTT  774
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCATAATAGTTTAAGGACTATTGTGAATGGTATTTTTCATGATTTCTT  799

seq1  TCTCAGTATATCTGCCATCTGTATAGAGAAAGTTACTATTGTTTGTGTAA  824
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCAGTATATCTGCCATCTGTATAGAGAAAGTTACTATTGTTTGTGTAA  849

seq1  TAATTTTACATCCTGCTCCTTGGAGGAATGTTTATTACCTGTAGGAGTTT  874
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTTACATCCTGCTCCTTGGAGGAATGTTTATTACCTGTAGGAGTTT  899

seq1  TCTGGTAGAAGTTTCAGAGCATTTTATATGTCAAATAATATCATCTGTAA  924
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGTAGAAGTTTCAGAGCATTTTATATGTCAAATAATATCATCTGTAA  949

seq1  ATTAAAAAAGTACTTTGAATTC  946
      | ||||||||||||||||||||
seq2  ACTAAAAAAGTACTTTGAATTC  971

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information