MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-311G08
Chromosome	17 (Build37)
Map Location	21,163,616 - 21,164,665
singlet/doublet	singlet
Overlap gene	Zfp160
Upstream gene	V2r7, LOC100041856, EG545190, Fpr-rs7, Fpr-rs6, EG627743, EG224576, V2r6, EG637720, EG665525, EG627805, V1re5, EG627814, EG381065, EG224582, Fpr-rs3, EG433073, V1re2, V1re6, LOC100041976, V1re3, V1re1, V1re8, V1re7, V1re4, LOC627884, Ppp2r1a, V1rf5
Downstream gene	LOC627912, LOC435509, EG627924, 4933430A09, EG665654, EG665662, LOC665666, EG665669, V1rf1, V1rf2, V1rf4, V1rf3, A830058L05Rik, Zfp54, Zfp51, Zfp53, LOC100042508, Zfp52, BC049807, Zfp760, BC043476, 4930515G13Rik, 2610036F08Rik, LOC624960, 3110048L19Rik, 4930432O21Rik, LOC665820, LOC665825, LOC674332
Link	Open Mouse BAC browser

Click to get alignment info.

name	V2r7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22313 MGI:1316665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100041856 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG545190 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545190 MGI:3646847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs

name	Fpr-rs7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321021 MGI:2448177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 Proteins

name	Fpr-rs6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321020 MGI:2448176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627743 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627743 MGI:3646973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins

name	EG224576 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224576 MGI:3647787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	V2r6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22312 MGI:1316664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 Proteins

name	EG637720 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637720 MGI:3648146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG665525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665525 MGI:3645524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins

name	EG627805 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627805 MGI:3643822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	V1re5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171228 MGI:2159626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627814 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627814 MGI:3646711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	EG381065 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381065 MGI:3645482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 8 Proteins

name	EG224582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224582 MGI:3644602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	Fpr-rs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14290 MGI:1278318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 Proteins

name	EG433073 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433073 MGI:3644513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins

name	V1re2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171225 MGI:2159616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171229 MGI:2159627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	V1re3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171226 MGI:2159624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171224 MGI:2159615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171231 MGI:2159629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171230 MGI:2159628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171227 MGI:2159625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627884 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	Ppp2r1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51792 MGI:1926334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171236 MGI:2159639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224585 MGI:108187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs

name	LOC435509 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	EG627924 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627924 MGI:3648804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins

name	4933430A09 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG665654 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665654 MGI:3643625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	EG665662 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665662 MGI:3647086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	LOC665666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins pseudo : _no_value

name	EG665669 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665669 MGI:3647092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	V1rf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171232 MGI:2159635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171233 MGI:2159636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171235 MGI:2159638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171234 MGI:2159637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830058L05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210503 MGI:3053207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22712 MGI:99201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22709 MGI:99198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24132 MGI:99200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042508 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Zfp52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22710 MGI:99199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC049807 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381066 MGI:3040683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp760 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240034 MGI:2679257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC043476 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381067 MGI:2679295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 23 ESTs, 1 Protein

name	4930515G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75098 MGI:1922348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	2610036F08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75424 MGI:1922674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 22 Proteins pseudo : _no_value

name	3110048L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73233 MGI:1920483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs pseudo : _no_value

name	4930432O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74670 MGI:1921920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665820 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC665825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 83 ESTs, 35 Proteins pseudo : _no_value

name	LOC674332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs pseudo : _no_value

name	V2r7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268546 GeneID:22313 MGI:1316665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : vomeronasal 2, receptor, 7 transcript_id : XM_139789.9

name	EG545190 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268549 GeneID:545190 MGI:3646847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs product : predicted gene, EG545190, transcript variant 1 transcript_id : XM_619437.4

name	Fpr-rs6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930700 GeneID:321020 MGI:2448176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formyl peptide receptor, related sequence 6 transcript_id : NM_177316.2

name	EG627743 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268551 GeneID:627743 MGI:3646973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins product : predicted gene, EG627743 transcript_id : XM_001477149.1

name	EG224576 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401692 GeneID:224576 MGI:3647787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG224576 transcript_id : XM_621454.3

name	V2r6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268554 GeneID:22312 MGI:1316664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 Proteins product : vomeronasal 2, receptor, 6 transcript_id : XM_977458.2

name	EG665525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268556 GeneID:665525 MGI:3645524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins product : predicted gene, EG665525 transcript_id : XM_977557.2

name	EG627805 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268558 GeneID:627805 MGI:3643822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG627805 transcript_id : XM_892506.2

name	V1re5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717710 GeneID:171228 MGI:2159626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E5 transcript_id : NM_134194.1

name	EG627814 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401706 GeneID:627814 MGI:3646711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG627814 transcript_id : XM_892515.2

name	EG381065 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268560 GeneID:381065 MGI:3645482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 8 Proteins product : predicted gene, EG381065 transcript_id : XM_354985.6

name	EG433073 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268561 GeneID:433073 MGI:3644513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins product : predicted gene, EG433073 transcript_id : XM_484599.5

name	V1re2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717696 GeneID:171225 MGI:2159616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E2 transcript_id : NM_134191.1

name	V1re6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168260 GeneID:171229 MGI:2159627
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E6 transcript_id : NM_134195.2

name	LOC100041976 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268564 GeneID:100041976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001477310.1

name	V1re3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982572 GeneID:171226 MGI:2159624
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E3 transcript_id : NM_134192.2

name	V1re1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717702 GeneID:171224 MGI:2159615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E1 transcript_id : NM_134190.1

name	V1re8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717708 GeneID:171231 MGI:2159629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E8 transcript_id : NM_134197.1

name	V1re7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717714 GeneID:171230 MGI:2159628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E7 transcript_id : NM_134196.1

name	V1re4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717700 GeneID:171227 MGI:2159625
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E4 transcript_id : NM_134193.1

name	Ppp2r1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131166 GeneID:51792 MGI:1926334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform transcript_id : NM_016891.3

name	V1rf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717726 GeneID:171236 MGI:2159639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F5 transcript_id : NM_134202.1

name	Zfp160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703953 GeneID:224585 MGI:108187
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 160 transcript_id : NM_145483.1

name	LOC627912 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94401717 GeneID:627912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs product : similar to l-Afadin transcript_id : XM_892614.2

name	EG627924 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82986763 GeneID:627924 MGI:3648804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins product : predicted gene, EG627924 transcript_id : XM_892630.1

name	4933430A09 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268566 GeneID:328766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein 4933430A09 transcript_id : XM_001477465.1

name	EG665654 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268601 GeneID:665654 MGI:3643625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG665654 transcript_id : XM_978485.2

name	EG665662 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268604 GeneID:665662 MGI:3647086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : predicted gene, EG665662 transcript_id : XM_978514.2

name	EG665669 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268569 GeneID:665669 MGI:3647092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins product : predicted gene, EG665669 transcript_id : XM_978594.2

name	V1rf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717718 GeneID:171232 MGI:2159635
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F1 transcript_id : NM_134198.1

name	V1rf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407051 GeneID:171233 MGI:2159636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F2 transcript_id : NM_134199.3

name	V1rf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717716 GeneID:171235 MGI:2159638
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F4 transcript_id : NM_134201.1

name	V1rf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717722 GeneID:171234 MGI:2159637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F3 transcript_id : NM_134200.1

name	A830058L05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865955 GeneID:210503 MGI:3053207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830058L05 gene transcript_id : NM_172486.2

name	Zfp54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124269707 GeneID:22712 MGI:99201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 54 transcript_id : NM_011760.2

name	Zfp51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124269709 GeneID:22709 MGI:99198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 51 transcript_id : NM_009558.3

name	Zfp53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680995 GeneID:24132 MGI:99200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 53 transcript_id : NM_013843.3

name	LOC100042508 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268606 GeneID:100042508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to zinc finger protein 54 transcript_id : XM_001478492.1

name	Zfp52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937376 GeneID:22710 MGI:99199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 52 transcript_id : NM_144515.2

name	BC049807 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50284536 GeneID:381066 MGI:3040683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049807 transcript_id : NM_001002008.1

name	Zfp760 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56605853 GeneID:240034 MGI:2679257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 760 transcript_id : NM_001008501.1

name	BC043476 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401701 GeneID:381067 MGI:2679295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 1 Protein product : cDNA sequence BC043476, transcript variant 2 transcript_id : XM_892560.2

name	BC043476 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268612 GeneID:381067 MGI:2679295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 1 Protein product : cDNA sequence BC043476, transcript variant 1 transcript_id : XM_354987.5

name	4930515G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268613 GeneID:75098 MGI:1922348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930515G13 gene transcript_id : XM_979393.2

name	2610036F08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677475 GeneID:75424 MGI:1922674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610036F08 gene transcript_id : NM_029281.1

name	4930432O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268459 GeneID:74670 MGI:1921920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930432O21 gene transcript_id : XM_001471514.1

name	V2r7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268547 GeneID:22313 MGI:1316665
definition	codon_start : 1 product : vomeronasal 2, receptor, 7 protein_id : XP_139789.9

name	EG545190 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268550 GeneID:545190 MGI:3646847
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_619437.3

name	Fpr-rs6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930701 CCDS:CCDS28423.1 GeneID:321020 MGI:2448176
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004943 - C3a anaphylatoxin receptor activity [Evidence IEA]; GO:0004982 - N-formyl peptide receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : formyl peptide receptor, related sequence 6 protein_id : NP_796290.2

name	EG627743 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268552 GeneID:627743 MGI:3646973
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001477199.1

name	EG224576 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401693 GeneID:224576 MGI:3647787
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_621454.3

name	V2r6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268555 GeneID:22312 MGI:1316664
definition	codon_start : 1 product : vomeronasal 2, receptor, 6 protein_id : XP_982552.2

name	EG665525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268557 GeneID:665525 MGI:3645524
definition	codon_start : 1 product : similar to vomeronasal V1r-type receptor V1re25 protein_id : XP_982651.2

name	EG627805 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268559 GeneID:627805 MGI:3643822
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897599.2

name	V1re5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717711 CCDS:CCDS28424.1 GeneID:171228 MGI:2159626
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E5 protein_id : NP_598955.1

name	EG627814 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401707 GeneID:627814 MGI:3646711
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897608.2

name	EG381065 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986751 GeneID:381065 MGI:3645482
definition	codon_start : 1 product : similar to small nuclear RNA protein_id : XP_354985.4

name	EG433073 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268562 GeneID:433073 MGI:3644513
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484599.2

name	V1re2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717697 CCDS:CCDS28426.1 GeneID:171225 MGI:2159616
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E2 protein_id : NP_598952.1

name	V1re6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168261 GeneID:171229 MGI:2159627
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : vomeronasal 1 receptor, E6 protein_id : NP_598956.2

name	LOC100041976 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268565 GeneID:100041976
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001477360.1

name	V1re3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717707 CCDS:CCDS28427.1 GeneID:171226 MGI:2159624
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal receptor 1 D1 product : vomeronasal 1 receptor, E3 protein_id : NP_598953.1

name	V1re1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717703 CCDS:CCDS28428.1 GeneID:171224 MGI:2159615
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E1 protein_id : NP_598951.1

name	V1re8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717709 CCDS:CCDS28429.1 GeneID:171231 MGI:2159629
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E8 protein_id : NP_598958.1

name	V1re7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717715 CCDS:CCDS28430.1 GeneID:171230 MGI:2159628
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal receptor 1 E5 product : vomeronasal 1 receptor, E7 protein_id : NP_598957.1

name	V1re4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717701 CCDS:CCDS28431.1 GeneID:171227 MGI:2159625
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, E4 protein_id : NP_598954.1

name	Ppp2r1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394027 CCDS:CCDS28432.1 GeneID:51792 MGI:1926334
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : serine/threonine protein phosphatase A subunit type 2A; protein phosphatase PP2A product : alpha isoform of regulatory subunit A, protein phosphatase 2 protein_id : NP_058587.1

name	V1rf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717727 CCDS:CCDS28433.1 GeneID:171236 MGI:2159639
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, F5 protein_id : NP_598963.1

name	Zfp160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703954 CCDS:CCDS28434.1 GeneID:224585 MGI:108187
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 160 protein_id : NP_663458.1

name	LOC627912 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82986760 GeneID:627912
definition	codon_start : 1 product : similar to l-Afadin protein_id : XP_897707.1

name	EG627924 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986764 GeneID:627924 MGI:3648804
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_897723.1

name	4933430A09 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268567 GeneID:328766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477515.1

name	EG665654 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268602 GeneID:665654 MGI:3643625
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_983579.2

name	EG665662 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268605 GeneID:665662 MGI:3647086
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_983608.2

name	EG665669 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268570 GeneID:665669 MGI:3647092
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_983688.2

name	V1rf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717719 CCDS:CCDS28435.1 GeneID:171232 MGI:2159635
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, F1 protein_id : NP_598959.1

name	V1rf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407052 GeneID:171233 MGI:2159636
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, F2 protein_id : NP_598960.3

name	V1rf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717717 CCDS:CCDS28437.1 GeneID:171235 MGI:2159638
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, F4 protein_id : NP_598962.1

name	V1rf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717723 CCDS:CCDS28438.1 GeneID:171234 MGI:2159637
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, F3 protein_id : NP_598961.1

name	A830058L05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865956 CCDS:CCDS28439.1 GeneID:210503 MGI:3053207
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : KRAB-zinc finger protein protein_id : NP_766074.2

name	Zfp54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124269708 GeneID:22712 MGI:99201
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : zinc finger protein 76; clone 18 product : zinc finger protein 54 protein_id : NP_035890.2

name	Zfp51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124269710 GeneID:22709 MGI:99198
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 51 protein_id : NP_033584.3

name	Zfp53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305637 CCDS:CCDS28440.1 GeneID:24132 MGI:99200
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Zinc finger protein 118 product : zinc finger protein 53 protein_id : NP_038871.1

name	LOC100042508 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268607 GeneID:100042508
definition	codon_start : 1 product : similar to zinc finger protein 54 protein_id : XP_001478542.1

name	Zfp52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937377 GeneID:22710 MGI:99199
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : KRAB-zinc finger protein 76 product : zinc finger protein 52 protein_id : NP_653098.2

name	BC049807 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50284537 CCDS:CCDS28441.1 GeneID:381066 MGI:3040683
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381066 protein_id : NP_001002008.1

name	Zfp760 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605854 GeneID:240034 MGI:2679257
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 760 protein_id : NP_001008501.1

name	BC043476 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38081804 GeneID:381067 MGI:2679295
definition	codon_start : 1 product : similar to BC043476 protein isoform 1 protein_id : XP_354987.1

name	BC043476 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986296 GeneID:381067 MGI:2679295
definition	codon_start : 1 product : similar to BC043476 protein isoform 2 protein_id : XP_897653.1

name	4930515G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401731 GeneID:75098 MGI:1922348
definition	codon_start : 1 product : hypothetical protein LOC75098 protein_id : XP_984487.1

name	2610036F08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677476 GeneID:75424 MGI:1922674
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75424 protein_id : NP_083557.1

name	4930432O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268460 GeneID:74670 MGI:1921920
definition	codon_start : 1 product : hypothetical protein LOC74670 protein_id : XP_001471564.1

name	LOC100041856 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041856
definition	number : 1 pseudo : _no_value

name	LOC100041856 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041856
definition	number : 2 pseudo : _no_value

name	LOC100041856 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041856
definition	number : 3 pseudo : _no_value

name	EG637720 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637720
definition	number : 1 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 8 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 7 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 6 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 5 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 4 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 3 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 2 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 1 pseudo : _no_value

name	LOC627884 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627884
definition	number : 1 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 4 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 3 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 2 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 1 pseudo : _no_value

name	LOC665666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665666
definition	number : 1 pseudo : _no_value

name	LOC665820 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665820
definition	number : 1 pseudo : _no_value

name	Fpr-rs7 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268595 GeneID:321021 MGI:2448177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 Proteins product : formyl peptide receptor, related sequence 7 transcript_id : XR_035358.1

name	Fpr-rs3 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268596 GeneID:14290 MGI:1278318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 Proteins product : formyl peptide receptor, related sequence 3 transcript_id : XR_035364.1

name	LOC624960 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268614 GeneID:624960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 22 Proteins product : similar to Y box transcription factor pseudo : _no_value transcript_id : XR_033753.1

name	3110048L19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268616 GeneID:73233 MGI:1920483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs product : RIKEN cDNA 3110048L19 gene pseudo : _no_value transcript_id : XR_035371.1

name	LOC665825 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268615 GeneID:665825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 83 ESTs, 35 Proteins product : similar to Tropomyosin alpha-4 chain (Tropomyosin-4) (TM-4) pseudo : _no_value transcript_id : XR_033760.1

name	LOC674332 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268574 GeneID:674332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs product : hypothetical LOC674332 pseudo : _no_value transcript_id : XR_033292.1

clone name	MSMg01-067D01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-066G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072M07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-456H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538F01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-178A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-405C22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-299J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-047D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-294O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405M24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-452H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071N02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-074L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-330B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060F20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-144N02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-272L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-311G08.b	B6Ng01-311G08.g
ACC	GA103124	GA103125
length	1,171	1,088
definition	B6Ng01-311G08.b	B6Ng01-311G08.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaactgaaggatgccaaagggctgagaagccccttgaaaaaat gttcaacatccttaatcatcagagaaatgcaaatcaaaacaaccctgaga ttccaccttacactagtcagaaaggctaagatcaaaattcaggcgacagc agatgctgccaagggtgtggggaaagaggaacactcctccattgctggtg ggattgcaagctggtacaaccactctgaaaatcagtctggtggttaaaca gaaaattggacatagtactataagaaggtccagcaatacctctcctgggc atatatacagaatatgttccaaattgtaataaggacacatgttcaaccct gctcacagcagccttatttgtaatacccagaagctggaaagaacccagat gtcccacaacagaggaagggatagagaaattgtggtacatttacacaatg gagtactactcagctattaaaaacaatgaatttatgaaatttttaagcca attgatggatctggaggagatcatcctgagtaaggtaacccaatctcaaa agaactcgcatgttattatatactcactgataagtggatattagcccaga acctaagaatacccaagatacaatttgcaaaacactagaaaattaagaag agagaagaccaacaggtggatacttctctcgttcttaaaatgggggacaa aatacccatggaaggagttacagagacaaagtttggagctgagacagaag gaaggaccagccagagactgctctacccagagatctatcccataaacaac caccaaacacagacactattgtatatgccaacaagatattgctgacagga ccctgatatagctgtctccagtgaggatatgccagtgcctggcaaataca aaaatggatgctcacagtcatctattggatgggaacacagggcccccaat gaaggagctagagaaagtatccaagaagctgaagtgtctgtacccctaaa ggagcaacaaccatatgactatcagtacccccagagctcatgtctctagc tgcatatgtgcagaggatgccttagtgcatcaatgggagaagagcctagt ctggcaagattatatggcccgtacaggattaacatgtcagaatgaactgg aatggcttggtaagcccggcg	gaattcacactggcagagaaaccttacagatgcaatgagtgtggaaaagc ctttaattcacattccaacctaaatacccatcaagtaatccatactggac aaaaaccctataaatgtatgcaatgtggcaaggtctttactcaaaattca catcttgcaaatcatcaaagaacccatacaggagagaaaccttacaaatg taatgagtgtggcaaagccttcagtgtgtactcaagtttgactactcatc aggcaatccatactggagaaaaaccttataagtgtaatgaatgtggtaaa gtcttcacgcaaaattcacacctagctagtcaccggaggactcatactgg agaaaaaccttaccagtgtaataagtgtgataaagcctttagtgtgcgtt caagcttgactacccatcaggcaatccatactggagaaaaaccttacaca tgtagtgagtgtggcaaagtctttagtcgaagttccaaccttacaagtca tcagagacttcatgttggacagaagcatatgtgaatatagcaaggtcttt gggcataattcacttcttgcataatatccaggaatacaatcctaataaaa tgttagtattgtgttgacgataaacacccatcatgagttcaaatatgtca ctagatgtagtggtatgcatgtacaaccacccttttcagggtgttgtggg agcattgtctgcttggcatatgtaggaagaacttgacctaaatttaaaaa tatatcaagcttttgtagacatataacatattaagaagacatttcataca tgtagagaagatgcttcaggatatgatttccacctctataaacccaaaaa tgcacattgttgatgaaataatccaattggcacttattgaggatgttact taatgactatttacagtggaaagtgaatagaaggagttattcagcctctt gtttttcatggctaatctcaatgttacattccacagaataattgataata ctgaacattaaaagtcaaaatagctaaacgtgaatatatttgaaaagtga ggatggtgatacttgccttaatatccgtgtacctcatt
quality values	Open. Hide. 58 25 27 35 58 58 58 41 28 47 62 62 62 47 62 62 62 27 23 47 62 47 26 62 62 62 62 62 62 62 62 33 18 21 24 18 24 24 27 28 28 38 37 26 56 59 59 62 62 59 59 59 62 59 46 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 59 59 59 45 32 43 56 46 62 62 54 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 49 54 45 36 48 54 58 58 58 54 58 58 54 58 58 58 58 58 58 54 58 54 41 45 47 58 58 58 58 58 58 58 54 54 58 58 54 47 58 54 58 58 54 58 58 58 58 58 58 58 58 52 58 58 58 52 58 58 54 58 58 58 58 58 58 58 58 51 58 58 58 54 58 58 58 58 58 58 58 50 58 58 58 45 58 58 58 53 58 58 58 58 53 42 45 54 58 53 58 58 47 51 52 58 51 38 58 58 54 58 50 58 58 52 48 43 43 44 42 49 54 58 50 53 54 51 58 58 58 58 58 51 50 58 58 53 52 51 51 51 51 52 58 58 58 34 31 51 40 58 38 58 58 41 58 39 53 40 58 58 42 46 12 49 50 51 49 40 21 58 50 47 58 37 40 37 53 52 58 52 54 52 51 45 53 42 52 45 52 49 29 54 54 50 53 54 54 54 54 54 38 25 45 54 54 45 53 37 32 54 49 32 39 31 54 49 39 20 53 49 32 51 53 37 52 28 52 54 30 41 37 29 44 51 40 54 54 54 49 42 46 23 40 53 37 46 13 34 32 40 33 54 34 14 25 21 47 24 52 32 31 33 33 32 52 53 34 31 52 25 24 27 42 53 31 53 40 52 28 32 46 40 24 34 41 21 26 31 31 32 34 42 26 51 32 28 42 30 47 31 30 23 41 24 51 28 30 37 32 51 43 31 28 31 30 41 32 30 29 33 31 31 31 33 42 24 29 32 29 43 30 30 24 24 42 38 28 36 31 42 32 25 11 17 31 30 42 30 43 21 31 26 42 33 25 46 33 27 29 21 19 25 30 26 25 34 43 34 26 26 38 33 37 30 30 31 31 41 18 25 33 23 26 30 31 31 36 31 30 32 29 23 42 34 28 33 25 31 46 32 31 35 22 32 38 38 48 30 26 38 20 31 35 34 24 20 32 23 23 33 24 17 28 20 30 34 32 27 14 28 11 24 6 14 10 44 19 42 21 11 7 10 17 7 28 22 18 33 31 31 18 9 17 34 29 18 11 4 5 13 13 32 33 21 31 34 15 6 21 15 20 25 21 33 20 25 12 22 24 32 31 27 31 23 22 17 4 4 4 19 25 31 26 22 18 24 8 27 27 11 32 16 40 18 24 21 32 12 29 14 13 28 10 20 10 10 27 9 19 28 10 27 9 22 20 3 12 27 15 11 16 27 32 28 27 23 8 6 10 5 23 23 18 26 24 22 24 13 12 8 16 16 11 21 17 14 23 9 11 5 14 16 9 11 2 5 6 23 6 9 10 8 3 2 2 6 13 13 3 3 5 7 10 16 16 8 15 12 18 30 13 4 4 15 10 7 15 4 3 3 3 11 5 7 8 18 4 6 16 20 16 7 21 19 10 11 9 10 20 9 13 4 18 19 10 13 5 11 3 3 3 3 1 4 4 5 10 1 1 3 1 2 12 8 9 12 4 4 12 4 1 2 15 3 1 1 2 17 3 1 5 6 5 2 1 3 15 4 14 20 7 18 15 3 2	Open. Hide. 62 47 42 47 62 54 51 62 56 49 49 44 17 8 15 16 20 21 24 32 43 44 43 49 62 62 62 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 59 49 62 54 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 42 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 44 62 49 54 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 45 41 58 58 58 58 58 58 58 41 58 58 58 58 58 58 58 58 54 58 42 54 54 58 58 58 54 58 58 58 58 58 58 58 42 58 54 58 58 54 58 54 58 54 58 58 58 58 49 58 51 53 53 58 58 58 58 49 58 58 52 58 51 58 58 58 58 58 50 51 53 50 52 51 58 58 53 47 58 58 58 54 58 58 51 42 50 52 58 58 54 51 58 46 35 58 58 58 39 41 50 51 40 58 51 58 58 53 53 58 50 53 58 58 48 41 51 51 51 58 50 50 37 40 58 58 53 54 50 58 58 51 32 33 23 12 9 12 9 22 37 39 12 27 24 52 54 41 53 58 58 37 58 53 41 39 58 51 53 50 47 58 53 53 52 50 50 50 50 46 30 54 45 53 45 53 54 50 41 39 41 51 52 53 53 54 44 22 49 41 49 34 49 37 44 42 46 32 54 54 49 37 29 17 49 42 39 54 29 49 51 40 44 22 28 33 21 51 32 45 32 47 37 52 45 33 31 54 42 51 42 32 32 45 42 42 51 39 45 26 42 33 46 23 36 35 37 42 53 53 37 27 40 33 39 53 32 45 35 41 40 52 51 51 45 35 31 35 37 40 40 31 31 52 34 32 52 52 52 42 31 53 33 40 29 28 52 32 41 42 42 32 30 45 43 30 31 42 42 31 51 46 29 35 13 25 26 46 33 31 26 31 31 29 26 31 45 32 33 30 31 28 34 31 7 31 14 31 29 14 21 32 31 14 46 19 13 23 30 31 29 16 47 27 18 30 28 23 41 42 31 31 31 30 31 46 30 32 46 37 37 48 46 46 29 26 31 27 19 18 23 31 41 39 19 33 31 32 26 32 42 48 34 31 25 31 31 31 32 22 28 32 31 39 27 31 33 32 31 29 31 22 22 31 21 20 16 30 15 31 22 31 23 31 28 38 29 20 26 32 32 35 31 31 27 44 31 20 31 18 31 25 38 37 26 48 9 18 10 24 14 25 33 31 31 22 17 4 9 17 24 23 32 31 29 14 29 22 20 20 17 18 30 21 24 19 24 47 48 48 27 25 22 22 25 15 14 30 21 37 32 10 13 8 12 17 28 32 28 17 6 11 15 22 18 20 14 8 6 8 11 21 9 24 13 24 13 15 20 17 12 6 7 3 4 18 21 28 11 14 21 13 7 12 20 34 38 26 19 10 13 24 47 38 22 20 10 10 22 27 24 30 18 8 9 20 12 6 7 12 7 16 14 13 30 20 13 10 28 24 6 4 3 3 12 5 6 25 8 14 14 5 7 19 5 4 17 10 8 16 14 17 15 14 3 1 4 5 11 6 15 4 4 13 8 11 16 9 9 23 7 17 17

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_21163616_21164665
seq2: B6Ng01-311G08.g_109_1153

seq1  GAAAAGCCTTTAATTCACATTCCAACCTAAATACCCATCAAGTAATCCAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAGCCTTTAATTCACATTCCAACCTAAATACCCATCAAGTAATCCAT  50

seq1  ACTGGACAAAAACCCTATAAATGTATGCAATGTGGCAAGGTCTTTACTCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGACAAAAACCCTATAAATGTATGCAATGTGGCAAGGTCTTTACTCA  100

seq1  AAATTCACATCTTGCAAATCATCAAAGAACCCATACAGGAGAGAAACCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTCACATCTTGCAAATCATCAAAGAACCCATACAGGAGAGAAACCTT  150

seq1  ACAAATGTAATGAGTGTGGCAAAGCCTTCAGTGTGTACTCAAGTTTGACT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAATGTAATGAGTGTGGCAAAGCCTTCAGTGTGTACTCAAGTTTGACT  200

seq1  ACTCATCAGGCAATCCATACTGGAGAAAAACCTTATAAGTGTAATGAATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCATCAGGCAATCCATACTGGAGAAAAACCTTATAAGTGTAATGAATG  250

seq1  TGGTAAAGTCTTCACGCAAAATTCACACCTAGCTAGTCACCGGAGGACTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTAAAGTCTTCACGCAAAATTCACACCTAGCTAGTCACCGGAGGACTC  300

seq1  ATACTGGAGAAAAACCTTACCAGTGTAATAAGTGTGATAAAGCCTTTAGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACTGGAGAAAAACCTTACCAGTGTAATAAGTGTGATAAAGCCTTTAGT  350

seq1  GTGCGTTCAAGCTTGACTACCCATCAGGCAATCCATACTGGAGAAAAACC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCGTTCAAGCTTGACTACCCATCAGGCAATCCATACTGGAGAAAAACC  400

seq1  TTACACATGTAGTGAGTGTGGCAAAGTCTTTAGTCGAAGTTCCAACCTTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACACATGTAGTGAGTGTGGCAAAGTCTTTAGTCGAAGTTCCAACCTTA  450

seq1  CAAGTCATCAGAGACTTCATGTTGGACAGAAGCATATGTGAATATAGCAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTCATCAGAGACTTCATGTTGGACAGAAGCATATGTGAATATAGCAA  500

seq1  GGTCTTTGGGCATAATTCACTTCTTGCATAATATCCAGGAATACAATCCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTTTGGGCATAATTCACTTCTTGCATAATATCCAGGAATACAATCCT  550

seq1  AATAAAATGTTAGTATTGTGTTGACGATAAACACCCATCATGAGTTCAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAAATGTTAGTATTGTGTTGACGATAAACACCCATCATGAGTTCAAA  600

seq1  TATGTCACTAGATGTAGTGGTATGCATGTACAACCACCCTTTTCAGGGTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTCACTAGATGTAGTGGTATGCATGTACAACCACCCTTTTCAGGGTG  650

seq1  TTGTGGGAGCATTGTCTGCTTGGCATATGTAGGAAGAACTTGACCTAAAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGGGAGCATTGTCTGCTTGGCATATGTAGGAAGAACTTGACCTAAAT  700

seq1  TTAAAAATATATCAAGCTTTTGTAGACATATAACATATTAAGAAGACATT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAATATATCAAGCTTTTGTAGACATATAACATATTAAGAAGACATT  750

seq1  TCATACATGTAGAGAAGATGCTTCAGGATATGATTTCCACCTCTATAAAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATACATGTAGAGAAGATGCTTCAGGATATGATTTCCACCTCTATAAAC  800

seq1  CCAAAAATGCACATTGTTGATGAAATAATCCAATTGGCACTTATTGAGGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAAATGCACATTGTTGATGAAATAATCCAATTGGCACTTATTGAGGA  850

seq1  TGTTACTTAATGACTATTTACAGTGGAAGGTGAATAGAAGGAGTTATTCA  900
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  TGTTACTTAATGACTATTTACAGTGGAAAGTGAATAGAAGGAGTTATTCA  900

seq1  GCCTCTTGTTTTTCATGGCTAATCTTCAATGTTACATTCCACAGAATAAT  950
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  GCCTCTTGTTTTTCATGGCTAATC-TCAATGTTACATTCCACAGAATAAT  949

seq1  TGATAATTACTGAACAATTAAAAGTCAAAATAGCTAAAACGTG-ATATAT  999
      |||||| |||||||| ||||||||||||||||||| ||||||| ||||||
seq2  TGATAA-TACTGAAC-ATTAAAAGTCAAAATAGCT-AAACGTGAATATAT  996

seq1  TTGAAAGGTTGAAGATGGTTGATACTTGCCTTTAATATTCGTGTA-CTCA  1048
      |||||| | ||| ||||| ||||||||||| ||||||| |||||| ||||
seq2  TTGAAAAG-TGAGGATGG-TGATACTTGCC-TTAATATCCGTGTACCTCA  1043

seq1  TT  1050
      ||
seq2  TT  1045

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information