MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-221B16
Chromosome	17 (Build37)
Map Location	6,034,632 - 6,173,373
singlet/doublet	doublet
Overlap gene	Synj2, Serac1, Gtf2h5, 2210038L17Rik, LOC545184, Tulp4
Upstream gene	Arid1b, 5730437N04Rik, Ldhal6b, LOC100040282, LOC666919, LOC100040312, Zdhhc14, 3300005D01Rik, LOC100040342, LOC100040352, Snx9, LOC666951
Downstream gene	EG433058, Tmem181, LOC100040453, LOC100040471, Dynlt1, LOC547127, LOC100040488, LOC100040500, LOC100040531, LOC100040525, LOC100040563, LOC100040546, LOC100040536, LOC100040556, LOC100040603, LOC100040596, LOC100040631, LOC100040616, Sytl3, Vil2, LOC100040654, Rshl2b, 1700122H20Rik, Tagap1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Arid1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239985 MGI:1926129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 141 ESTs, 6 Proteins

name	5730437N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70544 MGI:1917794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ldhal6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106557 MGI:2146830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040282 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666919 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666919
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100040312 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Zdhhc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224454 MGI:2653229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3300005D01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78512 MGI:1925762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	LOC100040342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 272 ESTs, 12 Proteins

name	LOC100040352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Snx9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66616 MGI:1913866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Synj2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20975 MGI:1201671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321007 MGI:2447813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gtf2h5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66467 MGI:107227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210038L17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78646 MGI:1925896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545184
definition	note : fibrillarin-like pseudo : _no_value

name	Tulp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68842 MGI:1916092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433058 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433058 MGI:3644697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 107 ESTs, 6 Proteins

name	Tmem181 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77106 MGI:1924356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040453 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 105 ESTs, 6 Proteins

name	LOC100040471 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 267 ESTs, 7 Proteins

name	Dynlt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21648 MGI:98643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC547127 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 118 ESTs, 6 Proteins

name	LOC100040500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 240 ESTs, 6 Proteins

name	LOC100040531 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 480 ESTs, 10 Proteins

name	LOC100040525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 257 ESTs, 1 Protein pseudo : _no_value

name	LOC100040563 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 585 ESTs, 10 Proteins

name	LOC100040546 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC100040536 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040556 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC100040603 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 585 ESTs, 10 Proteins

name	LOC100040596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 250 ESTs, 1 Protein pseudo : _no_value

name	LOC100040631 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 478 ESTs, 10 Proteins

name	LOC100040616 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Sytl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83672 MGI:1933367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Vil2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22350 MGI:98931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040654 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rshl2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100037282 MGI:3630308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 74 ESTs, 3 Proteins

name	1700122H20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73617 MGI:1920867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tagap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380608 MGI:1919786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arid1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401537 GeneID:239985 MGI:1926129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 132 ESTs, 4 Proteins product : AT rich interactive domain 1B (Swi1 like), transcript variant 2 transcript_id : XM_888675.2

name	Arid1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401536 GeneID:239985 MGI:1926129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 141 ESTs, 4 Proteins product : AT rich interactive domain 1B (Swi1 like), transcript variant 1 transcript_id : XM_139711.8

name	Arid1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268285 GeneID:239985 MGI:1926129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 139 ESTs, 4 Proteins product : AT rich interactive domain 1B (Swi1 like) transcript_id : XM_001474848.1

name	5730437N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366010 GeneID:70544 MGI:1917794
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730437N04 gene transcript_id : NM_027457.3

name	Ldhal6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044417 GeneID:106557 MGI:2146830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactate dehydrogenase A-like 6B transcript_id : NM_175349.2

name	LOC100040282 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268287 GeneID:100040282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to GPI-anchored cell surface glycoprotein required for diploid pseudohyphal formation and haploid invasive growth, transcriptionally regulated by the MAPK pathway (via Ste12p and Tec1p) and the cAMP pathway (via Flo8p) transcript_id : XM_001474427.1

name	LOC100040312 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268289 GeneID:100040312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100040312 transcript_id : XM_001474484.1

name	Zdhhc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51799027 GeneID:224454 MGI:2653229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 14 transcript_id : NM_146073.3

name	3300005D01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268291 GeneID:78512 MGI:1925762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : RIKEN cDNA 3300005D01 gene transcript_id : XM_987107.2

name	LOC100040342 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268293 GeneID:100040342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 272 ESTs, 12 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9) transcript_id : XM_001474523.1

name	Snx9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626032 GeneID:66616 MGI:1913866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 9 transcript_id : NM_025664.3

name	Synj2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362256 GeneID:20975 MGI:1201671
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptojanin 2 transcript_id : NM_011523.1

name	Serac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345698 GeneID:321007 MGI:2447813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine active site containing 1 transcript_id : NM_001033127.2

name	Serac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802959 GeneID:321007 MGI:2447813
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine active site containing 1 transcript_id : NM_177311.3

name	Gtf2h5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346453 GeneID:66467 MGI:107227
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor IIH, polypeptide 5 transcript_id : NM_181392.2

name	2210038L17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702046 GeneID:78646 MGI:1925896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210038L17 gene transcript_id : NM_001033529.1

name	Tulp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383137 GeneID:68842 MGI:1916092
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubby like protein 4 transcript_id : NM_054040.2

name	EG433058 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401557 GeneID:433058 MGI:3644697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 107 ESTs, 6 Proteins product : predicted gene, EG433058 transcript_id : XM_484582.4

name	Tmem181 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677513 GeneID:77106 MGI:1924356
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 181 transcript_id : NM_001033178.1

name	LOC100040453 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268295 GeneID:100040453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 105 ESTs, 6 Proteins product : similar to protein phosphatase 1, regulatory (inhibitor) subunit 2 transcript_id : XM_001474700.1

name	LOC100040471 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268297 GeneID:100040471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 267 ESTs, 7 Proteins product : similar to tubby like protein 4 transcript_id : XM_001474739.1

name	Dynlt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476289 GeneID:21648 MGI:98643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein light chain Tctex-type 1 transcript_id : NM_009342.2

name	LOC547127 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:113865914 GeneID:547127
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to KIAA1423 protein transcript_id : NM_001045538.1

name	LOC100040488 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268299 GeneID:100040488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 118 ESTs, 6 Proteins product : similar to protein phosphatase 1, regulatory (inhibitor) subunit 2 transcript_id : XM_001475435.1

name	LOC100040500 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268301 GeneID:100040500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 240 ESTs, 6 Proteins product : similar to tubby like protein 4 transcript_id : XM_001474822.1

name	LOC100040531 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268306 GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 477 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 2 transcript_id : XM_001475467.1

name	LOC100040531 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268304 GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 477 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 1 transcript_id : XM_001475451.1

name	LOC100040531 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268308 GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 91 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 4 transcript_id : XM_001475513.1

name	LOC100040531 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268310 GeneID:100040531
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 208 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 3 transcript_id : XM_001475492.1

name	LOC100040563 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268322 GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 582 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 2 transcript_id : XM_001475556.1

name	LOC100040563 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268320 GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 582 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 1 transcript_id : XM_001475539.1

name	LOC100040563 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268318 GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 190 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 4 transcript_id : XM_001475585.1

name	LOC100040563 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268324 GeneID:100040563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 309 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 3 transcript_id : XM_001475567.1

name	LOC100040546 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268314 GeneID:100040546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : similar to synaptotagmin-like protein 3-a transcript_id : XM_001474890.1

name	LOC100040536 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268312 GeneID:100040536
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical protein LOC100040536 transcript_id : XM_001474877.1

name	LOC100040556 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268316 GeneID:100040556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : similar to synaptotagmin-like protein 3-a transcript_id : XM_001474901.1

name	LOC100040603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268327 GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 582 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 1 transcript_id : XM_001475602.1

name	LOC100040603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268329 GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 582 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 2 transcript_id : XM_001475617.1

name	LOC100040603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268331 GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 190 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 4 transcript_id : XM_001475648.1

name	LOC100040603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268333 GeneID:100040603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 309 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 3 transcript_id : XM_001475631.1

name	LOC100040631 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268339 GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 475 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 1 transcript_id : XM_001475746.1

name	LOC100040631 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268341 GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 475 ESTs, 9 Proteins product : similar to tctex-1 protein, transcript variant 2 transcript_id : XM_001475764.1

name	LOC100040631 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268337 GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 91 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 4 transcript_id : XM_001475802.1

name	LOC100040631 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268343 GeneID:100040631
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 208 ESTs, 1 Protein product : similar to tctex-1 protein, transcript variant 3 transcript_id : XM_001475782.1

name	LOC100040616 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268335 GeneID:100040616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical protein LOC100040616 transcript_id : XM_001474985.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368577 GeneID:83672 MGI:1933367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_183367.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878232 GeneID:83672 MGI:1933367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_031395.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368585 GeneID:83672 MGI:1933367
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_183369.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368587 GeneID:83672 MGI:1933367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_183370.1

name	Sytl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368589 GeneID:83672 MGI:1933367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 3 transcript_id : NM_183368.1

name	Vil2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921617 GeneID:22350 MGI:98931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : villin 2 transcript_id : NM_009510.2

name	LOC100040654 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268345 GeneID:100040654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040654 transcript_id : XM_001475030.1

name	Rshl2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268347 GeneID:100037282 MGI:3630308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 74 ESTs, 3 Proteins product : radial spokehead-like 2B transcript_id : XM_001475820.1

name	1700122H20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268349 GeneID:73617 MGI:1920867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700122H20 gene transcript_id : XM_001475863.1

name	Tagap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165395 GeneID:380608 MGI:1919786
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell activation GTPase activating protein 1 transcript_id : NM_147155.1

name	Arid1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82981744 GeneID:239985 MGI:1926129
definition	codon_start : 1 product : AT rich interactive domain 1B (Swi1 like) isoform 2 protein_id : XP_893768.1

name	Arid1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82981753 GeneID:239985 MGI:1926129
definition	codon_start : 1 product : AT rich interactive domain 1B (Swi1 like) isoform 1 protein_id : XP_139711.7

name	Arid1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268286 GeneID:239985 MGI:1926129
definition	codon_start : 1 product : AT rich interactive domain 1B (Swi1 like) protein_id : XP_001474898.1

name	5730437N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328297 GeneID:70544 MGI:1917794
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC70544 protein_id : NP_081733.2

name	Ldhal6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425048 GeneID:106557 MGI:2146830
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_process : GO:0019642 - anaerobic glycolysis [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA] codon_start : 1 product : L-lactate dehydrogenase A-like protein_id : NP_780558.1

name	LOC100040282 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268288 GeneID:100040282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474477.1

name	LOC100040312 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268290 GeneID:100040312
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474534.1

name	Zdhhc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51799028 GeneID:224454 MGI:2653229
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : NEW1 domain containing protein product : zinc finger, DHHC domain containing 14 protein_id : NP_666185.3

name	3300005D01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268292 GeneID:78512 MGI:1925762
definition	codon_start : 1 product : hypothetical protein LOC78512 protein_id : XP_992201.2

name	LOC100040342 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268294 GeneID:100040342
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474573.1

name	Snx9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29568084 GeneID:66616 MGI:1913866
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005792 - microsome [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0035091 - phosphoinositide binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006886 - intracellular protein transport [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sorting nexin 9 protein_id : NP_079940.2

name	Synj2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362257 CCDS:CCDS28365.1 GeneID:20975 MGI:1201671
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0001668 - phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity [Evidence IDA]; GO:0004439 - phosphoinositide 5-phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] codon_start : 1 exception : mismatches in translation function : 5' lipid phosphatase product : synaptojanin 2 protein_id : NP_035653.1

name	Serac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701654 GeneID:321007 MGI:2447813
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : serine active site containing 1 isoform 1 protein_id : NP_001028299.1

name	Serac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893415 CCDS:CCDS28366.1 GeneID:321007 MGI:2447813
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : serine active site containing 1 isoform 2 protein_id : NP_796285.1

name	Gtf2h5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088918 GeneID:66467 MGI:107227
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : general transcription factor IIH, polypeptide 5 protein_id : NP_852057.1

name	2210038L17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702047 GeneID:78646 MGI:1925896
definition	codon_start : 1 product : hypothetical protein LOC78646 protein_id : NP_001028701.1

name	Tulp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905077 CCDS:CCDS28370.1 GeneID:68842 MGI:1916092
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : tubby super-family protein product : tubby like protein 4 protein_id : NP_473381.1

name	EG433058 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63701773 GeneID:433058 MGI:3644697
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484582.2

name	Tmem181 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677514 GeneID:77106 MGI:1924356
definition	codon_start : 1 product : G protein-coupled receptor 178 protein_id : NP_001028350.1

name	LOC100040453 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268296 GeneID:100040453
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474750.1

name	LOC100040471 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268298 GeneID:100040471
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474789.1

name	Dynlt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678265 CCDS:CCDS28371.1 GeneID:21648 MGI:98643
definition	GO_component : GO:0005858 - axonemal dynein complex [Evidence TAS]; GO:0005868 - cytoplasmic dynein complex [Evidence TAS] [Evidence ISS]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007017 - microtubule-based process [Evidence IDA] codon_start : 1 product : t-complex testis expressed 1 protein_id : NP_033368.1

name	LOC547127 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:113865915 GeneID:547127
definition	codon_start : 1 product : hypothetical protein LOC547127 protein_id : NP_001039003.1

name	LOC100040488 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268300 GeneID:100040488
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475485.1

name	LOC100040500 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268302 GeneID:100040500
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474872.1

name	LOC100040531 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268309 GeneID:100040531
definition	codon_start : 1 product : similar to tctex-1 protein isoform 4 protein_id : XP_001475563.1

name	LOC100040531 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268305 GeneID:100040531
definition	codon_start : 1 product : similar to tctex-1 protein isoform 1 protein_id : XP_001475501.1

name	LOC100040531 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268307 GeneID:100040531
definition	codon_start : 1 product : similar to tctex-1 protein isoform 2 protein_id : XP_001475517.1

name	LOC100040531 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268311 GeneID:100040531
definition	codon_start : 1 product : similar to tctex-1 protein isoform 3 protein_id : XP_001475542.1

name	LOC100040563 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268319 GeneID:100040563
definition	codon_start : 1 product : similar to tctex-1 protein isoform 4 protein_id : XP_001475635.1

name	LOC100040563 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268321 GeneID:100040563
definition	codon_start : 1 product : similar to tctex-1 protein isoform 1 protein_id : XP_001475589.1

name	LOC100040563 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268323 GeneID:100040563
definition	codon_start : 1 product : similar to tctex-1 protein isoform 2 protein_id : XP_001475606.1

name	LOC100040563 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268325 GeneID:100040563
definition	codon_start : 1 product : similar to tctex-1 protein isoform 3 protein_id : XP_001475617.1

name	LOC100040536 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268313 GeneID:100040536
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474927.1

name	LOC100040546 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268315 GeneID:100040546
definition	codon_start : 1 product : similar to synaptotagmin-like protein 3-a protein_id : XP_001474940.1

name	LOC100040556 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268317 GeneID:100040556
definition	codon_start : 1 product : similar to synaptotagmin-like protein 3-a protein_id : XP_001474951.1

name	LOC100040603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268332 GeneID:100040603
definition	codon_start : 1 product : similar to tctex-1 protein isoform 4 protein_id : XP_001475698.1

name	LOC100040603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268328 GeneID:100040603
definition	codon_start : 1 product : similar to tctex-1 protein isoform 1 protein_id : XP_001475652.1

name	LOC100040603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268330 GeneID:100040603
definition	codon_start : 1 product : similar to tctex-1 protein isoform 2 protein_id : XP_001475667.1

name	LOC100040603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268334 GeneID:100040603
definition	codon_start : 1 product : similar to tctex-1 protein isoform 3 protein_id : XP_001475681.1

name	LOC100040631 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268338 GeneID:100040631
definition	codon_start : 1 product : similar to tctex-1 protein isoform 4 protein_id : XP_001475852.1

name	LOC100040631 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268340 GeneID:100040631
definition	codon_start : 1 product : similar to tctex-1 protein isoform 1 protein_id : XP_001475796.1

name	LOC100040631 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268342 GeneID:100040631
definition	codon_start : 1 product : similar to tctex-1 protein isoform 2 protein_id : XP_001475814.1

name	LOC100040631 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268344 GeneID:100040631
definition	codon_start : 1 product : similar to tctex-1 protein isoform 3 protein_id : XP_001475832.1

name	LOC100040616 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268336 GeneID:100040616
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475035.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878233 CCDS:CCDS28372.1 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : synaptotagmin-like 3 isoform a protein_id : NP_113572.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368578 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform 3SI is encoded by transcript variant 2 product : synaptotagmin-like 3 isoform 3SI protein_id : NP_899223.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368586 CCDS:CCDS28373.1 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform 3SII is encoded by transcript variant 4 product : synaptotagmin-like 3 isoform 3SII protein_id : NP_899225.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368590 CCDS:CCDS28373.1 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant 3 product : synaptotagmin-like 3 isoform b protein_id : NP_899224.1

name	Sytl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368588 CCDS:CCDS28374.1 GeneID:83672 MGI:1933367
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005544 - calcium-dependent phospholipid binding [Evidence IDA]; GO:0042043 - neurexin binding [Evidence IDA]; GO:0005543 - phospholipid binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] [Evidence NAS] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 note : isoform 3SIII is encoded by transcript variant 5 product : synaptotagmin-like 3 isoform 3SIII protein_id : NP_899226.1

name	Vil2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921618 GeneID:22350 MGI:98931
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0045177 - apical part of cell [Evidence IDA]; GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005932 - basal body [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0001931 - uropod [Evidence IDA] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0051017 - actin filament bundle formation [Evidence ISS]; GO:0035088 - establishment and/or maintenance of apical/basal cell polarity [Evidence IMP]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 note : ezrin; cytovillin product : villin 2 protein_id : NP_033536.2

name	LOC100040654 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268346 GeneID:100040654
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475080.1

name	Rshl2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268348 GeneID:100037282 MGI:3630308
definition	codon_start : 1 product : radial spokehead-like 2B protein_id : XP_001475870.1

name	1700122H20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268350 GeneID:73617 MGI:1920867
definition	codon_start : 1 product : hypothetical protein LOC73617 protein_id : XP_001475913.1

name	Tagap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165396 GeneID:380608 MGI:1919786
definition	codon_start : 1 exception : mismatches in translation product : T-cell activation GTPase activating protein 1 protein_id : NP_671511.1

name	LOC666919 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666919
definition	number : 4 pseudo : _no_value

name	LOC666919 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666919
definition	number : 3 pseudo : _no_value

name	LOC666919 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666919
definition	number : 2 pseudo : _no_value

name	LOC666919 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666919
definition	number : 1 pseudo : _no_value

name	LOC100040352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040352
definition	number : 1 pseudo : _no_value

name	LOC666951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666951
definition	number : 1 pseudo : _no_value

name	LOC666951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666951
definition	number : 2 pseudo : _no_value

name	LOC666951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666951
definition	number : 3 pseudo : _no_value

name	LOC666951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666951
definition	number : 4 pseudo : _no_value

name	LOC100040525 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268303 GeneID:100040525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 257 ESTs, 1 Protein product : similar to G protein-coupled receptor 178 pseudo : _no_value transcript_id : XR_031953.1

name	LOC100040596 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268326 GeneID:100040596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 250 ESTs, 1 Protein product : similar to G protein-coupled receptor 178 pseudo : _no_value transcript_id : XR_032013.1

clone name	MSMg01-201C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482D20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462D07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-393E13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-119O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367K24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471O03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-108C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-134C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-291H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-213H15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-487K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495I20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-201G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-176I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137O11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466F01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-375N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421H18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-421P16
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-309N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-221B16.b	B6Ng01-221B16.g
ACC	GA036487	GA036488
length	1,038	1,125
definition	B6Ng01-221B16.b	B6Ng01-221B16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(6,034,632 - 6,035,677)	(6,172,248 - 6,173,373)
sequence	gaattctccacatgctgaaggagggcgtgtttagaagtcagaggacgttg ctgaggggttgtacagcacagacagtctcagtttttactgagaaacaaat ggaagtagagtgtatccctacaatggtgtattggccaaccacaggagtga agctgtacatagtgcagtgcgggcaagccttgaacatgttacactgagtt aatgaagggaggcacagagtcagacactgtgtgcttccatgtgtccatgt gctgtggtagggagatctgtagagacagaaagctctggaaagaaatgagt ctcagcaacaacaacaaaaatatcttaaacttggatagtagtgatgtgtg tgctacttggtgagtgcattaaatagcatgaaaatggttagattttaagg taggtgaattatatttcgatgaaatttatttgagggcacaccgccctaga gatgcatggtagtggaggtttgaagtttgaggtctccccaccatctccat gaaaggctgtcctattcacactcctattgagacttttgctatgtggctcc tctccttgagaaatatatgacgctttccatatggtgtcagggtctcagct gtctttcctcgggcccccatacctgcgacagaggtgcagagctggggcga gacctagctgtctaggtctatccttaaggacctctttgtgactctatgaa aacacacttggattaatagggcactgagatgagatgtagactcccatgcc cttgtacttgagcaagtgattttgtttcaggggtcccggaatcagcccca ggtgccatacccctgagaaaccaagggtcttctaagccagaggccacctg gggcccagccctgccccgccggcctgctccaagggttccacttatgaaga aaccaacttttgaggagggacaggaaaggtagaagtccaaccatgtgagc tacctatcaaggttgcttaggtcttgcttacataaatttctgtcaggaca gaaatgagatggattcagttctctcccataccgtatcc	gaattctgaattgagatgtgacagtaattggaaatgtggtcctagcaagc ttctttaccccaagttctaattggcacggctgagtaggtggtaactcaga gtggaagcaggagactttgccattgattctcggtttaaaactgaagtgga agggctggtgtttgcttggctggttcactctcatttcctctcctgtctgc actgcacagctgcctgccttatctcccagtagcttatttcctgctctcta cagcctgccagcctgcttggcagccttaggacataccagagtgttgagga attaccagacagggtcagctgggatctcagctgcccagattgtgtagtta ggtgctatggatccacctaggcatcctagccacagctttcctgcccttct aaagggaacaggattcattcagtctgtgcaccaaaagcctcccccagcta gggtgttagctgaaggctgcattcatctgggagggggaaaaagtgagcta agttttaattcatgcctttgagtattcaaaaagaaaaacctatggctgtc tcgtataagatgcagcctaccgttttatagcatggcagctaacaaatatt tattgaaattattaaagtcagaataaaagcacaggacaggacctctggaa gcatattcggattctaagctgaggtgcaagcatgctggttcacttcctct aatagaattacttctagggaaagcaaagtaagttgccaattagtgccaat gctgggcctctgaagcagcaccctccaaacggtgggcgtgcccacaggaa atgacacatcaggagcgaccgcattaccagggttcagggactttaccttt aatctaagaagaacacaattttgaacaatttttttttaaaaagccttatt aacaaacaatcctgtgataatcaccacccaatttcatctaattctataat tttattaagtgaaacaacagcaagtccaactacattagccatgatagttt attttaactatcattcatggaatggcaatactaacaaggagaatcagcag attcatgcatttccattcaaattcaataacatctcacagaacttaaatta aaaaccacactaaagctatacagca
quality values	Open. Hide. 58 29 22 37 58 58 58 58 38 30 43 38 62 62 62 62 62 62 62 54 62 62 54 62 47 47 62 62 62 62 62 44 44 43 56 56 43 59 59 29 31 62 56 49 59 46 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 59 59 62 59 62 59 59 54 62 62 62 62 62 62 62 59 56 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 59 62 54 59 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 56 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 54 62 62 59 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 54 62 62 62 56 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 59 62 62 62 62 59 62 62 59 62 62 59 54 49 54 62 62 62 59 62 54 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 49 54 62 62 62 62 62 56 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 56 56 43 56 56 62 54 47 62 62 62 62 62 38 54 62 62 62 50 56 56 62 62 62 62 62 62 62 62 62 62 56 62 47 62 62 62 62 62 62 47 43 62 62 62 62 62 52 62 62 62 54 62 62 62 62 62 62 62 62 42 62 62 62 52 47 62 62 54 62 62 52 58 58 58 54 58 54 54 39 54 52 58 58 54 54 58 58 41 41 41 49 48 52 58 58 53 53 52 54 58 58 54 58 58 58 58 54 42 45 46 52 48 54 48 54 47 52 54 46 58 53 54 52 52 52 54 46 42 32 54 52 58 35 58 54 52 52 50 23 48 17 50 49 48 54 47 47 47 50 58 39 42 26 58 47 42 23 50 50 49 41 52 36 31 40 43 48 46 51 39 52 34 47 50 47 47 48 29 54 50 32 49 39 51 48 58 58 44 46 50 47 39 53 50 46 32 35 37 46 27 28 30 37 30 49 40 26 19 6 12 49 28 16 10 23 36 53 42 41 58 49 37 31 39 39 40 39 20 41 39 41 41 28 24 16 21 15 47 37 54 35 41 46 54 39 29 28 42 32 54 47 33 41 37 29 31 39 52 16 15 42 32 41 30 35 28 20 27 37 24 54 54 51 42 40 54 42 39 34 17 44 27 23 21 53 54 45 28 52 31 20 17 30 35 31 40 45 40 53 19 6 25 5 23 15 31 17 34 26 30 47 41 33 27 32 47 15 42 32 32 24 20 12 25 15 40 9 14 29 24 29 21 17 18 27 14 27 31 31 12 45 6 40 12 18 23 32 11 31 32 27 32 9 15 23 25 18 17 9 37 19 13 21 18 26 21 30 12 6 8 10 28 31 24 25 28 23 31 12 27 20 19 21 43 31 20 19 46 33 9 14 8 31 33 38 23 30 32 20 18 36 21 21 18 15 19 21 32 43 48 9 10 21 15 6 26 7 39 11 25 15 17 29 20 19 30 16 9 20 11 28 17 38 14 13 10 6 11 22 29 14 31 22 16 31 23 32 15 15 22 7 5 20 13 10 9 11 8 5 8 25 30 18 19 33 23 12 25 4 4 4 6 21 12 19 30 7 5 10 21 8 5 11 9 31 10 10 34 24 9 7 14 8 25 34 9 15 10 13 21 15 15 33 24 7 9 43 8 28 7 11 21 9 13 27 19 22 10 27 9 12 17 5 5 4 15 11 12 24 11 30 7 10 7 5 4 7 7	Open. Hide. 62 49 34 47 62 62 43 36 62 62 54 56 56 50 27 28 28 44 44 49 44 59 59 62 62 62 62 62 62 62 46 62 62 62 59 59 59 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 59 51 59 54 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 59 59 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 51 62 54 62 59 62 62 62 59 59 56 49 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 54 51 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 62 62 62 62 62 56 56 50 38 56 56 62 62 62 62 62 56 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 56 62 62 48 62 62 62 62 62 48 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 42 62 62 62 62 62 62 62 58 58 54 54 58 58 58 54 54 58 58 58 58 58 58 41 46 58 54 58 58 42 58 58 58 58 58 58 58 54 58 54 54 54 54 58 45 41 58 58 49 41 52 58 54 43 39 52 54 58 58 52 58 58 58 54 58 58 54 54 52 54 54 50 52 52 38 58 42 43 48 58 58 47 39 48 47 45 51 49 47 47 48 49 58 51 50 50 50 50 48 38 51 58 47 49 49 51 58 49 50 47 47 40 42 49 51 53 53 58 34 44 58 58 49 47 41 29 48 51 49 36 41 50 58 58 40 41 52 40 36 58 37 50 29 50 44 41 42 51 33 51 43 50 58 51 46 53 47 58 31 37 58 50 58 49 49 51 50 49 32 52 39 53 40 49 47 58 36 44 44 40 40 53 41 53 49 32 52 42 50 39 12 29 29 41 40 50 49 40 50 25 50 49 32 40 58 58 50 41 42 39 42 53 53 32 36 34 49 33 33 53 42 37 29 53 46 29 49 34 38 21 39 53 35 45 26 44 50 39 54 38 29 35 42 40 28 17 40 35 50 15 6 13 42 25 44 22 29 44 24 39 28 16 13 14 22 9 44 33 43 33 40 51 54 31 22 35 34 53 31 33 51 49 28 37 37 29 42 37 41 40 30 25 35 27 21 41 27 31 19 40 11 29 36 30 34 35 45 42 27 46 51 21 38 15 11 41 38 41 34 25 34 29 27 19 32 24 32 40 9 7 9 14 10 32 19 33 15 22 23 31 12 12 22 29 18 17 23 32 40 30 12 28 29 11 9 40 31 31 17 24 37 35 32 22 24 42 51 14 33 28 29 37 30 22 11 19 33 46 14 26 44 13 16 28 30 31 25 46 46 7 20 8 46 32 16 32 20 48 46 48 48 48 48 46 36 30 46 36 32 9 18 9 28 14 25 14 8 18 20 22 31 18 39 41 24 10 11 12 21 21 10 27 33 30 23 13 17 23 12 30 11 27 30 16 31 44 31 25 15 31 31 7 9 15 27 33 13 8 12 31 25 31 24 14 15 31 11 9 43 43 16 15 32 31 21 25 13 7 19 31 48 24 25 7 25 38 17 22 36 18 19 19 19 14 27 8 14 14 22 23 31 9 20 11 23 7 12 39 23 21 21 29 9 27 28 21 48 14 9 32 48 48 37 17 20 22 31 14 34 37 15 32 6 7 13 21 23 26 9 16 16 17 25 20 22 17 10 6 5 18 8 5 29 10 28 9 6 21 7 29 7 3 5 11 5 16 6 6 11 7 27 23 10 4 10 21 20 10 29 10 27 34 14 15 9 4 3 18 8 25 7 13 4 7 26 27 11 25 6 13 7 6 3 3 10 11 13 9 26 19 7 19 11 20 7 5 8 6 6 13 24 10 6 4 21 10 6 9 5 5 4 2 1 3 8 12 14 8 21 6 18 12 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_6034632_6035677
seq2: B6Ng01-221B16.b_47_1084

seq1  GAATTCTCCACATGCTGAAGGAGGGCGTGTTTAGAAGTCAGAGGACGTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCCACATGCTGAAGGAGGGCGTGTTTAGAAGTCAGAGGACGTTG  50

seq1  CTGAGGGGTTGTACAGCACAGACAGTCTCAGTTTTTACTGAGAAACAAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGGGGTTGTACAGCACAGACAGTCTCAGTTTTTACTGAGAAACAAAT  100

seq1  GGAAGTAGAGTGTATCCCTACAATGGTGTATTGGCCAACCACAGGAGTGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGTAGAGTGTATCCCTACAATGGTGTATTGGCCAACCACAGGAGTGA  150

seq1  AGCTGTACATAGTGCAGTGCGGGCAAGCCTTGAACATGTTACACTGAGTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGTACATAGTGCAGTGCGGGCAAGCCTTGAACATGTTACACTGAGTT  200

seq1  AATGAAGGGAGGCACAGAGTCAGACACTGTGTGCTTCCATGTGTCCATGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAAGGGAGGCACAGAGTCAGACACTGTGTGCTTCCATGTGTCCATGT  250

seq1  GCTGTGGTAGGGAGATCTGTAGAGACAGAAAGCTCTGGAAAGAAATGAGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTGGTAGGGAGATCTGTAGAGACAGAAAGCTCTGGAAAGAAATGAGT  300

seq1  CTCAGCAACAACAACAAAAATATCTTAAACTTGGATAGTAGTGATGTGTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGCAACAACAACAAAAATATCTTAAACTTGGATAGTAGTGATGTGTG  350

seq1  TGCTACTTGGTGAGTGCATTAAATAGCATGAAAATGGTTAGATTTTAAGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTACTTGGTGAGTGCATTAAATAGCATGAAAATGGTTAGATTTTAAGG  400

seq1  TAGGTGAATTATATTTCGATGAAATTTATTTGAGGGCACACCGCCCTAGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTGAATTATATTTCGATGAAATTTATTTGAGGGCACACCGCCCTAGA  450

seq1  GATGCATGGTAGTGGAGGTTTGAAGTTTGAGGTCTCCCCACCATCTCCAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCATGGTAGTGGAGGTTTGAAGTTTGAGGTCTCCCCACCATCTCCAT  500

seq1  GAAAGGCTGTCCTATTCACACTCCTATTGAGACTTTTGCTATGTGGCTCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGCTGTCCTATTCACACTCCTATTGAGACTTTTGCTATGTGGCTCC  550

seq1  TCTCCTTGAGAAATATATGACGCTTTCCATATGGTGTCAGGGTCTCAGCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCTTGAGAAATATATGACGCTTTCCATATGGTGTCAGGGTCTCAGCT  600

seq1  GTCTTTCCTCGGGCCCCCATACCTGCGACAGAGGTGCAGAGCTGGGGCGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTTCCTCGGGCCCCCATACCTGCGACAGAGGTGCAGAGCTGGGGCGA  650

seq1  GACCTAGCTGTCTAGGTCTATCCTTAAGGACCTCTTTGTGACTCTATGAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTAGCTGTCTAGGTCTATCCTTAAGGACCTCTTTGTGACTCTATGAA  700

seq1  AACACAC-TGGATTAATAGGGCACTGAGATGAGATGTAGACTCCCATGCC  749
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  AACACACTTGGATTAATAGGGCACTGAGATGAGATGTAGACTCCCATGCC  750

seq1  CTTGTACTTGAGCAAGTGATTTTGTTTCAGGGGTCCCGGAATCAGCCCCA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTACTTGAGCAAGTGATTTTGTTTCAGGGGTCCCGGAATCAGCCCCA  800

seq1  GGTGCCATACCCCTGAGAAACCAAGGGTCTTCTAAGCCAGAGGCCACCCT  849
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  GGTGCCATACCCCTGAGAAACCAAGGGTCTTCTAAGCCAGAGGCCA-CCT  849

seq1  GGGGCCCCCAGCCCTGCCCCGCCGGCCTGCTCCAAGGGTTCCCACTATGA  899
      ||||  ||||||||||||||||||||||||||||||||||||   |||||
seq2  GGGG--CCCAGCCCTGCCCCGCCGGCCTGCTCCAAGGGTTCCACTTATGA  897

seq1  AGAAACCAAC-TTTGAGGA-GGACAGGAAAGGTAAGAAGTCAAACCATGT  947
      |||||||||| |||||||| ||||||||||||| ||||||| ||||||||
seq2  AGAAACCAACTTTTGAGGAGGGACAGGAAAGGT-AGAAGTCCAACCATGT  946

seq1  GAGCTACCCATTCCAAGGTTGCTTAAGGTCTTGC-TACATAAAATTCTGT  996
      |||||||| ||  ||||||||||| ||||||||| |||||||| ||||||
seq2  GAGCTACCTAT--CAAGGTTGCTT-AGGTCTTGCTTACATAAATTTCTGT  993

seq1  CAAGGACAGAAATGAAGATGGATTCAGTTTCTCAACCCATACCCGTATCC  1046
      | |||||||||||| |||||||||||| |||||  |||||| ||||||||
seq2  C-AGGACAGAAATG-AGATGGATTCAG-TTCTC-TCCCATA-CCGTATCC  1038

seq1: chr17_6172248_6173373
seq2: B6Ng01-221B16.g_66_1190 (reverse)

seq1  TGCTGTATAGATGTTAGTTGTTGTTTTTGATTTAAGTTCTGTGAAGAATG  50
      |||||||||| | |||| ||| |||||| |||||||||||||||   |||
seq2  TGCTGTATAGCT-TTAG-TGTGGTTTTTAATTTAAGTTCTGTGA--GATG  46

seq1  TTATTGGAATTTTGATGGGAATTGCATTGAATCTGCTGATTTCTCTTGTT  100
      ||||||  | |||||  |||| |||| ||||||||||||||   ||||||
seq2  TTATTG--AATTTGAATGGAAATGCA-TGAATCTGCTGATTCTCCTTGTT  93

seq1  AATATTGCCATTTCCATG-ATGATAGTTAAAAT-AACTATCATGGCTTAT  148
      | |||||||| ||||||| |||||||||||||| ||||||||||||| ||
seq2  AGTATTGCCA-TTCCATGAATGATAGTTAAAATAAACTATCATGGCTAAT  142

seq1  GTAGTTGGACTTGCTGTTGTTTCACTTAAT-AAATTATAGAATTAGATG-  196
      |||||||||||||||||||||||||||||| |||||||||||||||||| 
seq2  GTAGTTGGACTTGCTGTTGTTTCACTTAATAAAATTATAGAATTAGATGA  192

seq1  AATTGGGTGGTGATTATCACAGGATTGTTTGTT-ATAAGGCTTTTT-AAA  244
      ||||||||||||||||||||||||||||||||| |||||||||||| |||
seq2  AATTGGGTGGTGATTATCACAGGATTGTTTGTTAATAAGGCTTTTTAAAA  242

seq1  AAAAATTGTTC-AAATTGTGTTCTTCTTAGATTAAAGGTAAAGTCCCTGA  293
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AAAAATTGTTCAAAATTGTGTTCTTCTTAGATTAAAGGTAAAGTCCCTGA  292

seq1  ACCCTGGTAATGCGGTCGCTCCCTGATGTGTCATTTCCTGTGGGCACGCC  343
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  ACCCTGGTAATGCGGTCGCT-CCTGATGTGTCATTTCCTGTGGGCACGCC  341

seq1  CACCGTTTGGAGGGTGCTGCTTCAGAGGCCCAGCATTGGCACTAATTGGC  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCGTTTGGAGGGTGCTGCTTCAGAGGCCCAGCATTGGCACTAATTGGC  391

seq1  -ACTTACTTTGCTTTCCCTAGAAGTAATTCTATTAGAGGAAGTGAACCAG  442
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTACTTTGCTTTCCCTAGAAGTAATTCTATTAGAGGAAGTGAACCAG  441

seq1  CATGCTTGCACCTCAGCTTAGAATCCGAATATGCTTCCAGAGGTCCTGTC  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCTTGCACCTCAGCTTAGAATCCGAATATGCTTCCAGAGGTCCTGTC  491

seq1  CTGTGCTTTTATTCTGACTTTAATAATTTCAATAAATATTTGTTAGCTGC  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGCTTTTATTCTGACTTTAATAATTTCAATAAATATTTGTTAGCTGC  541

seq1  CATGCTATAAAACGGTAGGCTGCATCTTATACGAGACAGCCATAGGTTTT  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCTATAAAACGGTAGGCTGCATCTTATACGAGACAGCCATAGGTTTT  591

seq1  TCTTTTTGAATACTCAAAGGCATGAATTAAAACTTAGCTCACTTTTTCCC  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTTTGAATACTCAAAGGCATGAATTAAAACTTAGCTCACTTTTTCCC  641

seq1  CCTCCCAGATGAATGCAGCCTTCAGCTAACACCCTAGCTGGGGGAGGCTT  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCAGATGAATGCAGCCTTCAGCTAACACCCTAGCTGGGGGAGGCTT  691

seq1  TTGGTGCACAGACTGAATGAATCCTGTTCCCTTTAGAAGGGCAGGAAAGC  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTGCACAGACTGAATGAATCCTGTTCCCTTTAGAAGGGCAGGAAAGC  741

seq1  TGTGGCTAGGATGCCTAGGTGGATCCATAGCACCTAACTACACAATCTGG  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGGCTAGGATGCCTAGGTGGATCCATAGCACCTAACTACACAATCTGG  791

seq1  GCAGCTGAGATCCCAGCTGACCCTGTCTGGTAATTCCTCAACACTCTGGT  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCTGAGATCCCAGCTGACCCTGTCTGGTAATTCCTCAACACTCTGGT  841

seq1  ATGTCCTAAGGCTGCCAAGCAGGCTGGCAGGCTGTAGAGAGCAGGAAATA  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCCTAAGGCTGCCAAGCAGGCTGGCAGGCTGTAGAGAGCAGGAAATA  891

seq1  AGCTACTGGGAGATAAGGCAGGCAGCTGTGCAGTGCAGACAGGAGAGGAA  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTACTGGGAGATAAGGCAGGCAGCTGTGCAGTGCAGACAGGAGAGGAA  941

seq1  ATGAGAGTGAACCAGCCAAGCAAACACCAGCCCTTCCACTTCAGTTTTAA  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGAGTGAACCAGCCAAGCAAACACCAGCCCTTCCACTTCAGTTTTAA  991

seq1  ACCGAGAATCAATGGCAAAGTCTCCTGCTTCCACTCTGAGTTACCACCTA  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCGAGAATCAATGGCAAAGTCTCCTGCTTCCACTCTGAGTTACCACCTA  1041

seq1  CTCAGCCGTGCCAATTAGAACTTGGGGTAAAGAAGCTTGCTAGGACCACA  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGCCGTGCCAATTAGAACTTGGGGTAAAGAAGCTTGCTAGGACCACA  1091

seq1  TTTCCAATTACTGTCACATCTCAATTCAGAATTC  1126
      ||||||||||||||||||||||||||||||||||
seq2  TTTCCAATTACTGTCACATCTCAATTCAGAATTC  1125

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information