MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-309D23
Chromosome	17 (Build37)
Map Location	22,743,193 - 22,912,960
singlet/doublet	doublet
Overlap gene	EG628185, ENSMUSG00000046088, EG383218, EG433078
Upstream gene	Zfp760, BC043476, 4930515G13Rik, 2610036F08Rik, LOC624960, 3110048L19Rik, 4930432O21Rik, LOC665820, LOC665825, LOC674332, LOC631010, EG665844, EG210853, LOC671007, EG240038, EG631624, 6330416L07Rik, Zfp758, 1300003B13Rik, EG210876, LOC100042656
Downstream gene	LOC100042679, A630033E08Rik, LOC671128, LOC665961, EG434701, LOC665976, LOC100042225, LOC100042234, EG665988, LOC100042248, Zfp40, LOC100042257, LOC100042261, Vmn2r-ps133, EG666002, EG638102, EG619697, EG619775, EG619788, Olfr752-ps1, EG666030, EG381070, Zfp213, Zfp13, Zscan10, LOC666062, Mmp25, LOC665757, BC038613, Thoc6, Hcfc1r1, Tnfrsf12a, Cldn6, Cldn9, EG666080, 1520401A03Rik, Pkmyt1, Paqr4, Kremen2, 9530082P21Rik, Flywch1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zfp760 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240034 MGI:2679257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC043476 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381067 MGI:2679295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 23 ESTs, 1 Protein

name	4930515G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75098 MGI:1922348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	2610036F08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75424 MGI:1922674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 22 Proteins pseudo : _no_value

name	3110048L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73233 MGI:1920483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs pseudo : _no_value

name	4930432O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74670 MGI:1921920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665820 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC665825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 83 ESTs, 35 Proteins pseudo : _no_value

name	LOC674332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs pseudo : _no_value

name	LOC631010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	EG665844 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665844 MGI:3643608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	EG210853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210853 MGI:3646759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 110 ESTs, 3 Proteins pseudo : _no_value

name	EG240038 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240038 MGI:3643318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs, 1 Protein

name	EG631624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631624 MGI:3648314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein

name	6330416L07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319615 MGI:2442394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224598 MGI:2385044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300003B13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74149 MGI:1921399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG210876 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210876 MGI:3647034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 Proteins

name	LOC100042656 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG628185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628185 MGI:3644292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 Proteins

name	ENSMUSG00000046088 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194612 MGI:3642566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG383218 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383218 MGI:3647439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	EG433078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433078 MGI:3644511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	A630033E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240041 MGI:2445132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins pseudo : _no_value

name	LOC665961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG434701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434701 MGI:3648972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	LOC665976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins pseudo : _no_value

name	LOC100042225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	LOC100042234 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG665988 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665988 MGI:3644410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100042248 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zfp40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22700 MGI:99185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042257 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638056
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	EG666002 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666002 MGI:3648252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	EG638102 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638102 MGI:3647235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG619697 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619697 MGI:3646674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	EG619775 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619775 MGI:3648606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG619788 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619788 MGI:3648766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Olfr752-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257878 MGI:3030586
definition	gene_synonym : MOR220-4P note : olfactory receptor 752, pseudogene 1 pseudo : _no_value

name	EG666030 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666030 MGI:3645045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 8 Proteins pseudo : _no_value

name	EG381070 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381070 MGI:3646305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Zfp213 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:449521 MGI:3053094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22654 MGI:99159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zscan10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:332221 MGI:3040700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Mmp25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240047 MGI:2443938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665757 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	BC038613 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212733 MGI:2388267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thoc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386612 MGI:2677480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcfc1r1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353502 MGI:2663619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnfrsf12a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27279 MGI:1351484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54419 MGI:1859284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56863 MGI:1913100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666080 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666080 MGI:3649130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	1520401A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320309 MGI:2443785
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkmyt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268930 MGI:2137630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paqr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76498 MGI:1923748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kremen2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73016 MGI:1920266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9530082P21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638247 MGI:3603340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs

name	Flywch1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224613 MGI:2442638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp760 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56605853 GeneID:240034 MGI:2679257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 760 transcript_id : NM_001008501.1

name	BC043476 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401701 GeneID:381067 MGI:2679295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 1 Protein product : cDNA sequence BC043476, transcript variant 2 transcript_id : XM_892560.2

name	BC043476 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268612 GeneID:381067 MGI:2679295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 1 Protein product : cDNA sequence BC043476, transcript variant 1 transcript_id : XM_354987.5

name	4930515G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268613 GeneID:75098 MGI:1922348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930515G13 gene transcript_id : XM_979393.2

name	2610036F08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677475 GeneID:75424 MGI:1922674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610036F08 gene transcript_id : NM_029281.1

name	4930432O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268459 GeneID:74670 MGI:1921920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930432O21 gene transcript_id : XM_001471514.1

name	LOC631010 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268617 GeneID:631010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : similar to EG635895 protein transcript_id : XM_001478616.1

name	EG210853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130448 GeneID:210853 MGI:3646759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG210853 transcript_id : NM_177596.3

name	EG240038 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268619 GeneID:240038 MGI:3643318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs, 1 Protein product : predicted gene, EG240038, transcript variant 1 transcript_id : XM_139814.9

name	6330416L07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802178 GeneID:319615 MGI:2442394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330416L07 gene transcript_id : NM_176962.3

name	Zfp758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842386 GeneID:224598 MGI:2385044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 758 transcript_id : NM_145484.2

name	1300003B13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371067 GeneID:74149 MGI:1921399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300003B13 gene transcript_id : NM_198003.2

name	EG210876 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268576 GeneID:210876 MGI:3647034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 Proteins product : predicted gene, EG210876 transcript_id : XM_139816.6

name	LOC100042656 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268624 GeneID:100042656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042656 transcript_id : XM_001478701.1

name	EG628185 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268577 GeneID:628185 MGI:3644292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 Proteins product : predicted gene, EG628185 transcript_id : XM_892918.3

name	ENSMUSG00000046088 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268578 GeneID:194612 MGI:3642566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, ENSMUSG00000046088 transcript_id : XM_001477677.1

name	EG383218 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268628 GeneID:383218 MGI:3647439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG383218 transcript_id : XM_001478718.1

name	EG383218 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268626 GeneID:383218 MGI:3647439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG383218, transcript variant 1 transcript_id : XM_356928.5

name	EG433078 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401745 GeneID:433078 MGI:3644511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG433078 transcript_id : XM_484608.3

name	LOC100042679 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268630 GeneID:100042679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042679 transcript_id : XM_001478735.1

name	A630033E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381579 GeneID:240041 MGI:2445132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630033E08 gene transcript_id : NM_177358.3

name	EG434701 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268583 GeneID:434701 MGI:3648972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG434701 transcript_id : XM_486573.4

name	LOC100042225 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268584 GeneID:100042225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins product : similar to putative pheromone receptor transcript_id : XM_001477755.1

name	EG665988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268586 GeneID:665988 MGI:3644410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG665988 transcript_id : XM_980741.2

name	Zfp40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374191 GeneID:22700 MGI:99185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 40 transcript_id : NM_009555.2

name	EG666002 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268590 GeneID:666002 MGI:3648252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : predicted gene, EG666002 transcript_id : XM_980871.2

name	EG638102 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268592 GeneID:638102 MGI:3647235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG638102 transcript_id : XM_980908.2

name	EG619697 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268593 GeneID:619697 MGI:3646674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins product : predicted gene, EG619697 transcript_id : XM_884066.3

name	EG619775 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401756 GeneID:619775 MGI:3648606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG619775 transcript_id : XM_884146.2

name	EG619788 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268594 GeneID:619788 MGI:3648766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG619788 transcript_id : XM_884160.3

name	EG381070 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268641 GeneID:381070 MGI:3646305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG381070 transcript_id : XM_001478765.1

name	Zfp213 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372179 GeneID:449521 MGI:3053094
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 213 transcript_id : NM_001033496.2

name	Zfp13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802256 GeneID:22654 MGI:99159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 13 transcript_id : NM_011747.2

name	Zscan10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803483 GeneID:332221 MGI:3040700
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and SCAN domains 10 transcript_id : NM_001033425.2

name	Mmp25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802536 GeneID:240047 MGI:2443938
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 25 transcript_id : NM_001033339.2

name	BC038613 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802304 GeneID:212733 MGI:2388267
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC038613 transcript_id : NM_153784.2

name	Thoc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56605679 GeneID:386612 MGI:2677480
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THO complex 6 homolog (Drosophila) transcript_id : NM_001008425.1

name	Hcfc1r1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32451499 GeneID:353502 MGI:2663619
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : host cell factor C1 regulator 1 (XPO1-dependent) transcript_id : NM_181821.1

name	Tnfrsf12a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305058 GeneID:27279 MGI:1351484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 12a transcript_id : NM_013749.1

name	Cldn6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382484 GeneID:54419 MGI:1859284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 6 transcript_id : NM_018777.3

name	Cldn9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098101 GeneID:56863 MGI:1913100
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 9 transcript_id : NM_020293.2

name	EG666080 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401762 GeneID:666080 MGI:3649130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : predicted gene, EG666080 transcript_id : XM_981456.1

name	1520401A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359763 GeneID:320309 MGI:2443785
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1520401A03 gene transcript_id : NM_177132.3

name	Pkmyt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389041 GeneID:268930 MGI:2137630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, membrane associated tyrosine/threonine 1 transcript_id : NM_023058.3

name	Paqr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130648 GeneID:76498 MGI:1923748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progestin and adipoQ receptor family member IV transcript_id : NM_023824.3

name	Kremen2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703353 GeneID:73016 MGI:1920266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kringle containing transmembrane protein 2 transcript_id : NM_028416.1

name	9530082P21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401764 GeneID:638247 MGI:3603340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs product : RIKEN cDNA 9530082P21 gene transcript_id : XM_895607.1

name	Flywch1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418894 GeneID:224613 MGI:2442638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FLYWCH-type zinc finger 1 transcript_id : NM_153791.1

name	Zfp760 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605854 GeneID:240034 MGI:2679257
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 760 protein_id : NP_001008501.1

name	BC043476 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38081804 GeneID:381067 MGI:2679295
definition	codon_start : 1 product : similar to BC043476 protein isoform 1 protein_id : XP_354987.1

name	BC043476 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986296 GeneID:381067 MGI:2679295
definition	codon_start : 1 product : similar to BC043476 protein isoform 2 protein_id : XP_897653.1

name	4930515G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401731 GeneID:75098 MGI:1922348
definition	codon_start : 1 product : hypothetical protein LOC75098 protein_id : XP_984487.1

name	2610036F08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677476 GeneID:75424 MGI:1922674
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75424 protein_id : NP_083557.1

name	4930432O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268460 GeneID:74670 MGI:1921920
definition	codon_start : 1 product : hypothetical protein LOC74670 protein_id : XP_001471564.1

name	LOC631010 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268618 GeneID:631010
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_001478666.1

name	EG210853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243956 GeneID:210853 MGI:3646759
definition	codon_start : 1 product : hypothetical protein LOC210853 protein_id : NP_808264.1

name	EG240038 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268620 GeneID:240038 MGI:3643318
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_139814.9

name	6330416L07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892783 GeneID:319615 MGI:2442394
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319615 protein_id : NP_795936.1

name	Zfp758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842387 GeneID:224598 MGI:2385044
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 758 protein_id : NP_663459.2

name	1300003B13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574094 GeneID:74149 MGI:1921399
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74149 protein_id : NP_932120.1

name	EG210876 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986795 GeneID:210876 MGI:3647034
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_139816.4

name	LOC100042656 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268625 GeneID:100042656
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478751.1

name	EG628185 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986799 GeneID:628185 MGI:3644292
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_898011.1

name	ENSMUSG00000046088 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268579 GeneID:194612 MGI:3642566
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477727.1

name	EG383218 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268629 GeneID:383218 MGI:3647439
definition	codon_start : 1 product : similar to endosulfine-alpha protein_id : XP_001478768.1

name	EG383218 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268627 GeneID:383218 MGI:3647439
definition	codon_start : 1 product : similar to endosulfine-alpha isoform 1 protein_id : XP_356928.5

name	EG433078 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770048 GeneID:433078 MGI:3644511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484608.1

name	LOC100042679 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268631 GeneID:100042679
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478785.1

name	A630033E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893509 GeneID:240041 MGI:2445132
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC240041 protein_id : NP_796332.1

name	EG434701 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986820 GeneID:434701 MGI:3648972
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_486573.2

name	LOC100042225 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268585 GeneID:100042225
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001477805.1

name	EG665988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268587 GeneID:665988 MGI:3644410
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_985835.2

name	Zfp40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374192 GeneID:22700 MGI:99185
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 40 protein_id : NP_033581.2

name	EG666002 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268591 GeneID:666002 MGI:3648252
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_985965.2

name	EG638102 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401754 GeneID:638102 MGI:3647235
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_986002.1

name	EG619697 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992463 GeneID:619697 MGI:3646674
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_889159.1

name	EG619775 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401757 GeneID:619775 MGI:3648606
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_889239.2

name	EG619788 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992469 GeneID:619788 MGI:3648766
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_889253.1

name	EG381070 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268642 GeneID:381070 MGI:3646305
definition	codon_start : 1 product : caspase 14-like protein protein_id : XP_001478815.1

name	Zfp213 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702031 CCDS:CCDS28449.1 GeneID:449521 MGI:3053094
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zin finger protein 213 protein_id : NP_001028668.1

name	Zfp13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27777687 CCDS:CCDS28450.1 GeneID:22654 MGI:99159
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Kruppel-related protein product : zinc finger protein 13 protein_id : NP_035877.1

name	Zscan10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701933 CCDS:CCDS28451.1 GeneID:332221 MGI:3040700
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger with KRAB and SCAN domains 10 product : zinc finger protein 206 protein_id : NP_001028597.1

name	Mmp25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677470 CCDS:CCDS28452.1 GeneID:240047 MGI:2443938
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0016504 - protease activator activity [Evidence ISS] GO_process : GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 note : matrix metalloproteinase 25 product : matrix metallopeptidase 25 protein_id : NP_001028511.1

name	BC038613 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418887 CCDS:CCDS28453.1 GeneID:212733 MGI:2388267
definition	codon_start : 1 product : hypothetical protein LOC212733 protein_id : NP_722479.1

name	Thoc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605680 CCDS:CCDS28454.1 GeneID:386612 MGI:2677480
definition	codon_start : 1 product : WD repeat domain 58 protein_id : NP_001008425.1

name	Hcfc1r1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32451500 CCDS:CCDS28455.1 GeneID:353502 MGI:2663619
definition	codon_start : 1 product : host cell factor C1 regulator 1 protein_id : NP_861542.1

name	Tnfrsf12a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305059 CCDS:CCDS28456.1 GeneID:27279 MGI:1351484
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0007155 - cell adhesion [Evidence IDA]; GO:0008219 - cell death [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0045773 - positive regulation of axon extension [Evidence IDA]; GO:0006931 - substrate-bound cell migration, cell attachment to substrate [Evidence IDA] codon_start : 1 exception : mismatches in translation function : modulates adhesion and migration note : fibroblast growth factor regulated protein 2; type I transmembrane protein Fn14 product : tumor necrosis factor receptor superfamily, member 12a protein_id : NP_038777.1

name	Cldn6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055190 CCDS:CCDS28457.1 GeneID:54419 MGI:1859284
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : tight junction molecule claudin 6 product : claudin 6 protein_id : NP_061247.1

name	Cldn9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098102 CCDS:CCDS28458.1 GeneID:56863 MGI:1913100
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : claudin-9 product : claudin 9 protein_id : NP_064689.2

name	EG666080 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401763 GeneID:666080 MGI:3649130
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986550.1

name	1520401A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893093 GeneID:320309 MGI:2443785
definition	codon_start : 1 product : hypothetical protein LOC320309 protein_id : NP_796106.1

name	Pkmyt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625699 CCDS:CCDS28460.1 GeneID:268930 MGI:2137630
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : MYT1 kinase product : membrane-associated tyrosine-and threonine-specific cdc2-inhibitory kinase protein_id : NP_075545.2

name	Paqr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963841 CCDS:CCDS28461.1 GeneID:76498 MGI:1923748
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : progestin and adipoQ receptor family member IV protein_id : NP_076313.1

name	Kremen2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703354 CCDS:CCDS28462.1 GeneID:73016 MGI:1920266
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : kringle-containing transmembrane protein 2 protein_id : NP_082692.1

name	9530082P21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401765 GeneID:638247 MGI:3603340
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900700.1

name	Flywch1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418895 CCDS:CCDS28463.1 GeneID:224613 MGI:2442638
definition	codon_start : 1 exception : mismatches in translation product : FLYWCH-type zinc finger 1 protein_id : NP_722486.1

name	LOC665820 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665820
definition	number : 1 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 6 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 5 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 4 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 3 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 2 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 1 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 1 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 2 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 3 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 4 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 5 pseudo : _no_value

name	LOC665976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665976
definition	number : 6 pseudo : _no_value

name	LOC100042234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042234
definition	number : 1 pseudo : _no_value

name	LOC100042248 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042248
definition	number : 1 pseudo : _no_value

name	LOC100042257 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042257
definition	number : 4 pseudo : _no_value

name	LOC100042257 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042257
definition	number : 3 pseudo : _no_value

name	LOC100042257 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042257
definition	number : 2 pseudo : _no_value

name	LOC100042257 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042257
definition	number : 1 pseudo : _no_value

name	LOC100042261 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042261
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 7 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638056
definition	number : 1 pseudo : _no_value

name	LOC666062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666062
definition	number : 3 pseudo : _no_value

name	LOC666062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666062
definition	number : 2 pseudo : _no_value

name	LOC666062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666062
definition	number : 1 pseudo : _no_value

name	LOC624960 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268614 GeneID:624960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 22 Proteins product : similar to Y box transcription factor pseudo : _no_value transcript_id : XR_033753.1

name	3110048L19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268616 GeneID:73233 MGI:1920483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs product : RIKEN cDNA 3110048L19 gene pseudo : _no_value transcript_id : XR_035371.1

name	LOC665825 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268615 GeneID:665825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 83 ESTs, 35 Proteins product : similar to Tropomyosin alpha-4 chain (Tropomyosin-4) (TM-4) pseudo : _no_value transcript_id : XR_033760.1

name	LOC674332 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268574 GeneID:674332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs product : hypothetical LOC674332 pseudo : _no_value transcript_id : XR_033292.1

name	EG665844 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268575 GeneID:665844 MGI:3643608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG665844 pseudo : _no_value transcript_id : XR_033298.1

name	LOC671007 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268623 GeneID:671007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 110 ESTs, 3 Proteins product : similar to Sorting nexin 4 pseudo : _no_value transcript_id : XR_033824.1

name	EG631624 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268622 GeneID:631624 MGI:3648314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : predicted gene, EG631624 transcript_id : XR_033816.1

name	LOC671128 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268582 GeneID:671128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_033358.1

name	EG666030 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94401759 GeneID:666030 MGI:3645045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 8 Proteins product : predicted gene, EG666030 pseudo : _no_value transcript_id : XR_001815.1

name	LOC665757 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268643 GeneID:665757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to 60S ribosomal protein L36 pseudo : _no_value transcript_id : XR_033924.1

clone name	MSMg01-405C22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-299J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-047D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-294O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405M24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-452H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071N02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-074L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-330B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060F20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-144N02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-272L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459B16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-122B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-320P12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-452H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-274G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-480I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-547G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-182B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064F07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-207F11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-050B11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-262E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-142K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454E09
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-038G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209G14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-309D23.b	B6Ng01-309D23.g
ACC	GA101536	GA101537
length	1,145	1,051
definition	B6Ng01-309D23.b	B6Ng01-309D23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(22,743,193 - 22,744,335)	(22,911,906 - 22,912,960)
sequence	gaattctgatgtgattagttttaatgtgtcatattcaaactgcctaattt catttgaatatctcctgttgctctggtaatatgaaatttaaacttactat tcttcctcaatgtgattaagaattccattcttagggaaaagaacatagaa gctgaaaatgaagtgaaagaactgtttatcaatctagaggataaattgaa atctcacatgttttctatccagacttcacatgagccttataaacacattt tcttgaaaaaaatttaagaatgcagtcagtgttattcatatatatctctc tatatgtctctctctatatatacgaatctcagtgtggaatctaataaaca aaaatgttcagacatcaaggaaatatttaaaacattagatttaagtaaaa gtatgttcaatgatatactaaacaaggaatcaaagaatgattttaagaat ggtaaaaaaagaaatcaaagaaaggcagtaatcacctctgggtaaataca attaaactatgaaagctttaatcactgagaccctgagtgcgaaaatgaca aaggatttcactaaattataaaataatgaaggaatttcaatatatatatg atatatataaaagaactaaaccaaataaatatatcagtaaatagtctcac aaaaggcatgctccaaattgatgattgaagaaaaaaggcttaagaagtac aaaattcaaactatgacaaggataaaacaacaagaaaaataaaattcata ggttaacaaggatgtatgattaaataataaaatttaaaaccaatgggaac aagacagaaaagaagcaactctcagtagccactgtatatccattatattg catctgtacatatcgaaaataatgtaggaaaagtagagatcggtctagta gaaacatataaataggaagcttgaaataaaaaatactcagctgttgaaat aaaaatagtccttgtcaaattttacttaaaatttatttctggaaatagag catatatgaatgcacaggggaaaatcttcagtgatggaagactcttcttt tgttaagagcaagttccacagcttcaatcatttttaaatgtagcctgctc atcattcattgaattcatttgctttctatactgaataacaattta	gaattcagtattaatttaggaattctcagaatgatcacacagggaagccc gtcttgaaggaggggagaggtggtttctcagcgagaggaggagtcacatg gtggctcaagcactgaaccttaaacaaacacaagggcagacttggttcac aggctctgaggtcccctgctgtgaaaagagacaagatgactgctccgagg cagaaagacagagagttaaagatgcctgcttcctacaagcaggtaatcat aggacataagtttaaagtttggtttatttgtttttaaagctagataaaac tacagagtttgcccatgtcacgtgtggaattccgcatgtggttcggaagt agtacagggaaaattatactgggtccaggcagagagcaaattggttgaaa ctgtctgcttcctctaggctgatatttgtagaagtgtgatttatttactt taaatatggtctaataaagtctgcaggaaaactcattcttcgaatgtagg ccccgtggggatttttgggttatatatcctgacacaacaaattaaggaaa aggcctgagaataggtttatacagcaagcaaaatgtctcttaggataata gggaaattgtatgaaaacaaatgttttaaggaagctttaaagtcatacaa ggtaactcatagtctttgaacgtgggctccacgggaattttggcttaatg tgaatttgagttttgtggttgttttattactcctctgagagagagatcaa gctaaaagttttcctggttactggctaaagggcaagctgatcgatttggg atagaggcgttgactttgtgtttgtagaaaaggtgattagactctccatc ccttccagagttatatgcatcagctatgatagagggaggcccactgaaga actagattcaagagaatcaacaaaaaatgtaacattcgttgtgccatcct tcacatggcacaaatgaagacttatgattggttatattaaaatttggctc aataaagactgtattcacatgctcaaattggcagagttcatctacctagt c
quality values	Open. Hide. 58 26 27 20 58 58 45 54 42 32 54 58 58 34 26 54 47 62 62 62 62 47 62 62 49 49 54 62 62 47 51 56 56 37 32 31 31 56 56 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 59 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 54 58 58 58 54 58 58 58 58 54 58 58 49 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 54 38 36 41 58 58 58 54 54 52 58 58 58 58 58 58 58 54 47 58 54 52 52 58 58 51 58 45 41 58 58 54 52 51 58 58 58 58 51 58 52 53 52 58 58 47 50 58 49 58 58 58 58 47 58 58 37 37 58 58 53 50 51 58 53 58 58 58 58 54 58 58 58 58 40 58 54 58 51 58 51 58 58 58 58 53 58 50 43 58 58 58 42 49 51 42 44 48 50 58 58 58 54 58 58 52 58 58 49 58 58 49 58 51 53 53 51 53 51 58 50 50 50 50 58 58 43 50 58 40 50 51 58 44 50 43 13 10 50 47 50 44 54 37 31 52 53 31 51 54 47 50 31 49 54 54 54 54 44 35 54 31 54 52 35 49 30 54 50 39 52 42 44 50 51 54 36 50 52 42 36 54 50 44 49 45 40 49 31 37 31 39 44 49 20 26 31 54 54 35 40 28 34 28 24 45 44 52 54 54 54 26 38 26 54 54 32 53 53 42 35 53 45 42 51 34 35 31 34 33 17 32 40 53 34 30 51 29 32 34 36 31 13 41 30 49 40 35 23 42 31 31 52 52 52 31 52 45 31 49 40 33 23 27 15 47 28 45 49 27 28 30 25 24 29 29 27 13 32 31 45 51 51 45 33 46 35 19 32 30 26 36 42 32 42 31 32 24 31 31 30 32 28 24 31 30 37 31 31 30 23 31 31 42 23 32 30 30 31 30 22 27 31 31 31 30 28 32 42 29 28 32 22 32 27 31 31 31 43 48 48 31 28 29 31 29 42 24 37 9 18 29 48 46 31 24 21 20 13 31 16 31 32 26 31 30 23 36 34 37 26 32 37 22 41 46 24 24 20 38 31 29 20 46 27 29 32 25 32 23 26 32 29 24 26 31 20 36 28 26 13 30 36 47 47 17 17 24 30 42 34 37 27 32 34 27 30 21 32 32 48 25 22 22 44 41 47 6 10 19 20 15 11 33 16 19 29 11 29 18 43 16 30 43 43 19 19 19 22 13 17 40 48 24 21 48 29 13 6 37 10 26 14 17 25 18 48 24 31 6 6 5 7 30 24 26 10 15 13 32 26 21 18 14 29 21 13 23 4 4 32 43 10 18 47 40 18 5 26 9 19 26 26 7 14 23 19 23 27 18 3 5 6 10 8 20 8 8 6 6 24 34 40 8 14 13 21 21 5 4 5 10 14 10 6 21 5 9 20 14 4 11 5 9 28 13 13 28 9 8 9 13 14 20 40 47 47 21 14 27 20 6 18 16 23 13 9 9 21 18 11 13 16 6 9 4 10 20 15 14 5 10 11 18 5 10 9 14 17 7 4 16 8 19 3 3 14 7 9 4 4 4 11 17 10 19 9 11 6 5 14 3 1 4 14 27 23 5	Open. Hide. 62 47 39 41 62 54 33 62 62 62 47 47 50 30 43 56 51 47 56 62 54 62 47 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 59 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 59 59 62 59 59 62 62 62 62 62 62 62 54 42 42 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 54 54 62 59 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 48 39 31 41 58 54 58 58 58 58 45 35 58 58 58 58 58 58 58 49 58 52 52 54 54 58 58 58 58 58 58 54 54 50 58 49 54 58 52 54 51 48 58 49 54 49 58 58 58 58 58 51 46 24 41 47 58 51 31 58 39 47 58 51 58 41 58 58 52 53 50 58 36 51 54 58 50 49 54 49 58 58 44 47 58 49 51 48 50 58 48 51 19 54 41 31 52 50 50 52 39 58 54 58 49 50 39 58 54 50 39 41 49 58 23 32 33 50 21 39 44 50 58 49 49 58 53 39 50 43 58 53 58 50 43 58 44 49 32 58 46 41 42 50 42 52 50 49 32 40 40 54 38 51 49 51 54 49 39 49 53 45 45 53 39 54 54 53 52 24 33 45 52 51 49 40 38 45 41 47 37 41 39 54 54 52 29 22 54 54 49 54 41 27 54 33 25 51 45 54 42 45 42 42 41 54 36 28 53 35 51 54 51 36 46 37 54 23 14 40 46 19 54 54 34 42 52 34 31 53 35 25 47 37 45 31 51 53 28 53 32 53 34 53 30 32 32 37 19 41 32 41 31 21 49 49 28 25 31 53 52 32 34 36 36 38 38 31 32 35 37 35 31 42 30 33 24 51 37 39 51 43 27 25 32 25 31 31 31 31 33 27 18 31 33 51 44 29 51 30 22 16 32 28 31 8 38 25 31 41 41 28 30 23 23 46 41 42 31 27 25 47 29 32 33 31 24 23 46 46 33 6 11 13 33 36 25 27 30 20 32 25 37 43 42 25 26 20 27 23 39 18 12 27 21 32 35 22 41 21 30 41 24 27 23 30 31 32 28 36 32 34 27 26 37 32 31 31 27 20 33 13 31 23 47 22 31 21 33 17 38 15 8 17 31 28 14 25 10 24 22 17 26 32 22 31 24 25 33 20 19 18 38 13 28 16 31 19 38 12 15 17 36 34 34 36 24 27 32 23 23 10 11 23 26 21 32 32 25 14 30 21 24 18 14 20 34 24 30 26 19 18 18 14 19 32 21 30 19 14 15 10 31 26 32 26 16 17 14 32 32 33 24 25 33 32 28 10 18 6 21 18 11 7 13 4 7 19 6 28 28 27 8 28 8 22 14 14 28 8 4 5 6 8 19 10 4 18 19 18 28 10 21 26 30 4 4 8 20 10 19 20 27 15 17 30 7 13 27 12 10 16 10 10 27 5 22 15 10 7 9 27 11 14 16 15 20 19 6 11 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_22743193_22744335
seq2: B6Ng01-309D23.b_47_1191

seq1  GAATTCTGATGTGATTAGTTTTAATGTGTCATATTCAAACTGCCTAATTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGATGTGATTAGTTTTAATGTGTCATATTCAAACTGCCTAATTT  50

seq1  CATTTGAATATCTCCTGTTGCTCTGGTAATATGAAATTTAAACTTACTAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTGAATATCTCCTGTTGCTCTGGTAATATGAAATTTAAACTTACTAT  100

seq1  TCTTCCTCAATGTGATTAAGAATTCCATTCTTAGGGAAAAGAACATAGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCTCAATGTGATTAAGAATTCCATTCTTAGGGAAAAGAACATAGAA  150

seq1  GCTGAAAATGAAGTGAAAGAACTGTTTATCAATCTAGAGGATAAATTGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGAAAATGAAGTGAAAGAACTGTTTATCAATCTAGAGGATAAATTGAA  200

seq1  ATCTCACATGTTTTCTATCCAGACTTCACATGAGCCTTATAAACACATTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCACATGTTTTCTATCCAGACTTCACATGAGCCTTATAAACACATTT  250

seq1  TCTTGAAAAAAATTTAAGAATGCAGTCAGTGTTATTCATATATATCTCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGAAAAAAATTTAAGAATGCAGTCAGTGTTATTCATATATATCTCTC  300

seq1  TATATGTCTCTCTCTATATATACGAATCTCAGTGTGGAATCTAATAAACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATGTCTCTCTCTATATATACGAATCTCAGTGTGGAATCTAATAAACA  350

seq1  AAAATGTTCAGACATCAAGGAAATATTTAAAACATTAGATTTAAGTAAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATGTTCAGACATCAAGGAAATATTTAAAACATTAGATTTAAGTAAAA  400

seq1  GTATGTTCAATGATATACTAAACAAGGAATCAAAGAATGATTTTAAGAAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGTTCAATGATATACTAAACAAGGAATCAAAGAATGATTTTAAGAAT  450

seq1  GGTAAAAAAAGAAATCAAAGAAAGGCAGTAATCACCTCTGGGTAAATACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAAAAAAAGAAATCAAAGAAAGGCAGTAATCACCTCTGGGTAAATACA  500

seq1  ATTAAACTATGAAAGCTTTAATCACTGAGACCCTGAGTGCGAAAATGACA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAAACTATGAAAGCTTTAATCACTGAGACCCTGAGTGCGAAAATGACA  550

seq1  AAGGATTTCACTAAATTATAAAATAATGAAGGAATTTCAATATATATATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGATTTCACTAAATTATAAAATAATGAAGGAATTTCAATATATATATG  600

seq1  ATATATATAAAAGAACTAAACCAAATAAATATATCAGTAAATAGTCTCAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATATAAAAGAACTAAACCAAATAAATATATCAGTAAATAGTCTCAC  650

seq1  AAAAGGCATGCTCCAAATTGATGATTGAAGAAAAAAGGCTTAAGAAGTAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGCATGCTCCAAATTGATGATTGAAGAAAAAAGGCTTAAGAAGTAC  700

seq1  AAAATTCAAACTATGACAAGGATAAAACAACAAGAAAAATAAAATTCATA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTCAAACTATGACAAGGATAAAACAACAAGAAAAATAAAATTCATA  750

seq1  GGTTAACAAGGATGTATGATTAAATAATAAAATTTAAAACCAATGGGAAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTAACAAGGATGTATGATTAAATAATAAAATTTAAAACCAATGGGAAC  800

seq1  AAGACAGAAAAGAAGCAACTCTCAGTAGCCACTGTATATCCATTATATTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAGAAAAGAAGCAACTCTCAGTAGCCACTGTATATCCATTATATTG  850

seq1  CATCTGTACATATCGAAAATAATGTAGGAAAAGTAGAGATCGGTCTAGTA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTGTACATATCGAAAATAATGTAGGAAAAGTAGAGATCGGTCTAGTA  900

seq1  GAAACATATAAATAGGAAGCTTGAAATAAAAAATACTCAGCTGTTGAAAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACATATAAATAGGAAGCTTGAAATAAAAAATACTCAGCTGTTGAAAT  950

seq1  -AAAATAGTCCTTGTCAAATTTTACTTAAAATTTA-TTCTGGAAATAGGA  998
       |||||||||||||||||||||||||||||||||| ||||||||||| ||
seq2  AAAAATAGTCCTTGTCAAATTTTACTTAAAATTTATTTCTGGAAATA-GA  999

seq1  GCATATATGAATGCACAGGGGAAAA-CCTCAGTGATGGGAAGACTC-TCT  1046
      ||||||||||||||||||||||||| | |||||||| ||||||||| |||
seq2  GCATATATGAATGCACAGGGGAAAATCTTCAGTGAT-GGAAGACTCTTCT  1048

seq1  TTTGTTAAGAGCAGGTTCCACCAGCTTCAATCATTTTTAAATGTAGCTTG  1096
      ||||||||||||| |||||| |||||||||||||||||||||||||| ||
seq2  TTTGTTAAGAGCAAGTTCCA-CAGCTTCAATCATTTTTAAATGTAGCCTG  1097

seq1  CTCATTCATTCATTG-ATTCATTTGCTTTCTATACTG-ATAACCATTTA  1143
      |||| |||||||||| ||||||||||||||||||||| ||||| |||||
seq2  CTCA-TCATTCATTGAATTCATTTGCTTTCTATACTGAATAACAATTTA  1145

seq1: chr17_22911906_22912960
seq2: B6Ng01-309D23.g_64_1114 (reverse)

seq1  GACTAGGTAGGATGAAACTCTG-CAATTTGAGCATGTGAAATACAGTCTT  49
      ||||||||| |||| ||||||| ||||||||||||||| |||||||||||
seq2  GACTAGGTA-GATG-AACTCTGCCAATTTGAGCATGTG-AATACAGTCTT  47

seq1  TTATGAGCC-AATTTTAATAATAACCAATCATAAGTCTTCATTTGTGCCA  98
      |  |||||| ||||||||| ||||||||||||||||||||||||||||||
seq2  TATTGAGCCAAATTTTAAT-ATAACCAATCATAAGTCTTCATTTGTGCCA  96

seq1  TGTGAAGGATGGCACAACGAATGTTTACATTTTTTGTTTGATTCTCTTGA  148
      ||||||||||||||||||||||| |||||||||||| |||||||||||||
seq2  TGTGAAGGATGGCACAACGAATG-TTACATTTTTTG-TTGATTCTCTTGA  144

seq1  ATCTAGTTCTTCAGTGGGCCTCCCTCTATCATAGCTGATGCATATAACTC  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTAGTTCTTCAGTGGGCCTCCCTCTATCATAGCTGATGCATATAACTC  194

seq1  TGGAAGGGATGGAGAGTCTAATCACCTTTTCTACAAACACAAAGTCAACG  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAGGGATGGAGAGTCTAATCACCTTTTCTACAAACACAAAGTCAACG  244

seq1  CCTCTATCCCAAATCGATCAGCTTGCCCTTTAGCCAGTAACCAGGAAAAC  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTATCCCAAATCGATCAGCTTGCCCTTTAGCCAGTAACCAGGAAAAC  294

seq1  TTTTAGCTTGATCTCTCTCTCAGAGGAGTAATAAAACAACCACAAAACTC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAGCTTGATCTCTCTCTCAGAGGAGTAATAAAACAACCACAAAACTC  344

seq1  AAATTCACATTAAGCCAAAATTCCCGTGGAGCCCACGTTCAAAGACTATG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTCACATTAAGCCAAAATTCCCGTGGAGCCCACGTTCAAAGACTATG  394

seq1  AGTTACCTTGTATGACTTTAAAGCTTCCTTAAAACATTTGTTTTCATACA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTACCTTGTATGACTTTAAAGCTTCCTTAAAACATTTGTTTTCATACA  444

seq1  ATTTCCCTATTATCCTAAGAGACATTTTGCTTGCTGTATAAACCTATTCT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCCCTATTATCCTAAGAGACATTTTGCTTGCTGTATAAACCTATTCT  494

seq1  CAGGCCTTTTCCTTAATTTGTTGTGTCAGGATATATAACCCAAAAATCCC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCCTTTTCCTTAATTTGTTGTGTCAGGATATATAACCCAAAAATCCC  544

seq1  CACGGGGCCTACATTCGAAGAATGAGTTTTCCTGCAGACTTTATTAGACC  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGGGGCCTACATTCGAAGAATGAGTTTTCCTGCAGACTTTATTAGACC  594

seq1  ATATTTAAAGTAAATAAATCACACTTCTACAAATATCAGCCTAGAGGAAG  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTTAAAGTAAATAAATCACACTTCTACAAATATCAGCCTAGAGGAAG  644

seq1  CAGACAGTTTCAACCAATTTGCTCTCTGCCTGGACCCAGTATAATTTTCC  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACAGTTTCAACCAATTTGCTCTCTGCCTGGACCCAGTATAATTTTCC  694

seq1  CTGTACTACTTCCGAACCACATGCGGAATTCCACACGTGACATGGGCAAA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTACTACTTCCGAACCACATGCGGAATTCCACACGTGACATGGGCAAA  744

seq1  CTCTGTAGTTTTATCTAGCTTTAAAAACAAATAAACCAAACTTTAAACTT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTAGTTTTATCTAGCTTTAAAAACAAATAAACCAAACTTTAAACTT  794

seq1  ATGTCCTATGATTACCTGCTTGTAGGAAGCAGGCATCTTTAACTCTCTGT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCCTATGATTACCTGCTTGTAGGAAGCAGGCATCTTTAACTCTCTGT  844

seq1  CTTTCTGCCTCGGAGCAGTCATCTTGTCTCTTTTCACAGCAGGGGACCTC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCTGCCTCGGAGCAGTCATCTTGTCTCTTTTCACAGCAGGGGACCTC  894

seq1  AGAGCCTGTGAACCAAGTCTGCCCTTGTGTTTGTTTAAGGTTCAGTGCTT  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCCTGTGAACCAAGTCTGCCCTTGTGTTTGTTTAAGGTTCAGTGCTT  944

seq1  GAGCCACCATGTGACTCCTCCTCTCGCTGAGAAACCACCTCTCCCCTCCT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCACCATGTGACTCCTCCTCTCGCTGAGAAACCACCTCTCCCCTCCT  994

seq1  TCAAGACGGGCTTCCCTGTGTGATCATTCTGAGAATTCCTAAATTAATAC  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGACGGGCTTCCCTGTGTGATCATTCTGAGAATTCCTAAATTAATAC  1044

seq1  TGAATTC  1055
      |||||||
seq2  TGAATTC  1051

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information