MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-220J06
Chromosome	17 (Build37)
Map Location	55,494,049 - 55,495,010
singlet/doublet	singlet
Overlap gene	none
Upstream gene	1700025K24Rik, Trp53-ps, LOC240117, EG629178, LOC100043833, LOC100043485
Downstream gene	LOC677496, St6gal2, LOC383258, Pot1b, Emr4, Zfp119, BC011426, EG433125, BC031441, Ebi3, Ccdc94, Shd, Fsd1, AW049765, Mpnd, Sh3gl1, Chaf1a, Ubxd1, Hdgfrp2, S3-12, 2310076L09Rik, Lrg1, Sema6b, Tnfaip8l1, D17Wsu104e, Dpp9, LOC668573, A230051N06Rik, Fem1a, Ticam1, M6prbp1, Arrdc5, Uhrf1, Jmjd2b
Link	Open Mouse BAC browser

Click to get alignment info.

name	1700025K24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69418 MGI:1916668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Trp53-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22060 MGI:98835
definition	gene_synonym : p53 note : transformation related protein 53, pseudogene pseudo : _no_value

name	LOC240117 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:240117
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG629178 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629178 MGI:3647305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100043833 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043833
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	LOC100043485 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	LOC677496 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	St6gal2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240119 MGI:2445190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 32 Proteins pseudo : _no_value

name	Pot1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72836 MGI:1920086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52614 MGI:1196464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp119 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104349 MGI:1345189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC011426 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224893 MGI:2385058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433125 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433125 MGI:3643554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 287 ESTs, 10 Proteins

name	BC031441 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240120 MGI:2385323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ebi3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50498 MGI:1354171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc94 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72886 MGI:1920136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20420 MGI:1099461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240121 MGI:1934858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW049765 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106766 MGI:2147039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpnd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68047 MGI:1915297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh3gl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20405 MGI:700010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chaf1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27221 MGI:1351331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubxd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66530 MGI:1913780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdgfrp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15193 MGI:1194492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	S3-12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57435 MGI:1929709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310076L09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66968 MGI:1914218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Lrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76905 MGI:1924155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20359 MGI:1202889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfaip8l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66443 MGI:1913693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D17Wsu104e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28106 MGI:2156020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224897 MGI:2443967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668573 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins pseudo : _no_value

name	A230051N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320593 MGI:2444339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Fem1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14154 MGI:1335089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ticam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106759 MGI:2147032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	M6prbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66905 MGI:1914155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arrdc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76920 MGI:1924170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uhrf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18140 MGI:1338889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jmjd2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193796 MGI:2442355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700025K24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94402057 GeneID:69418 MGI:1916668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700025K24 gene transcript_id : XM_901213.2

name	EG629178 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268758 GeneID:629178 MGI:3647305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG629178 transcript_id : XM_894020.3

name	St6gal2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352074 GeneID:240119 MGI:2445190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta galactoside alpha 2,6 sialyltransferase 2 transcript_id : NM_172829.2

name	Pot1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677916 GeneID:72836 MGI:1920086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protection of telomeres 1B transcript_id : NM_028370.1

name	Emr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349934 GeneID:52614 MGI:1196464
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like module containing, mucin-like, hormone receptor-like sequence 4 transcript_id : NM_139138.2

name	Zfp119 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351474 GeneID:104349 MGI:1345189
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 119 transcript_id : NM_144546.4

name	BC011426 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665710 GeneID:224893 MGI:2385058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC011426 transcript_id : NM_145490.4

name	EG433125 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268879 GeneID:433125 MGI:3643554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 10 Proteins product : predicted gene, EG433125, transcript variant 2 transcript_id : XM_895083.3

name	EG433125 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268878 GeneID:433125 MGI:3643554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 286 ESTs, 10 Proteins product : predicted gene, EG433125, transcript variant 1 transcript_id : XM_484650.4

name	BC031441 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130188 GeneID:240120 MGI:2385323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC031441 transcript_id : NM_146249.4

name	Ebi3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70906480 GeneID:50498 MGI:1354171
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Epstein-Barr virus induced gene 3 transcript_id : NM_015766.2

name	Ccdc94 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802679 GeneID:72886 MGI:1920136
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 94 transcript_id : NM_028381.2

name	Shd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677938 GeneID:20420 MGI:1099461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : src homology 2 domain-containing transforming protein D transcript_id : NM_009168.1

name	Fsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130725 GeneID:240121 MGI:1934858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibronectin type 3 and SPRY domain-containing protein transcript_id : NM_183178.2

name	AW049765 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122356 GeneID:106766 MGI:2147039
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW049765 transcript_id : NM_145934.1

name	Mpnd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803295 GeneID:68047 MGI:1915297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MPN domain containing transcript_id : NM_026530.4

name	Sh3gl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130840 GeneID:20405 MGI:700010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-domain GRB2-like 1 transcript_id : NM_013664.2

name	Chaf1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376418 GeneID:27221 MGI:1351331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromatin assembly factor 1, subunit A (p150) transcript_id : NM_013733.3

name	Ubxd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981252 GeneID:66530 MGI:1913780
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UBX domain containing 1 transcript_id : NM_024432.2

name	Hdgfrp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375363 GeneID:15193 MGI:1194492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hepatoma-derived growth factor, related protein 2 transcript_id : NM_008233.2

name	S3-12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375035 GeneID:57435 MGI:1929709
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plasma membrane associated protein, S3-12 transcript_id : NM_020568.2

name	2310076L09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116292165 GeneID:66968 MGI:1914218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310076L09 gene transcript_id : NM_025874.3

name	2310076L09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116292163 GeneID:66968 MGI:1914218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310076L09 gene transcript_id : NM_001077348.1

name	Lrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981359 GeneID:76905 MGI:1924155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich alpha-2-glycoprotein 1 transcript_id : NM_029796.2

name	Sema6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305474 GeneID:20359 MGI:1202889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B transcript_id : NM_013662.1

name	Tnfaip8l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560243 GeneID:66443 MGI:1913693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor, alpha-induced protein 8-like 1 transcript_id : NM_025566.2

name	D17Wsu104e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55956924 GeneID:28106 MGI:2156020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 17, Wayne State University 104, expressed transcript_id : NM_080837.2

name	Dpp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801828 GeneID:224897 MGI:2443967
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidylpeptidase 9 transcript_id : NM_172624.2

name	A230051N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268764 GeneID:320593 MGI:2444339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA A230051N06 gene transcript_id : XM_001480286.1

name	Fem1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364435 GeneID:14154 MGI:1335089
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : feminization 1 homolog a (C. elegans) transcript_id : NM_010192.3

name	Ticam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227224 GeneID:106759 MGI:2147032
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor adaptor molecule 1 transcript_id : NM_174989.3

name	M6prbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803193 GeneID:66905 MGI:1914155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose-6-phosphate receptor binding protein 1 transcript_id : NM_025836.2

name	Arrdc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626085 GeneID:76920 MGI:1924170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin domain containing 5 transcript_id : NM_029799.1

name	Uhrf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981595 GeneID:18140 MGI:1338889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-like, containing PHD and RING finger domains, 1 transcript_id : NM_010931.2

name	Jmjd2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26006856 GeneID:193796 MGI:2442355
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 2B transcript_id : NM_172132.1

name	1700025K24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82993933 GeneID:69418 MGI:1916668
definition	codon_start : 1 product : hypothetical protein LOC69418 protein_id : XP_906306.1

name	EG629178 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268759 GeneID:629178 MGI:3647305
definition	codon_start : 1 product : similar to 4933411K20Rik protein protein_id : XP_899113.3

name	St6gal2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370242 CCDS:CCDS28886.1 GeneID:240119 MGI:2445190
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0003835 - beta-galactoside alpha-2,6-sialyltransferase activity [Evidence ISS]; GO:0008373 - sialyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0007275 - development [Evidence ISS]; GO:0040007 - growth [Evidence ISS]; GO:0006054 - N-acetylneuraminate metabolism [Evidence IC]; GO:0009311 - oligosaccharide metabolism [Evidence ISS] codon_start : 1 product : beta-galactoside alpha-2,6-sialyltransferase II protein_id : NP_766417.1

name	Pot1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76677917 GeneID:72836 MGI:1920086
definition	GO_component : GO:0000784 - nuclear chromosome, telomeric region [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 note : Pot1-like product : protection of telomeres 1B protein_id : NP_082646.1

name	Emr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20982827 GeneID:52614 MGI:1196464
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0015058 - epidermal growth factor-like module containing hormone receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007173 - epidermal growth factor receptor signaling pathway [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : seven-span membrane protein FIRE; F4/80-like-receptor product : EGF-like module containing, mucin-like, hormone receptor-like sequence 4 protein_id : NP_631877.1

name	Zfp119 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536254 GeneID:104349 MGI:1345189
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : KRAB zinc finger protein product : zinc finger protein 119 protein_id : NP_653129.1

name	BC011426 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729792 GeneID:224893 MGI:2385058
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC224893 protein_id : NP_663465.1

name	EG433125 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770297 GeneID:433125 MGI:3643554
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_484650.1

name	EG433125 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82993899 GeneID:433125 MGI:3643554
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_900176.1

name	BC031441 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122835 GeneID:240120 MGI:2385323
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240120 protein_id : NP_666361.1

name	Ebi3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657052 CCDS:CCDS28888.1 GeneID:50498 MGI:1354171
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0045523 - interleukin-27 receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : Epstein-Barr virus induced gene 3 protein precursor protein_id : NP_056581.1

name	Ccdc94 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312171 GeneID:72886 MGI:1920136
definition	codon_start : 1 product : coiled-coil domain containing 94 protein_id : NP_082657.1

name	Shd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677939 GeneID:20420 MGI:1099461
definition	codon_start : 1 product : src homology 2 domain-containing transforming protein D protein_id : NP_033194.1

name	Fsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147224 GeneID:240121 MGI:1934858
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] codon_start : 1 product : fibronectin type 3 and SPRY domain-containing protein protein_id : NP_899001.1

name	AW049765 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122357 CCDS:CCDS28889.1 GeneID:106766 MGI:2147039
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : signal-transducing adaptor protein-2 protein_id : NP_666046.1

name	Mpnd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626001 GeneID:68047 MGI:1915297
definition	codon_start : 1 exception : unclassified translation discrepancy product : MPN domain containing protein_id : NP_080806.3

name	Sh3gl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305485 CCDS:CCDS28891.1 GeneID:20405 MGI:700010
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IDA] codon_start : 1 note : endophilin II; SH3 domain protein 2B product : SH3-domain GRB2-like 1 protein_id : NP_038692.1

name	Chaf1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304957 CCDS:CCDS28892.1 GeneID:27221 MGI:1351331
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : chromatin assembly factor 1, subunit A (p150) protein_id : NP_038761.1

name	Ubxd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277354 CCDS:CCDS28893.1 GeneID:66530 MGI:1913780
definition	codon_start : 1 note : UBX domain-containing 2 product : UBX domain containing 1 protein_id : NP_077752.1

name	Hdgfrp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680201 CCDS:CCDS28894.1 GeneID:15193 MGI:1194492
definition	codon_start : 1 product : hepatoma-derived growth factor-related protein 2 protein_id : NP_032259.1

name	S3-12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181204 GeneID:57435 MGI:1929709
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] codon_start : 1 exception : mismatches in translation product : plasma membrane associated protein, S3-12 protein_id : NP_065593.1

name	2310076L09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116292164 GeneID:66968 MGI:1914218
definition	codon_start : 1 note : lipid droplet associated protein product : lipid storage droplet protein 5 protein_id : NP_001070816.1

name	2310076L09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116292166 GeneID:66968 MGI:1914218
definition	codon_start : 1 note : lipid droplet associated protein product : lipid storage droplet protein 5 protein_id : NP_080150.2

name	Lrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16418335 CCDS:CCDS28895.1 GeneID:76905 MGI:1924155
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine-rich alpha-2-glycoprotein protein_id : NP_084072.1

name	Sema6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305475 CCDS:CCDS28896.1 GeneID:20359 MGI:1202889
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B protein_id : NP_038690.1

name	Tnfaip8l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560244 CCDS:CCDS28897.1 GeneID:66443 MGI:1913693
definition	codon_start : 1 product : tumor necrosis factor, alpha-induced protein 8-like 1 protein_id : NP_079842.2

name	D17Wsu104e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18250288 CCDS:CCDS28898.1 GeneID:28106 MGI:2156020
definition	GO_function : GO:0008083 - growth factor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IDA] GO_process : GO:0008284 - positive regulation of cell proliferation [Evidence IDA] codon_start : 1 note : C19orf10-like product : hypothetical protein LOC28106 protein_id : NP_543027.1

name	Dpp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369900 GeneID:224897 MGI:2443967
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dipeptidylpeptidase 9 protein_id : NP_766212.1

name	A230051N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268765 GeneID:320593 MGI:2444339
definition	codon_start : 1 product : hypothetical protein LOC320593 protein_id : XP_001480336.1

name	Fem1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542806 CCDS:CCDS28899.1 GeneID:14154 MGI:1335089
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : feminization 1 homolog a protein_id : NP_034322.2

name	Ticam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859797 CCDS:CCDS28900.1 GeneID:106759 MGI:2147032
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence IMP] codon_start : 1 note : TIR domain-containing adaptor inducing interferon-beta product : TICAM-1 protein_id : NP_778154.1

name	M6prbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385312 CCDS:CCDS28901.1 GeneID:66905 MGI:1914155
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mannose-6-phosphate receptor binding protein 1 protein_id : NP_080112.1

name	Arrdc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626086 CCDS:CCDS28902.1 GeneID:76920 MGI:1924170
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : arrestin domain containing 5 protein_id : NP_084075.1

name	Uhrf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981596 CCDS:CCDS28903.1 GeneID:18140 MGI:1338889
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0008283 - cell proliferation [Evidence TAS]; GO:0007275 - development [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : nuclear protein 95 product : ubiquitin-like, containing PHD and RING finger domains, 1 protein_id : NP_035061.2

name	Jmjd2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006857 CCDS:CCDS28904.1 GeneID:193796 MGI:2442355
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : jumonji domain containing 2B protein_id : NP_742144.1

name	LOC240117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:240117
definition	number : 1 pseudo : _no_value

name	LOC240117 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:240117
definition	number : 2 pseudo : _no_value

name	LOC677496 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677496
definition	number : 1 pseudo : _no_value

name	Trp53-ps (CDS detail)
type	polyA_site
link	vega ensembl
xref
definition	gene_synonym : p53 note : putative

name	Trp53-ps (CDS detail)
type	polyA_signal
link	vega ensembl
xref
definition	gene_synonym : p53 note : putative

name	Trp53-ps (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : p53 note : no similarity to p53 cDNA pseudo : _no_value

name	LOC100043833 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268877 GeneID:100043833
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : similar to Chain A, D92n,D94n Double Point Mutant Of Human Nuclear Transport Factor 2 (Ntf2) pseudo : _no_value transcript_id : XR_035013.1

name	LOC100043485 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268760 GeneID:100043485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : hypothetical protein LOC100043485 pseudo : _no_value transcript_id : XR_034600.1

name	LOC383258 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268761 GeneID:383258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 32 Proteins product : similar to putative pheromone receptor pseudo : _no_value transcript_id : XR_034606.1

name	LOC668573 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268880 GeneID:668573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_035016.1

clone name	MSMg01-412B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057F13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-062L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-305M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-182H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362D23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-277K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-344E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-384K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355B02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-352F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-220J06.b	B6Ng01-220J06.g
ACC	GA036101	GA036102
length	681	975
definition	B6Ng01-220J06.b	B6Ng01-220J06.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttgatctctccaatacttttaacatgaagggctgttgtattttg tcaaatgctttttctgcatctaaggagatgatcatgtgatttttttcttt gcgcttgtttatataatggattacgttaatggattttcatatattgagtc agccttgcatctctgggatgaagcctacttgattgtggtgaatgatggtt ttgatgtgctcttggattcggttttcaagagttttattgagtatttttgc atcaatattcataagcgagattgatctgaagttctctttttttgttgggt ccttgtgtggtttaggtatcagagtaattgtggcatcatagagcaagtta gtcagtgttccttctctttctattttatggaatagtttgaggaaaattgg tatcaggtcttctttgaaggcctggtagaatttgcactaaatccatctgc ccctgggtttgtttgtttgtttgtttgttttggttgggagatttttaatg acttctatttacttatgggctatgggcctgtttagatagttttacctcct cttgagttaactttggtatgtggtatctgtctagaaaaatcatccatttc atctagattttccagggtttttttgagtataggctttttgtagtaggatt ctgatgattttttgaatttcctctgtttcat	gaattcaagcaggtcaggaagcaggaactgatgcagaggccatgagagat tttacttactggcttgcttcccctggcttgctcagcctgctctcttatag aacccagagatggcaccacccacaaggcgacctccccacttgatcactaa ttgagaaaatgccttacagctggatctcatggaggcacttccccaactga agctcctttctctgtgataactccagcctgtgtcaagttggcacaaaact agccagtacagtttctaaatttcctaaacttctggcaaagagtacatttt atattgtccacacaatgtgaaaagaatcagaaatagttttaactattagt cctgctctgttttagcagacatttagatgagtaagctctagttgcacaaa aaaagttttaaagtgttcctttttattaatctagttctacagctacaatc agaaacattgacttattgctgctaaaattgtttaaaaaaaaaagaaagaa agaaaaatgatggtaggtcagtggtggcacatgcctttaatcccagcact tgggaggcagaggcagatggatttctgagtttgaggccagcctgctctac agagtgagttccaggacagccagagctatacacagaaaccctgtcttgaa aaaccaaaaaaaaaaaaaaaattatgtgtggtattttctaagacatattg tcaatcaaactatttctagaaaagttcatatttctagaagaaatcatttt atttttctctccagtggcttttattcttaatttttctttagctttgaaaa tactatatatacaaacaataaaattatgatcttattccacccccccccaa catctcttgtaacattaacatctctaacattctccttccctgtatgggtt tgcctttttcttccactttaattttcccataaaggttagagaatgaaagg agtactccacagagttcttattatc
quality values	Open. Hide. 58 31 35 24 62 62 62 62 54 24 38 62 62 62 62 62 41 18 49 62 62 62 62 62 62 59 62 62 44 44 59 62 62 62 49 49 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 49 42 62 59 59 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 59 59 62 59 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 53 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 48 62 46 58 54 54 54 52 43 37 54 54 54 54 54 52 30 34 52 58 52 50 34 33 32 29 25 32 46 40 41 41 46 46 41 38 34 39 48 52 54 19 52 52 37 22 54 52 50 39 25 33 46 32 42 52 52 49 42 54 54 54 54 54 58 50 21 25 19 18 19 21 34 25 37 41 43 39 52 42 50 42 40 37 38 49 50 40 40 38 29 38 39 52 32 46 50 50 46 24 25 25 9 9 16 12 7 10 29 31 32 29 32 31 50 48 15 29 17 50 52 51 50 22 36 41 50 31 19 31 26 29 40 40 50 40 43 28 41 29 39 21 14 30 25 33 31 23 27 26 33 21 31 29 24 23 8 10 20 7 19 33 16 22 42 16 19 39 32 15 30 27 25 15 19 22 21 24 29 15 36 18 16 12 11 20 27 9 16 6 5 6	Open. Hide. 62 47 56 42 62 44 42 44 56 51 51 50 62 50 59 44 45 49 44 59 59 59 59 59 62 59 62 59 62 59 54 62 62 62 62 59 62 62 59 62 59 59 62 59 59 59 59 62 59 49 62 62 62 62 54 62 62 59 59 62 62 49 40 34 32 54 49 54 62 62 62 54 54 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 49 54 54 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 56 62 62 62 59 62 62 54 62 59 62 62 59 62 62 54 42 54 62 62 62 59 59 62 62 62 62 62 62 56 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 59 56 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 43 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 50 56 59 62 62 62 62 62 62 62 62 59 62 51 59 62 49 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 56 59 59 56 59 62 62 62 62 59 59 59 59 62 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 59 59 62 62 59 62 62 62 62 62 62 59 59 56 62 59 59 44 62 59 59 59 62 59 56 49 62 47 62 47 47 62 62 56 62 62 49 56 62 62 62 62 62 56 51 47 44 56 44 56 47 62 62 62 62 62 62 62 56 62 56 62 23 21 14 6 18 15 56 62 39 47 62 62 62 56 62 56 51 42 62 25 46 51 56 56 62 56 62 56 47 51 62 62 56 56 47 62 43 56 62 56 62 62 47 47 56 62 43 56 56 62 62 62 56 62 62 27 27 47 46 42 56 47 56 62 62 46 33 33 56 46 47 38 39 62 27 56 47 43 52 48 43 62 38 62 62 52 52 34 43 54 48 62 49 62 62 39 41 54 52 48 62 62 52 62 47 42 47 47 47 62 62 16 52 46 52 50 43 52 52 52 52 52 52 52 52 52 54 54 47 34 18 25 25 50 46 54 28 37 32 8 20 29 21 27 42 41 35 32 54 34 42 31 39 42 42 35 34 47 28 32 21 16 31 52 27 52 52 35 35 41 31 26 54 38 42 46 42 52 35 34 34 18 39 39 35 35 42 34 19 33 39 35 20 26 12 52 33 28 50 28 33 27 30 32 30 58 58 42 50 35 52 49 50 48 47 42 35 50 46 17 7 23 15 50 25 34 58 54 58 42 19 21 31 15 22 21 26 36 17 34 46 51 58 45 18 50 41 32 26 52 39 49 28 30 50 27 28 20 22 19 18 7 5 15 18 39 20 30 11 35 15 31 13 15 9 20 17 6 31 28 18 19 17 13 17 32 23 12 12 12 22 17 22 13 16 28 20 9 50 50 50 50 40 50 50 31 33 35 20 24 39 31 19 28 8 8 35 9 41 52 26 18 17 16 18 30 26 20 24 16 29 34 43 53 42 19 19 41 30 37 27 50 25 16 10 19 15 7 9 13 6 15 26 31 31 9 6 9 20 49 9 49 17 38 41 40 30 30 41 12 37 23 30 14 29 37 31 13 21 16 39 37 46 31 32 18 6 19 17 38 30 38 21 23 22 25 9 21 9 37 13 12 25 37 30 25 12 27 17 15 23 12 15 22 25 28 14 21 29 20 9 6 17 6 23 8 7 26 24 11 10 8 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_55494049_55495010
seq2: B6Ng01-220J06.g_69_1043

seq1  GAATTCAAGCAGGTCAGGAAGCAGGAACTGATGCAGAGGCCATGAGAGAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGCAGGTCAGGAAGCAGGAACTGATGCAGAGGCCATGAGAGAT  50

seq1  TTTACTTACTGGCTTGCTTCCCCTGGCTTGCTCAGCCTGCTCTCTTATAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACTTACTGGCTTGCTTCCCCTGGCTTGCTCAGCCTGCTCTCTTATAG  100

seq1  AACCCAGAGATGGCACCACCCACAAGGCGACCTCCCCACTTGATCACTAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCCAGAGATGGCACCACCCACAAGGCGACCTCCCCACTTGATCACTAA  150

seq1  TTGAGAAAATGCCTTACAGCTGGATCTCATGGAGGCACTTCCCCAACTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGAAAATGCCTTACAGCTGGATCTCATGGAGGCACTTCCCCAACTGA  200

seq1  AGCTCCTTTCTCTGTGATAACTCCAGCCTGTGTCAAGTTGGCACAAAACT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCCTTTCTCTGTGATAACTCCAGCCTGTGTCAAGTTGGCACAAAACT  250

seq1  AGCCAGTACAGTTTCTAAATTTCCTAAACTTCTGGCAAAGAGTACATTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAGTACAGTTTCTAAATTTCCTAAACTTCTGGCAAAGAGTACATTTT  300

seq1  ATATTGTCCACACAATGTGAAAAGAATCAGAAATAGTTTTAACTATTAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTGTCCACACAATGTGAAAAGAATCAGAAATAGTTTTAACTATTAGT  350

seq1  CCTGCTCTGTTTTAGCAGACATTTAGATGAGTAAGCTCTAGTTGCACAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCTCTGTTTTAGCAGACATTTAGATGAGTAAGCTCTAGTTGCACAAA  400

seq1  AAAAGTTTTAAAGTGTTCCTTTTTATTAATCTAGTTCTACAGCTACAATC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGTTTTAAAGTGTTCCTTTTTATTAATCTAGTTCTACAGCTACAATC  450

seq1  AGAAACATTGACTTATTGCTGCTAAAATTGTTTAAAAAAAAAAGAAAGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAACATTGACTTATTGCTGCTAAAATTGTTTAAAAAAAAAAGAAAGAA  500

seq1  AGAAAAATGATGGTAGGTCAGTGGTGGCACATGCCTTTAATCCCAGCACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAAATGATGGTAGGTCAGTGGTGGCACATGCCTTTAATCCCAGCACT  550

seq1  TGGGAGGCAGAGGCAGATGGATTTCTGAGTTTGAGGCCAGCCTGCTCTAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAGGCAGAGGCAGATGGATTTCTGAGTTTGAGGCCAGCCTGCTCTAC  600

seq1  AGAGTGAGTTCCAGGACAGCCAGAGCTATACACAGAAACCCTGTCTTGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTGAGTTCCAGGACAGCCAGAGCTATACACAGAAACCCTGTCTTGAA  650

seq1  AAACCAAAAAAAAAAAAAAAATTATGTGTGGTA-TTTCTAAGACATATTG  699
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  AAACCAAAAAAAAAAAAAAAATTATGTGTGGTATTTTCTAAGACATATTG  700

seq1  TCAATCAAACTATTTCTAGAAAAGTTCATA-TTCTAGAAGAAATCATTTT  748
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  TCAATCAAACTATTTCTAGAAAAGTTCATATTTCTAGAAGAAATCATTTT  750

seq1  ATTTTTCTCTCCAGTGGCTTTTATTCTTAATTTTTCTTTAGCTTTGAAAA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTCTCTCCAGTGGCTTTTATTCTTAATTTTTCTTTAGCTTTGAAAA  800

seq1  TACTATATATACAAACAATAAAA-TATGATCATA-TCCA--CCCCCCCAA  844
      ||||||||||||||||||||||| ||||||| || ||||  |||||||||
seq2  TACTATATATACAAACAATAAAATTATGATCTTATTCCACCCCCCCCCAA  850

seq1  CATCTCCTGTAACA-TAACATCTCTAACATTCTCCCTCCCTGTAT-GGTT  892
      |||||| ||||||| |||||||||||||||||||| ||||||||| ||||
seq2  CATCTCTTGTAACATTAACATCTCTAACATTCTCCTTCCCTGTATGGGTT  900

seq1  TGCC-TTTTCTTCCACTTTTATTTT-CCATAAAGGTTAGAGAATGAAAGG  940
      |||| |||||||||||||| ||||| ||||||||||||||||||||||||
seq2  TGCCTTTTTCTTCCACTTTAATTTTCCCATAAAGGTTAGAGAATGAAAGG  950

seq1  AGTACT-CACAGAGT--CTATTATC  962
      |||||| ||||||||   |||||||
seq2  AGTACTCCACAGAGTTCTTATTATC  975

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information