MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-220I07
Chromosome	17 (Build37)
Map Location	65,799,393 - 65,901,881
singlet/doublet	doublet
Overlap gene	E130009J12Rik
Upstream gene	LOC100043582, Man2a1, 4930583I09Rik, LOC100043871, LOC668655
Downstream gene	LOC674701, Vapa, Txndc2, Rab31, Ppp4r1, Ralbp1, LOC100043873, LOC100043592, Twsg1, Ankrd12, 5430411C19Rik, Ndufv2, ORF19, Ddx11, LOC100043599, LOC100043875, 1110012J17Rik, LOC100043876, Rab12
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043582 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043582
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Man2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17158 MGI:104669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930583I09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78057 MGI:1925307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100043871 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043871
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	E130009J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381107 MGI:2685786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC674701 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Vapa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30960 MGI:1353561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txndc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213272 MGI:2389312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106572 MGI:1914603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp4r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70351 MGI:1917601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ralbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19765 MGI:108466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043873 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100043592 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043592
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Twsg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65960 MGI:2137520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106585 MGI:1914357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430411C19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71331 MGI:1918581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Ndufv2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72900 MGI:1920150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ORF19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68767 MGI:1916017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ddx11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320209 MGI:2443590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043599 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043875 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	1110012J17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68617 MGI:1915867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043876 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 593 ESTs, 8 Proteins

name	Rab12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19328 MGI:894284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043582 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268780 GeneID:100043582
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043582 transcript_id : XM_001480456.1

name	Man2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678789 GeneID:17158 MGI:104669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase 2, alpha 1 transcript_id : NM_008549.1

name	4930583I09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94402107 GeneID:78057 MGI:1925307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930583I09 gene transcript_id : XM_128729.3

name	E130009J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374161 GeneID:381107 MGI:2685786
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130009J12 gene transcript_id : NM_001008973.2

name	LOC674701 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268782 GeneID:674701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) transcript_id : XM_001480470.1

name	Vapa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980695 GeneID:30960 MGI:1353561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle-associated membrane protein, associated protein A transcript_id : NM_013933.2

name	Txndc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943823 GeneID:213272 MGI:2389312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 2 (spermatozoa) transcript_id : NM_153519.1

name	Rab31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526849 GeneID:106572 MGI:1914603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB31, member RAS oncogene family transcript_id : NM_133685.1

name	Ppp4r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164781 GeneID:70351 MGI:1917601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 4, regulatory subunit 1 transcript_id : NM_146081.1

name	Ralbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375674 GeneID:19765 MGI:108466
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ralA binding protein 1 transcript_id : NM_009067.2

name	LOC100043873 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268890 GeneID:100043873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043873 transcript_id : XM_001481169.1

name	LOC100043592 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268784 GeneID:100043592
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to Ubtf protein transcript_id : XM_001480486.1

name	Twsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802034 GeneID:65960 MGI:2137520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : twisted gastrulation homolog 1 (Drosophila) transcript_id : NM_023053.2

name	Ankrd12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71834682 GeneID:106585 MGI:1914357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 12 transcript_id : NM_001025572.1

name	5430411C19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268787 GeneID:71331 MGI:1918581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 5430411C19 gene transcript_id : XM_001480495.1

name	Ndufv2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367926 GeneID:72900 MGI:1920150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) flavoprotein 2 transcript_id : NM_028388.2

name	ORF19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649759 GeneID:68767 MGI:1916017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 19 transcript_id : NM_026833.1

name	ORF19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649761 GeneID:68767 MGI:1916017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 19 transcript_id : NM_001037757.1

name	Ddx11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491861 GeneID:320209 MGI:2443590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) transcript_id : NM_001003919.1

name	LOC100043875 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268892 GeneID:100043875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043875 transcript_id : XM_001481170.1

name	1110012J17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40217637 GeneID:68617 MGI:1915867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012J17 gene transcript_id : NM_172963.3

name	LOC100043876 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268894 GeneID:100043876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 593 ESTs, 8 Proteins product : similar to ribosomal protein L34 transcript_id : XM_001481172.1

name	Rab12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:106507167 GeneID:19328 MGI:894284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB12, member RAS oncogene family transcript_id : NM_024448.2

name	LOC100043582 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268781 GeneID:100043582
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480506.1

name	Man2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678790 CCDS:CCDS28938.1 GeneID:17158 MGI:104669
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004559 - alpha-mannosidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0015923 - mannosidase activity [Evidence IEA]; GO:0004572 - mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006013 - mannose metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mannosidase 2, alpha 1 protein_id : NP_032575.1

name	4930583I09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20900722 GeneID:78057 MGI:1925307
definition	codon_start : 1 product : hypothetical protein LOC78057 protein_id : XP_128729.1

name	E130009J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374162 CCDS:CCDS28940.1 GeneID:381107 MGI:2685786
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC381107 protein_id : NP_001008973.2

name	LOC674701 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268783 GeneID:674701
definition	codon_start : 1 product : similar to protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) protein_id : XP_001480520.1

name	Vapa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94721328 GeneID:30960 MGI:1353561
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005874 - microtubule [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : vesicle-associated membrane protein, associated protein A (33 kDa); synaptobrevin-associated protein of 33kDa product : vesicle-associated membrane protein, associated protein A protein_id : NP_038961.2

name	Txndc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943824 GeneID:213272 MGI:2389312
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0030508 - thiol-disulfide exchange intermediate activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006467 - protein thiol-disulfide exchange [Evidence IDA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : spermatid-specific thioredoxin 1 product : thioredoxin domain containing 2 (spermatozoa) protein_id : NP_705739.1

name	Rab31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526850 GeneID:106572 MGI:1914603
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : Rab31-like protein_id : NP_598446.1

name	Ppp4r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164782 CCDS:CCDS28941.1 GeneID:70351 MGI:1917601
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : protein phosphatase 4, regulatory subunit 1 protein_id : NP_666193.1

name	Ralbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677751 GeneID:19765 MGI:108466
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030675 - Rac GTPase activator activity [Evidence IDA]; GO:0017160 - Ral GTPase binding [Evidence IPI] GO_process : GO:0043089 - positive regulation of Cdc42 GTPase activity [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Ral-interacting protein 1 product : ralA binding protein 1 protein_id : NP_033093.1

name	LOC100043873 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268891 GeneID:100043873
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481219.1

name	LOC100043592 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268785 GeneID:100043592
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480536.1

name	Twsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746428 CCDS:CCDS28942.1 GeneID:65960 MGI:2137520
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030509 - BMP signaling pathway [Evidence IGI]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0009790 - embryonic development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IGI]; GO:0030900 - forebrain development [Evidence IMP] [Evidence IGI]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0001707 - mesoderm formation [Evidence IGI]; GO:0030514 - negative regulation of BMP signaling pathway [Evidence IMP] [Evidence IDA]; GO:0045668 - negative regulation of osteoblast differentiation [Evidence IDA]; GO:0001503 - ossification [Evidence IMP]; GO:0030513 - positive regulation of BMP signaling pathway [Evidence IMP]; GO:0009888 - tissue development [Evidence IGI] codon_start : 1 function : putative modifier of BMP-signalling product : twisted gastrulation homolog 1 protein_id : NP_075540.1

name	Ankrd12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71834683 CCDS:CCDS28943.1 GeneID:106585 MGI:1914357
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ankyrin repeat domain 12 protein_id : NP_001020743.1

name	5430411C19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268788 GeneID:71331 MGI:1918581
definition	codon_start : 1 product : hypothetical protein LOC71331 protein_id : XP_001480545.1

name	Ndufv2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625954 GeneID:72900 MGI:1920150
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051537 - 2 iron, 2 sulfur cluster binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006120 - mitochondrial electron transport, NADH to ubiquinone [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) flavoprotein 2 protein_id : NP_082664.1

name	ORF19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649762 CCDS:CCDS28944.1 GeneID:68767 MGI:1916017
definition	codon_start : 1 product : hypothetical protein LOC68767 protein_id : NP_001032846.1

name	ORF19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649760 CCDS:CCDS28944.1 GeneID:68767 MGI:1916017
definition	codon_start : 1 product : hypothetical protein LOC68767 protein_id : NP_081109.1

name	Ddx11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491862 CCDS:CCDS28945.1 GeneID:320209 MGI:2443590
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004003 - ATP-dependent DNA helicase activity [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016818 - hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae) protein_id : NP_001003919.1

name	LOC100043875 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268893 GeneID:100043875
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481220.1

name	1110012J17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40018622 CCDS:CCDS28946.1 GeneID:68617 MGI:1915867
definition	codon_start : 1 product : hypothetical protein LOC68617 protein_id : NP_766551.2

name	LOC100043876 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268895 GeneID:100043876
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481222.1

name	Rab12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:106507168 GeneID:19328 MGI:894284
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB12, member RAS oncogene family protein_id : NP_077768.2

name	LOC668655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668655
definition	number : 1 pseudo : _no_value

name	LOC668655 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668655
definition	number : 2 pseudo : _no_value

name	LOC100043599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043599
definition	number : 1 pseudo : _no_value

name	LOC100043599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043599
definition	number : 2 pseudo : _no_value

name	LOC100043599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043599
definition	number : 3 pseudo : _no_value

name	LOC100043599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043599
definition	number : 4 pseudo : _no_value

name	LOC100043871 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268889 GeneID:100043871
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical protein LOC100043871 pseudo : _no_value transcript_id : XR_035029.1

clone name	MSMg01-437G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125E23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-304B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353O07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157O20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-467E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207I17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-474I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-220I07.b	B6Ng01-220I07.g
ACC	GA036056	GA036057
length	1,194	1,166
definition	B6Ng01-220I07.b	B6Ng01-220I07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(65,900,665 - 65,901,881)	(65,799,393 - 65,800,557)
sequence	gaattctcctcacaagagtgcactcttggactatgttcatgctccgcagc aagatggcacacccttgcaatcaaaccctgggggaatggagacaggcaga tccttggaacatggaagttggcttgcctaaactaaatttcaagccccagc ccagtgatatgttctcggctcataaaacagcgtagaggacacctgaatag aggcacctgaggttgacctctgtcctcagcgtgtatgggtacacagatgc acccgctcacacacgaacactcttgtacacacagaaaacaaggagaaaac aagtaatttctgcctcctaattacattcaagctgtaactgcaaagtatac ttcggtacattgatccgtgctctgacaatgatctcaaagatgacggggat cagggctgtggctgaagatctgggtgaaggctttgtgtggggcactccaa ggacatttgccaccaaaagcagcactgattgagtcttctccctggcaaca aagtacttcttatccaaacactttacaagatactagaacatcttggactc cgggccaatcagcagattcctaacacaatcctctctttcattccacacac actccctaagcctgttcttgtaggaaccattaaaaaaaataataaaaaaa aaaaaaaaggccgaaggctcggtgtggtggcacacacctttacctccagc cctggggaggtagaagcaggtgggtctatgggagtttgaagccagcctat atagcaggttctagggcaaccagggcgatgtagagagaccctgtctcaaa aaacaaagcaacaagtgggaggctcgtggggctggagaaaaggctcagaa gttaagaacatgtgctgctctggttaagaaccctagtttggttcctcaca tccatgtcaggaggctcacaacagcctgtaattcaagttctaggggatct gagtctccagcctctcaggcatgtgataaaacaacacacacacacacaca caaacaaaacaagccttacacacatcatcacacaatgaagagcttgtgtg gagaagagcagcggttgttggcctggaagcagttcctggtagctttggcc tggggcaagcctccacttgggccatagttgggccatggaagaaaaattct ctagtccaccatcaaaaagccctggcccttttaggattcctgcc	gaattccttgtctctagcacatttcatttaatagagacaaactacacaga gcagccagcaaaccaggacaacagagactgcaacaattcattggtatagc tggtataaaatatgcgcatggcttttgtctttggagatgagactataaag tgtattcttagtcaactgagccgtgattaacatttcgggcactaaggtct cctggagtcactctggatttataggcttgcccttaccagcatttcgtctg aagctgcgttttgtagaagaggaggtgttccagcacttcggtgagctgag gacgattgttctgaacgcaggaccaggcggccacactgtgccagagcagg tggttgacttcgtagcccctcttattcagctgcaaatgattctgaaatga catgattattatggaggctgacctgccaaagacttctttgacttgcacag acttgaaaaatacattttaaaatatacaaatcaaagtgaatattcactca gatttgtagaatcatttaaaagtgtttttaggtatggatagctgaaataa acctagtagctacacaaaatgtttacaagtccctgtgttcaatgtatcta tcagtctacggtaagacagaaacaccaaaacctctgaaggaccactgttg gatgtgctgttcttggactctgtgggtctcccttcttcacaacacctgat caagaggcaactgggaaagttttaacaaactgggctctgaaacctgggtt tctctgcattaacaaccaaataggtgcctcatagagggtggccaatgcct gttaatcacttgggtttctttaactacaaattcagatactatgttttttg tttgtttttcttcaagtattccatgacagcttcattaagtaattgatctg ctgcagtgattagcattccatgacatcatagtactctcagccccacccca cccccacccttgcccctgcctcaaaggttcattggcagttcacaattcca tactgataagaaaacactttacatctgaagggcttcattgtcctcagtat ttaatatgaatattaagagctaaatcctaaagacagtcttcatgttgagt cctctgaaaatgctgaaatccattcaggaatttcaagttaacctctcaag ctccggtaagccgttt
quality values	Open. Hide. 58 36 17 26 58 58 54 58 58 62 41 33 43 33 62 62 49 62 54 54 62 56 47 62 62 62 62 62 62 47 54 62 62 62 62 49 62 44 44 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 54 42 54 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 54 48 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 58 58 58 58 58 58 58 58 45 37 47 46 58 58 58 58 58 58 58 58 54 58 58 45 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 46 58 54 58 58 58 58 52 46 54 58 58 58 47 54 58 58 52 54 38 58 52 58 51 54 58 54 52 54 51 58 54 58 58 58 58 58 51 58 58 54 47 41 58 54 52 49 46 53 58 53 51 52 50 58 58 58 47 47 58 54 51 52 58 58 51 58 40 49 51 58 51 58 53 49 38 45 49 50 50 58 37 58 46 37 58 58 58 58 58 58 53 46 50 58 52 53 58 58 58 58 58 58 58 58 58 58 58 58 58 49 49 51 26 58 35 58 41 13 49 25 53 53 50 36 33 53 50 58 41 39 58 39 39 39 53 42 53 41 51 58 52 54 51 32 44 44 43 35 50 32 42 32 58 41 50 37 14 31 44 39 19 50 26 37 37 36 29 32 53 42 32 54 39 53 54 44 37 45 45 39 52 49 54 35 47 25 29 54 54 35 49 53 20 50 51 31 42 38 45 42 42 52 30 39 34 34 36 41 13 49 30 35 37 45 34 8 54 51 27 33 22 25 47 31 53 52 36 34 25 39 27 42 37 32 14 24 27 34 32 28 23 53 45 30 41 31 40 40 34 32 53 51 47 51 27 27 32 51 34 18 32 28 22 42 21 33 36 29 32 53 26 35 17 32 15 32 34 35 26 43 51 51 51 21 35 29 31 35 17 51 51 51 20 14 15 14 31 35 30 13 46 45 15 31 33 16 46 10 28 19 31 26 31 34 28 28 32 34 34 24 30 25 31 31 32 27 28 24 42 15 42 41 24 41 33 31 35 23 32 48 32 20 24 12 23 26 21 24 26 13 21 18 36 19 29 20 31 31 26 31 8 12 9 25 16 27 15 31 33 30 26 29 13 32 23 23 24 19 30 38 28 20 17 9 16 25 25 13 22 31 27 27 21 14 32 44 38 25 11 14 27 30 18 29 8 28 22 31 15 26 25 16 22 20 24 25 8 20 18 29 22 7 23 32 32 22 19 4 4 4 12 21 11 13 11 4 5 7 10 22 9 13 5 34 8 18 10 24 17 14 5 33 15 18 14 6 5 6 4 5 9 5 4 7 4 9 8 8 19 20 8 16 6 6 6 8 16 12 6 8 5 8 29 17 28 11 15 7 7 11 10 9 15 5 6 5 10 16 7 24 3 5 12 8 6 21 15 8 27 5 19 17 15 5 3 6 27 9 9 14 21 6 13 18 12 14 9 11 1 2 3 3 2 4 12 11 13 14 7 15 4 1 7 7 8 12 13 10 5 10 2 3 4 9 7 8 17 7 5 6 19 6 4 6 7 22 6 5 10 8 4 8 17 3 6 11 4 5 4 6 5 11 20 9 2 5 6 5 12 13 9 22 4 7 25 8 1 1 3 11 8 8 5 2 2 2 2 3 2 4 22 7 7 4 7 4 3 8 9 7 4 7 21 15 12 15 8 10 22 12 6 23 11 15 3 4 6 9 12 5 5 4 15 6 7 10	Open. Hide. 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 54 54 56 62 59 59 62 62 62 59 59 62 49 54 62 62 62 59 62 62 62 59 59 62 62 62 62 59 62 62 62 62 59 62 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 54 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 52 58 58 58 58 54 58 54 58 58 58 54 58 54 58 58 54 58 52 58 58 54 54 58 58 58 52 58 58 58 58 58 58 54 58 58 54 54 58 58 58 58 58 49 58 58 58 58 58 58 58 51 53 41 58 58 58 58 58 58 58 54 58 50 58 58 52 51 50 54 53 58 58 58 46 51 38 58 49 49 50 39 58 58 58 51 58 58 58 58 58 58 58 47 51 50 49 58 58 52 53 58 58 54 51 58 52 52 50 58 51 53 52 50 47 58 32 49 54 53 53 50 53 53 58 58 42 51 41 46 46 37 58 51 39 37 44 51 53 54 51 58 52 39 54 41 30 49 42 41 53 58 52 51 58 50 46 33 58 33 47 49 51 52 38 49 53 53 52 54 42 51 32 53 53 52 54 45 54 54 39 40 41 49 42 39 33 44 44 44 52 53 35 37 40 37 53 53 40 37 54 52 54 41 42 39 36 44 41 54 32 47 31 33 31 36 41 54 54 32 32 54 52 39 31 54 54 40 42 40 39 28 54 40 40 45 44 25 35 40 51 40 40 53 53 53 32 26 52 32 42 53 53 45 53 42 32 28 36 32 41 31 30 41 39 32 32 34 34 33 31 33 23 52 32 34 32 29 52 40 45 25 51 42 31 31 30 30 23 31 31 51 43 24 42 51 30 31 31 31 30 51 31 42 31 46 29 18 30 31 30 31 31 31 38 36 36 51 46 31 48 25 32 31 47 46 27 25 31 36 30 31 19 48 36 31 31 37 31 23 46 29 25 32 31 38 34 37 26 48 46 46 46 31 33 23 46 37 31 13 28 46 39 24 31 30 32 30 26 25 34 32 31 27 41 34 23 24 28 31 31 28 32 26 43 32 32 32 23 25 41 42 37 33 36 32 32 21 25 26 29 26 29 31 36 32 24 31 31 32 21 28 34 36 19 22 33 27 35 34 31 31 16 30 17 31 31 31 25 22 29 18 9 20 24 24 32 26 21 22 21 23 20 22 32 26 43 34 16 16 15 31 22 12 4 5 31 39 39 15 14 19 39 21 23 14 20 24 43 48 38 25 26 18 29 29 25 21 40 21 19 14 24 25 23 39 9 7 11 26 8 18 27 21 16 17 11 6 5 11 28 15 7 16 15 19 27 26 20 25 11 18 13 25 13 15 34 31 11 19 11 19 24 47 28 13 16 20 28 17 19 21 22 21 15 40 21 9 15 15 14 9 15 8 25 6 22 7 13 5 5 3 3 3 10 29 9 16 11 6 7 21 10 14 9 13 16 9 23 9 15 5 25 20 22 11 13 19 8 2 3 5 20 16 28 13 23 23 9 20 20 13 19 5 16 12 7 4 11 11 21 12 18 15 17 24 20 8 6 2 1 2 13 18 11 6 9 8 5 3 2 1 2 4 4 7 9 5 6 11 10 5 5 15 24 4 14 14 6 6 3 2 4 4 3 3 2 6 5 4 6 4 10 7 10 5 16 4 4 12 9 3 7 11 5 6 7 9 6 19 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_65900665_65901881
seq2: B6Ng01-220I07.b_42_1235 (reverse)

seq1  GGCA-GAATCCTAAAA-GGCCAGGCTTTTCTTGTTGGTGGGACAGAGAGA  48
      |||| ||||||||||| |||||||  ||| ||| |||| ||||  |||||
seq2  GGCAGGAATCCTAAAAGGGCCAGGGCTTT-TTGATGGT-GGAC-TAGAGA  47

seq1  ATACTTTTCTTCCATGGCCCCCAACTATGGCCACAAAGTGGAGAGCCTGC  98
      ||  |||||||||||||  ||||||||||||  | |||||||| || |||
seq2  AT--TTTTCTTCCATGG--CCCAACTATGGC--CCAAGTGGAG-GCTTGC  90

seq1  CCCAGGGCCAAAGCTACCAGGAACTCCCTACCAGGCCAACAA-CGCTGCT  147
      |||| ||||||||||||||||||||  || |||||||||||| |||||||
seq2  CCCA-GGCCAAAGCTACCAGGAACT-GCTTCCAGGCCAACAACCGCTGCT  138

seq1  CTTCTTCCACCACAGCTCTTCCATTGGTGGTGATGATGGTGGTGGTGAGG  197
      |||| |||||   ||||||| |||||   |||||||| |||   || |||
seq2  CTTC-TCCACACAAGCTCTT-CATTG--TGTGATGAT-GTG--TGTAAGG  181

seq1  GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGCACATGCC  247
        |||   | ||| ||||||||||||||||||| ||| |   ||||||||
seq2  CTTGT---TTTGTTTGTGTGTGTGTGTGTGTGT-TGTTTTATCACATGCC  227

seq1  TGAGGAGGCTGGAGACTTCAGATCCCCCTAGAACTTGAATTACAGGCTGT  297
      ||| |||||||||||| |||||| ||||||||||||||||||||||||||
seq2  TGA-GAGGCTGGAGAC-TCAGAT-CCCCTAGAACTTGAATTACAGGCTGT  274

seq1  TGTGAGCCTCCTGACATGGATGTGAGGAACCAAACTAGGGTTCTTAACCA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAGCCTCCTGACATGGATGTGAGGAACCAAACTAGGGTTCTTAACCA  324

seq1  GAGCAGCACATGTTCTTAACTTCTGAGCCTTTTCTCCAGCCCCACGAGCC  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCAGCACATGTTCTTAACTTCTGAGCCTTTTCTCCAGCCCCACGAGCC  374

seq1  TCCCACTTGTTGCTTTGTTTTTTGAGACAGGGTCTCTCTACATCGCCCTG  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCACTTGTTGCTTTGTTTTTTGAGACAGGGTCTCTCTACATCGCCCTG  424

seq1  GTTGCCCTAGAACCTGCTATATAGGCTGGCTTCAAACTCCCATAGACCCA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGCCCTAGAACCTGCTATATAGGCTGGCTTCAAACTCCCATAGACCCA  474

seq1  CCTGCTTCTACCTCCCCAGGGCTGGAGGTAAAGGTGTGTGCCACCACACC  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCTTCTACCTCCCCAGGGCTGGAGGTAAAGGTGTGTGCCACCACACC  524

seq1  GAGCCTTCGGCCTTTTTTTTTTTTTTTATTATTTTTTTTAATGGTTCCTA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCTTCGGCCTTTTTTTTTTTTTTTATTATTTTTTTTAATGGTTCCTA  574

seq1  CAAGAACAGGCTTAGGGAGTGTGTGTGGAATGAAAGAGAGGATTGTGTTA  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAACAGGCTTAGGGAGTGTGTGTGGAATGAAAGAGAGGATTGTGTTA  624

seq1  GGAATCTGCTGATTGGCCCGGAGTCCAAGATGTTCTAGTATCTTGTAAAG  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATCTGCTGATTGGCCCGGAGTCCAAGATGTTCTAGTATCTTGTAAAG  674

seq1  TGTTTGGATAAGAAGTACTTTGTTGCCAGGGAGAAGACTCAATCAGTGCT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTGGATAAGAAGTACTTTGTTGCCAGGGAGAAGACTCAATCAGTGCT  724

seq1  GCTTTTGGTGGCAAATGTCCTTGGAGTGCCCCACACAAAGCCTTCACCCA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTTTGGTGGCAAATGTCCTTGGAGTGCCCCACACAAAGCCTTCACCCA  774

seq1  GATCTTCAGCCACAGCCCTGATCCCCGTCATCTTTGAGATCATTGTCAGA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTTCAGCCACAGCCCTGATCCCCGTCATCTTTGAGATCATTGTCAGA  824

seq1  GCACGGATCAATGTACCGAAGTATACTTTGCAGTTACAGCTTGAATGTAA  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACGGATCAATGTACCGAAGTATACTTTGCAGTTACAGCTTGAATGTAA  874

seq1  TTAGGAGGCAGAAATTACTTGTTTTCTCCTTGTTTTCTGTGTGTACAAGA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGAGGCAGAAATTACTTGTTTTCTCCTTGTTTTCTGTGTGTACAAGA  924

seq1  GTGTTCGTGTGTGAGCGGGTGCATCTGTGTACCCATACACGCTGAGGACA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTCGTGTGTGAGCGGGTGCATCTGTGTACCCATACACGCTGAGGACA  974

seq1  GAGGTCAACCTCAGGTGCCTCTATTCAGGTGTCCTCTACGCTGTTTTATG  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTCAACCTCAGGTGCCTCTATTCAGGTGTCCTCTACGCTGTTTTATG  1024

seq1  AGCCGAGAACATATCACTGGGCTGGGGCTTGAAATTTAGTTTAGGCAAGC  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCGAGAACATATCACTGGGCTGGGGCTTGAAATTTAGTTTAGGCAAGC  1074

seq1  CAACTTCCATGTTCCAAGGATCTGCCTGTCTCCATTCCCCCAGGGTTTGA  1147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTTCCATGTTCCAAGGATCTGCCTGTCTCCATTCCCCCAGGGTTTGA  1124

seq1  TTGCAAGGGTGTGCCATCTTGCTGCGGAGCATGAACATAGTCCAAGAGTG  1197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCAAGGGTGTGCCATCTTGCTGCGGAGCATGAACATAGTCCAAGAGTG  1174

seq1  CACTCTTGTGAGGAGAATTC  1217
      ||||||||||||||||||||
seq2  CACTCTTGTGAGGAGAATTC  1194

seq1: chr17_65799393_65800557
seq2: B6Ng01-220I07.g_63_1228

seq1  GAATTCCTTGTCTCTAGCACATTTCATTTAATAGAGACAAACTACACAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTGTCTCTAGCACATTTCATTTAATAGAGACAAACTACACAGA  50

seq1  GCAGCCAGCAAACCAGGACAACAGAGACTGCAACAATTCATTGGTATAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCCAGCAAACCAGGACAACAGAGACTGCAACAATTCATTGGTATAGC  100

seq1  TGGTATAAAATATGCGCATGGCTTTTGTCTTTGGAGATGAGACTATAAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTATAAAATATGCGCATGGCTTTTGTCTTTGGAGATGAGACTATAAAG  150

seq1  TGTATTCTTAGTCAACTGAGCCGTGATTAACATTTCGGGCACTAAGGTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTCTTAGTCAACTGAGCCGTGATTAACATTTCGGGCACTAAGGTCT  200

seq1  CCTGGAGTCACTCTGGATTTATAGGCTTGCCCTTACCAGCATTTCGTCTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGAGTCACTCTGGATTTATAGGCTTGCCCTTACCAGCATTTCGTCTG  250

seq1  AAGCTGCGTTTTGTAGAAGAGGAGGTGTTCCAGCACTTCGGTGAGCTGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTGCGTTTTGTAGAAGAGGAGGTGTTCCAGCACTTCGGTGAGCTGAG  300

seq1  GACGATTGTTCTGAACGCAGGACCAGGCGGCCACACTGTGCCAGAGCAGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACGATTGTTCTGAACGCAGGACCAGGCGGCCACACTGTGCCAGAGCAGG  350

seq1  TGGTTGACTTCGTAGCCCCTCTTATTCAGCTGCAAATGATTCTGAAATGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTGACTTCGTAGCCCCTCTTATTCAGCTGCAAATGATTCTGAAATGA  400

seq1  CATGATTATTATGGAGGCTGACCTGCCAAAGACTTCTTTGACTTGCACAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGATTATTATGGAGGCTGACCTGCCAAAGACTTCTTTGACTTGCACAG  450

seq1  ACTTGAAAAATACATTTTAAAATATACAAATCAAAGTGAATATTCACTCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGAAAAATACATTTTAAAATATACAAATCAAAGTGAATATTCACTCA  500

seq1  GATTTGTAGAATCATTTAAAAGTGTTTTTAGGTATGGATAGCTGAAATAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTTGTAGAATCATTTAAAAGTGTTTTTAGGTATGGATAGCTGAAATAA  550

seq1  ACCTAGTAGCTACACAAAATGTTTACAAGTCCCTGTGTTCAATGTATCTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTAGTAGCTACACAAAATGTTTACAAGTCCCTGTGTTCAATGTATCTA  600

seq1  TCAGTCTACGGTAAGACAGAAACACCAAAACCTCTGAAGGACCACTGTTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTCTACGGTAAGACAGAAACACCAAAACCTCTGAAGGACCACTGTTG  650

seq1  GATGTGCTGTTCTTGGACTCTGTGGGTCTCCCTTCTTCACAACACCTGAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTGCTGTTCTTGGACTCTGTGGGTCTCCCTTCTTCACAACACCTGAT  700

seq1  CAAGAGGCAACTGGGAAAGTTTTAACAAACTGGGCTCTGAAACCTGGGTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAGGCAACTGGGAAAGTTTTAACAAACTGGGCTCTGAAACCTGGGTT  750

seq1  TCTCTGCATTAACAACCAAATAGGTGCCTCATAGAGGGTGGCCAATGCCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGCATTAACAACCAAATAGGTGCCTCATAGAGGGTGGCCAATGCCT  800

seq1  GTTAATCACTTGGGTTTCTTTAACTACAAATTCAGATACTATGTTTTTTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAATCACTTGGGTTTCTTTAACTACAAATTCAGATACTATGTTTTTTG  850

seq1  TTTG-TTTTCTTCAAGTATTCCATGACAGCTTCATTAAGTAATTGATCTG  899
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTTTCTTCAAGTATTCCATGACAGCTTCATTAAGTAATTGATCTG  900

seq1  CTGCAGTGATTAGCATTCCATGACATCATAGTACTCTCAGCCCCACCCCA  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCAGTGATTAGCATTCCATGACATCATAGTACTCTCAGCCCCACCCCA  950

seq1  -CCCCACCCTTGCCCCTGCCTCAAAGGTTCAATGGCAGTTCAC-ATTCCA  997
       |||||||||||||||||||||||||||||| ||||||||||| ||||||
seq2  CCCCCACCCTTGCCCCTGCCTCAAAGGTTCATTGGCAGTTCACAATTCCA  1000

seq1  TACTGATAAG-AAACACTTTACATCTGAAGGGCTTCATTGTCCTCAGT-T  1045
      |||||||||| ||||||||||||||||||||||||||||||||||||| |
seq2  TACTGATAAGAAAACACTTTACATCTGAAGGGCTTCATTGTCCTCAGTAT  1050

seq1  ATTATATGAAATATT-AGAGCTAAAAATCTAAAGACAGTCTTCATGTTGA  1094
       | ||||| |||||| |||||| |||  ||||||||||||||||||||||
seq2  TTAATATG-AATATTAAGAGCT-AAATCCTAAAGACAGTCTTCATGTTGA  1098

seq1  GTCCTCTCAAAATGCTGGAGATTCATACA-GAATTTCAAATTAAAACCTC  1143
      ||||||| |||||||| || || ||| || ||||||||| ||  ||||||
seq2  GTCCTCTGAAAATGCT-GAAATCCATTCAGGAATTTCAAGTT--AACCTC  1145

seq1  TCAAGTTTCTGGTAAGCTGTTT  1165
      |||||  || ||||||| ||||
seq2  TCAAG-CTCCGGTAAGCCGTTT  1166

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information