MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-313N16
Chromosome	17 (Build37)
Map Location	33,110,742 - 33,242,116
singlet/doublet	doublet
Overlap gene	Zfp472, C920016K16Rik, 1700065O13Rik, 4921501E09Rik, Zfp563
Upstream gene	Hsf2bp, Rrp1b, LOC435518, Notch3, Pdxk-ps, Abhd9, Brd4, LOC100043434, LOC100043433, Akap8, Akap8l, Wiz, A430107D22Rik, Pglyrp2, 4732474A20Rik, EG208285, Cyp4f16, LOC667178, LOC677156, EG631304, Cyp4f15, LOC623809, 9030612M13Rik, Zfp811, 6030490I01Rik, LOC631266, BC066107, Cyp4f14, Cyp4f13, 6030422M01Rik
Downstream gene	Morc2b, LOC100038859, LOC100038860, LOC100043474, Zfp422-rs1, Olfr63, LOC100043468, Zfp81, Zfp101, 1700029I08Rik, LOC100042953, Adamts10, Myo1f, Zfp414, Pram1, Hnrpm, March2, Rab11b, Angptl4, Ankrd47, Rps28, Ndufa7, Cd320, LOC100042967, LOC630219, LOC100042970, BC051226, Daxx, Zbtb22, Tapbp, Rgl2, H2-Ke2, Wdr46, B3galt4, Rps18, Vps52, EG630499, LOC100042989, AA388235, H2-K1, LOC654352, Ring1, H2-Ke6, Slc39a7, Rxrb, Col11a2, LOC672505, H2-Pa, H2-Oa
Link	Open Mouse BAC browser

Click to get alignment info.

name	Hsf2bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74377 MGI:1921627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 32 ESTs, 1 Protein

name	Rrp1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72462 MGI:1919712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435518 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Notch3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18131 MGI:99460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdxk-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140553 MGI:1933201
definition	note : pyridoxal (pyridoxine, vitamin B6) kinase, pseudogene pseudo : _no_value

name	Abhd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71932 MGI:1919182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57261 MGI:1888520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043434 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	LOC100043433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Akap8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56399 MGI:1928488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akap8l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54194 MGI:1860606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wiz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22404 MGI:1332638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	A430107D22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320484 MGI:2444128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pglyrp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57757 MGI:1928099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732474A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320997 MGI:2445210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG208285 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208285 MGI:3646233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 24 Proteins

name	Cyp4f16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70101 MGI:1917351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667178 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC677156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 41 Proteins

name	EG631304 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631304 MGI:3645508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	Cyp4f15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106648 MGI:2146921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623809 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	9030612M13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208292 MGI:1921793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp811 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240063 MGI:2682944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030490I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240064 MGI:2443934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631266 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 10 Proteins pseudo : _no_value

name	BC066107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240066 MGI:3029586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4f14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64385 MGI:1927669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4f13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170716 MGI:2158641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030422M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77875 MGI:1925125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Zfp472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224691 MGI:2385049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C920016K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240067 MGI:2441928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700065O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73451 MGI:1920701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921501E09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74042 MGI:1921292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp563 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240068 MGI:2677168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morc2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240069 MGI:3045293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038860 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1110 Proteins

name	Zfp422-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77652 MGI:3028594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 108 ESTs

name	Olfr63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258939 MGI:1335096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs

name	Zfp81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224694 MGI:1890752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22643 MGI:107547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700029I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69481 MGI:1916731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Adamts10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224697 MGI:2449112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17916 MGI:107711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp414 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328801 MGI:1915641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pram1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378460 MGI:3576625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76936 MGI:1926465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	March2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224703 MGI:1925915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab11b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19326 MGI:99425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Angptl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57875 MGI:1888999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80880 MGI:1098615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54127 MGI:1859516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66416 MGI:1913666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd320 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54219 MGI:1860083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042967 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC630219 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100042970 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 34 Proteins

name	BC051226 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407803 MGI:3039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Daxx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13163 MGI:1197015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81630 MGI:1931870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tapbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21356 MGI:1201689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rgl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19732 MGI:107483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Ke2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14976 MGI:95908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57315 MGI:1931871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3galt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54218 MGI:1859517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20084 MGI:98146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224705 MGI:1330304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG630499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630499 MGI:3644203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042989 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	AA388235 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433100 MGI:3035178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-K1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14972 MGI:95904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC654352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654352
definition	note : Casitas B-lineage lymphoma pseudogene pseudo : _no_value

name	Ring1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19763 MGI:1101770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2-Ke6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14979 MGI:95911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14977 MGI:95909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rxrb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20182 MGI:98215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col11a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12815 MGI:88447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672505 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672505
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	H2-Pa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15003 MGI:105314
definition	gene_synonym : H2-Pa-ps note : histocompatibility 2, P region alpha locus pseudo : _no_value

name	H2-Oa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15001 MGI:95924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsf2bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268656 GeneID:74377 MGI:1921627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 32 ESTs, 1 Protein product : heat shock transcription factor 2 binding protein transcript_id : XM_484622.4

name	Rrp1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076996 GeneID:72462 MGI:1919712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal RNA processing 1 homolog B (S. cerevisiae) transcript_id : NM_028244.1

name	Notch3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130663 GeneID:18131 MGI:99460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Notch gene homolog 3 (Drosophila) transcript_id : NM_008716.2

name	Abhd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369966 GeneID:71932 MGI:1919182
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 9 transcript_id : NM_001033163.2

name	Brd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560787 GeneID:57261 MGI:1888520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 4 transcript_id : NM_020508.2

name	Brd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674286 GeneID:57261 MGI:1888520
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 4 transcript_id : NM_198094.1

name	LOC100043433 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268731 GeneID:100043433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043433 transcript_id : XM_001480478.1

name	Akap8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801979 GeneID:56399 MGI:1928488
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 8 transcript_id : NM_019774.3

name	Akap8l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70780372 GeneID:54194 MGI:1860606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 8-like transcript_id : NM_017476.2

name	Wiz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909564 GeneID:22404 MGI:1332638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : widely-interspaced zinc finger motifs transcript_id : NM_212438.1

name	Wiz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909562 GeneID:22404 MGI:1332638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : widely-interspaced zinc finger motifs transcript_id : NM_011717.2

name	A430107D22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130502227 GeneID:320484 MGI:2444128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430107D22 gene transcript_id : NM_178785.3

name	Pglyrp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476059 GeneID:57757 MGI:1928099
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 2 transcript_id : NM_021319.2

name	4732474A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361891 GeneID:320997 MGI:2445210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732474A20 gene transcript_id : NM_177307.3

name	EG208285 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268657 GeneID:208285 MGI:3646233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 24 Proteins product : predicted gene, EG208285 transcript_id : XM_139863.7

name	Cyp4f16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13277361 GeneID:70101 MGI:1917351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 16 transcript_id : NM_024442.1

name	LOC677156 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268738 GeneID:677156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 41 Proteins product : similar to cytochrome P450, family 4, subfamily f, polypeptide 16 transcript_id : XM_001480532.1

name	EG631304 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401873 GeneID:631304 MGI:3645508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : predicted gene, EG631304 transcript_id : XM_988992.1

name	Cyp4f15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373164 GeneID:106648 MGI:2146921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 15 transcript_id : NM_134127.1

name	9030612M13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140969611 GeneID:208292 MGI:1921793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030612M13 gene transcript_id : NM_172458.3

name	Zfp811 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147227 GeneID:240063 MGI:2682944
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 811 transcript_id : NM_183177.1

name	6030490I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793417 GeneID:240064 MGI:2443934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030490I01 gene transcript_id : NM_177359.3

name	BC066107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402246 GeneID:240066 MGI:3029586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC066107 transcript_id : NM_207245.1

name	Cyp4f14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11967964 GeneID:64385 MGI:1927669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 14 transcript_id : NM_022434.1

name	Cyp4f13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373154 GeneID:170716 MGI:2158641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 13 transcript_id : NM_130882.1

name	6030422M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401875 GeneID:77875 MGI:1925125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 6030422M01 gene transcript_id : XM_128564.4

name	Zfp472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377185 GeneID:224691 MGI:2385049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 472 transcript_id : NM_153063.2

name	C920016K16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930751 GeneID:240067 MGI:2441928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C920016K16 gene transcript_id : NM_001045559.1

name	1700065O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802452 GeneID:73451 MGI:1920701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700065O13 gene transcript_id : NM_028543.2

name	4921501E09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222273 GeneID:74042 MGI:1921292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921501E09 gene transcript_id : NM_001009544.1

name	Zfp563 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930757 GeneID:240068 MGI:2677168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 563 transcript_id : NM_001024950.2

name	Morc2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354229 GeneID:240069 MGI:3045293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microrchidia 2B transcript_id : NM_177719.3

name	LOC100038859 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268461 GeneID:100038859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038859 transcript_id : XM_001471659.1

name	LOC100038860 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268463 GeneID:100038860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038860 transcript_id : XM_001471916.1

name	LOC100043474 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268754 GeneID:100043474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1110 Proteins product : similar to olfactory receptor Olr1092 transcript_id : XM_001480594.1

name	Zfp422-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268744 GeneID:77652 MGI:3028594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 108 ESTs product : zinc finger protein 422, related sequence 1 transcript_id : XM_001480577.1

name	Olfr63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128642 GeneID:258939 MGI:1335096
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 63 transcript_id : NM_146937.1

name	LOC100043468 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268748 GeneID:100043468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs product : similar to Zinc finger protein 422, related sequence 1 transcript_id : XM_001480580.1

name	Zfp81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432559 GeneID:224694 MGI:1890752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 81 transcript_id : NM_207541.1

name	Zfp101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119120796 GeneID:22643 MGI:107547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 101 transcript_id : NM_009542.2

name	1700029I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85662420 GeneID:69481 MGI:1916731
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700029I08 gene transcript_id : NM_183282.2

name	LOC100042953 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268658 GeneID:100042953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to nuclear factor, interleukin 3 regulated transcript_id : XM_001479150.1

name	Adamts10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064868 GeneID:224697 MGI:2449112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 10 transcript_id : NM_172619.2

name	Myo1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859762 GeneID:17916 MGI:107711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IF transcript_id : NM_053214.1

name	Zfp414 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892660 GeneID:328801 MGI:1915641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 414 transcript_id : NM_026712.2

name	Pram1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50726895 GeneID:378460 MGI:3576625
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PML-RAR alpha-regulated adaptor molecule 1 transcript_id : NM_001002842.1

name	Hnrpm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803569 GeneID:76936 MGI:1926465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein M transcript_id : NM_029804.2

name	March2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349138 GeneID:224703 MGI:1925915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-associated ring finger (C3HC4) 2 transcript_id : NM_145486.3

name	Rab11b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431264 GeneID:19326 MGI:99425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11B, member RAS oncogene family transcript_id : NM_008997.3

name	Angptl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181163 GeneID:57875 MGI:1888999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiopoietin-like 4 transcript_id : NM_020581.1

name	Ankrd47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344046 GeneID:80880 MGI:1098615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 47 transcript_id : NM_030697.2

name	Rps28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426820 GeneID:54127 MGI:1859516
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S28 transcript_id : NM_016844.1

name	Ndufa7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891825 GeneID:66416 MGI:1913666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) transcript_id : NM_023202.3

name	Cd320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853587 GeneID:54219 MGI:1860083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD320 antigen transcript_id : NM_019421.3

name	LOC100042967 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268660 GeneID:100042967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to EF hand domain family, member B transcript_id : XM_001479201.1

name	LOC630219 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268762 GeneID:630219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC630219 transcript_id : XM_001480651.1

name	LOC100042970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268662 GeneID:100042970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 34 Proteins product : similar to Kifc1 protein transcript_id : XM_001479207.1

name	BC051226 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268766 GeneID:407803 MGI:3039585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : cDNA sequence BC051226 transcript_id : XM_001480654.1

name	Daxx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181184 GeneID:13163 MGI:1197015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas death domain-associated protein transcript_id : NM_007829.3

name	Zbtb22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560784 GeneID:81630 MGI:1931870
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 22 transcript_id : NM_020625.2

name	Tapbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778973 GeneID:21356 MGI:1201689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAP binding protein transcript_id : NM_001025313.1

name	Tapbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778724 GeneID:21356 MGI:1201689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAP binding protein transcript_id : NM_009318.2

name	Rgl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46195799 GeneID:19732 MGI:107483
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ral guanine nucleotide dissociation stimulator-like 2 transcript_id : NM_009059.2

name	H2-Ke2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754127 GeneID:14976 MGI:95908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2-K region expressed gene 2 transcript_id : NM_010385.1

name	Wdr46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982691 GeneID:57315 MGI:1931871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 46 transcript_id : NM_020603.2

name	B3galt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506416 GeneID:54218 MGI:1859517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-Gal:betaGalNAc beta 1,3-galactosyltransferase, polypeptide 4 transcript_id : NM_019420.1

name	Rps18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755367 GeneID:20084 MGI:98146
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S18 transcript_id : NM_011296.1

name	Vps52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375696 GeneID:224705 MGI:1330304
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 52 (yeast) transcript_id : NM_172620.2

name	EG630499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486607 GeneID:630499 MGI:3644203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG630499 transcript_id : NM_001081015.1

name	AA388235 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380530 GeneID:433100 MGI:3035178
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA388235 transcript_id : NM_001013793.2

name	H2-K1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922587 GeneID:14972 MGI:95904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, K1, K region transcript_id : NM_001001892.2

name	Ring1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982045 GeneID:19763 MGI:1101770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 1 transcript_id : NM_009066.2

name	H2-Ke6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305124 GeneID:14979 MGI:95911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2-K region expressed gene 6 transcript_id : NM_013543.1

name	Slc39a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118150667 GeneID:14977 MGI:95909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 7 transcript_id : NM_001077709.1

name	Slc39a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118150669 GeneID:14977 MGI:95909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 7 transcript_id : NM_008202.2

name	Rxrb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130198 GeneID:20182 MGI:98215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoid X receptor beta transcript_id : NM_011306.3

name	Col11a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753481 GeneID:12815 MGI:88447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XI, alpha 2 transcript_id : NM_009926.1

name	H2-Oa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680150 GeneID:15001 MGI:95924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility 2, O region alpha locus transcript_id : NM_008206.1

name	Hsf2bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401867 GeneID:74377 MGI:1921627
definition	codon_start : 1 product : heat shock transcription factor 2 binding protein protein_id : XP_484622.3

name	Rrp1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076997 CCDS:CCDS28613.1 GeneID:72462 MGI:1919712
definition	GO_component : GO:0030688 - nucleolar preribosome, small subunit precursor [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0004784 - superoxide dismutase activity [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA]; GO:0006801 - superoxide metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ribosomal RNA processing 1 homolog B protein_id : NP_082520.1

name	Notch3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679096 CCDS:CCDS28614.1 GeneID:18131 MGI:99460
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IGI]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0045665 - negative regulation of neuron differentiation [Evidence IMP]; GO:0048663 - neuron fate commitment [Evidence IGI]; GO:0007219 - Notch signaling pathway [Evidence IEA] [Evidence IC]; GO:0050793 - regulation of development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Notch gene homolog 3 protein_id : NP_032742.1

name	Abhd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83716015 CCDS:CCDS28615.1 GeneID:71932 MGI:1919182
definition	codon_start : 1 product : abhydrolase domain containing 9 protein_id : NP_001028335.1

name	Brd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560788 GeneID:57261 MGI:1888520
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0043388 - positive regulation of DNA binding [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; bromodomain-containing 5; fsh-like protein product : bromodomain containing 4 isoform 1 protein_id : NP_065254.2

name	Brd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674287 GeneID:57261 MGI:1888520
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0043388 - positive regulation of DNA binding [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; bromodomain-containing 5; fsh-like protein product : bromodomain containing 4 isoform 2 protein_id : NP_932762.1

name	LOC100043433 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268732 GeneID:100043433
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480528.1

name	Akap8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560394 GeneID:56399 MGI:1928488
definition	GO_component : GO:0000793 - condensed chromosome [Evidence IDA] [Evidence ISS]; GO:0001939 - female pronucleus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0000790 - nuclear chromatin [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007076 - mitotic chromosome condensation [Evidence ISS] [Evidence IDA] codon_start : 1 note : A kinase anchor protein 95 product : A kinase anchor protein 8 protein_id : NP_062748.2

name	Akap8l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70780373 GeneID:54194 MGI:1860606
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : neighbor of A-kinase anchoring protein 95 product : A kinase (PRKA) anchor protein 8-like protein_id : NP_059504.2

name	Wiz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909563 CCDS:CCDS28616.1 GeneID:22404 MGI:1332638
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : widely-interspaced zinc finger motifs isoform 2 protein_id : NP_035847.2

name	Wiz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909565 CCDS:CCDS28617.1 GeneID:22404 MGI:1332638
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : widely-interspaced zinc finger motifs isoform 1 protein_id : NP_997603.1

name	A430107D22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130502228 GeneID:320484 MGI:2444128
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320484 protein_id : NP_848900.2

name	Pglyrp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946624 GeneID:57757 MGI:1928099
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0016020 - membrane [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0016019 - peptidoglycan receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0050830 - defense response to Gram-positive bacterium [Evidence ISS]; GO:0016045 - detection of bacterium [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence ISS]; GO:0009253 - peptidoglycan catabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : TAG-like; peptidoglycan recognition protein-like product : peptidoglycan recognition protein 2 protein_id : NP_067294.1

name	4732474A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893407 CCDS:CCDS28618.1 GeneID:320997 MGI:2445210
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0050051 - leukotriene-B4 20-monooxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 product : cytochrome P450, family 2, subfamily E, polypeptide 2 homolog protein_id : NP_796281.1

name	EG208285 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992694 GeneID:208285 MGI:3646233
definition	codon_start : 1 product : similar to cytochrome P450 4F6 protein_id : XP_139863.4

name	Cyp4f16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277362 CCDS:CCDS28619.1 GeneID:70101 MGI:1917351
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : cytochrome P450, 4f16 product : cytochrome P450, family 4, subfamily f, polypeptide 16 protein_id : NP_077762.1

name	LOC677156 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268739 GeneID:677156
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480582.1

name	EG631304 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401874 GeneID:631304 MGI:3645508
definition	codon_start : 1 product : similar to Cyp4f15 protein protein_id : XP_994086.1

name	Cyp4f15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373165 CCDS:CCDS28620.1 GeneID:106648 MGI:2146921
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, 4f15 product : cytochrome P450 CYP4F15 protein_id : NP_598888.1

name	9030612M13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140969612 GeneID:208292 MGI:1921793
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208292 protein_id : NP_766046.3

name	Zfp811 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147228 GeneID:240063 MGI:2682944
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 811 protein_id : NP_899000.1

name	6030490I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793418 GeneID:240064 MGI:2443934
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein protein_id : NP_796333.2

name	BC066107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402247 GeneID:240066 MGI:3029586
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240066 protein_id : NP_997128.1

name	Cyp4f14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967965 CCDS:CCDS28621.1 GeneID:64385 MGI:1927669
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0050051 - leukotriene-B4 20-monooxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, subfamily IVF, polypeptide 14 (leukotriene B4 omega hydroxylase) product : cytochrome P450, family 4, subfamily f, polypeptide 14 protein_id : NP_071879.1

name	Cyp4f13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373155 CCDS:CCDS28622.1 GeneID:170716 MGI:2158641
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : cytochrome P450,subfamily IVF, polypeptide 13; cytochrome P450 CYP4F13; leukotriene B4 omega hydroxylase product : cytochrome P450, family 4, subfamily f, polypeptide 13 protein_id : NP_570952.1

name	6030422M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20899446 GeneID:77875 MGI:1925125
definition	codon_start : 1 product : hypothetical protein LOC77875 protein_id : XP_128564.1

name	Zfp472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346459 GeneID:224691 MGI:2385049
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : KRAB box containing zinc finger protein; Krab box proteins interacting with myc 1; zin finger protein 472 product : zinc finger protein 472 protein_id : NP_694703.1

name	C920016K16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930752 GeneID:240067 MGI:2441928
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240067 protein_id : NP_001039024.1

name	1700065O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037331 GeneID:73451 MGI:1920701
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : RIKEN cDNA 1700065O13 protein_id : NP_082819.1

name	4921501E09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222274 CCDS:CCDS28624.1 GeneID:74042 MGI:1921292
definition	codon_start : 1 note : KIAA1111-like protein product : PHD finger protein 8 protein_id : NP_001009544.1

name	Zfp563 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930758 GeneID:240068 MGI:2677168
definition	codon_start : 1 note : zinc finger protein NTfin7 product : zinc finger protein ZFP413 protein_id : NP_001020121.2

name	Morc2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244180 GeneID:240069 MGI:3045293
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Morc-like protein product : microrchidia 2B protein_id : NP_808387.1

name	LOC100038859 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268462 GeneID:100038859
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471709.1

name	LOC100038860 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268464 GeneID:100038860
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471966.1

name	LOC100043474 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268755 GeneID:100043474
definition	codon_start : 1 product : similar to olfactory receptor Olr1092 protein_id : XP_001480644.1

name	Zfp422-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268745 GeneID:77652 MGI:3028594
definition	codon_start : 1 product : zinc finger protein 422, related sequence 1 protein_id : XP_001480627.1

name	Olfr63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128643 GeneID:258939 MGI:1335096
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NTC5-9778-8828 product : olfactory receptor 63 protein_id : NP_667148.1

name	LOC100043468 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268749 GeneID:100043468
definition	codon_start : 1 product : similar to Zinc finger protein 422, related sequence 1 protein_id : XP_001480630.1

name	Zfp81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432560 GeneID:224694 MGI:1890752
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : ZFP-36 zinc finger protein product : zinc finger protein 81 protein_id : NP_997424.1

name	Zfp101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119120797 GeneID:22643 MGI:107547
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 101 protein_id : NP_033568.2

name	1700029I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662421 GeneID:69481 MGI:1916731
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69481 protein_id : NP_899105.2

name	LOC100042953 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268659 GeneID:100042953
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479200.1

name	Adamts10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064869 GeneID:224697 MGI:2449112
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IEA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc metalloendopeptidase product : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10 protein_id : NP_766207.2

name	Myo1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859763 GeneID:17916 MGI:107711
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : myosin-1F-like protein product : myosin IF protein_id : NP_444444.1

name	Zfp414 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34850068 GeneID:328801 MGI:1915641
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger, C2H2 type containing protein product : zinc finger protein 414 protein_id : NP_080988.1

name	Pram1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50726896 GeneID:378460 MGI:3576625
definition	codon_start : 1 exception : mismatches in translation product : PML-RARA regulated adaptor molecule 1 protein_id : NP_001002842.1

name	Hnrpm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313308 GeneID:76936 MGI:1926465
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein M protein_id : NP_084080.1

name	March2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542053 CCDS:CCDS28627.1 GeneID:224703 MGI:1925915
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : membrane-associated ring finger (C3HC4) 2 protein_id : NP_663461.2

name	Rab11b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679583 CCDS:CCDS28628.1 GeneID:19326 MGI:99425
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB11B, member RAS oncogene family protein_id : NP_033023.1

name	Angptl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181164 CCDS:CCDS28629.1 GeneID:57875 MGI:1888999
definition	GO_component : GO:0005576 - extracellular region [Evidence IEP]; GO:0005615 - extracellular space [Evidence ISS] [Evidence IDA] GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IDA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0009267 - cellular response to starvation [Evidence NAS]; GO:0043066 - negative regulation of apoptosis [Evidence IDA] [Evidence ISS]; GO:0051005 - negative regulation of lipoprotein lipase activity [Evidence IDA]; GO:0045766 - positive regulation of angiogenesis [Evidence IDA]; GO:0045834 - positive regulation of lipid metabolism [Evidence NAS]; GO:0001666 - response to hypoxia [Evidence ISS] codon_start : 1 exception : mismatches in translation note : major histocompatibility complex region NG27 product : fibrinogen/angiopoietin-related protein protein_id : NP_065606.1

name	Ankrd47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507632 CCDS:CCDS28630.1 GeneID:80880 MGI:1098615
definition	codon_start : 1 product : ankyrin repeat domain 47 protein_id : NP_109622.1

name	Rps28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426821 GeneID:54127 MGI:1859516
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein S28 protein_id : NP_058540.1

name	Ndufa7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963571 CCDS:CCDS28631.1 GeneID:66416 MGI:1913666
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0042773 - ATP synthesis coupled electron transport [Evidence IEA] codon_start : 1 note : NADH oxidoreductase product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (B14.5a) protein_id : NP_075691.1

name	Cd320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853588 CCDS:CCDS28632.1 GeneID:54219 MGI:1860083
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : putative VLDL lipoprotein receptor product : putative VLDL lipoprotein receptor precursor protein_id : NP_062294.3

name	LOC100042967 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268661 GeneID:100042967
definition	codon_start : 1 product : similar to EF hand domain family, member B protein_id : XP_001479251.1

name	LOC630219 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268763 GeneID:630219
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480701.1

name	LOC100042970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268663 GeneID:100042970
definition	codon_start : 1 product : similar to Kifc1 protein protein_id : XP_001479257.1

name	BC051226 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268767 GeneID:407803 MGI:3039585
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480704.1

name	Daxx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181185 CCDS:CCDS28633.1 GeneID:13163 MGI:1197015
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0016605 - PML body [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : death-domain associated protein product : Fas death domain-associated protein protein_id : NP_031855.3

name	Zbtb22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181180 CCDS:CCDS28634.1 GeneID:81630 MGI:1931870
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 297 protein_id : NP_065650.1

name	Tapbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778974 GeneID:21356 MGI:1201689
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA] GO_process : GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA]; GO:0006952 - defense response [Evidence IMP]; GO:0050823 - peptide antigen stabilization [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Tapasin product : TAP binding protein isoform 1 protein_id : NP_001020484.1

name	Tapbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678219 GeneID:21356 MGI:1201689
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003823 - antigen binding [Evidence IEA] GO_process : GO:0019885 - antigen processing and presentation of endogenous peptide antigen via MHC class I [Evidence IEA]; GO:0006952 - defense response [Evidence IMP]; GO:0050823 - peptide antigen stabilization [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Tapasin product : TAP binding protein isoform 2 protein_id : NP_033344.1

name	Rgl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195800 CCDS:CCDS28635.1 GeneID:19732 MGI:107483
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : ral guanine nucleotide dissociation stimulator,-like 2; RalGDS-like; RalGDS-like factor product : RAB2, member RAS oncogene family-like protein_id : NP_033085.2

name	H2-Ke2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754128 CCDS:CCDS28636.1 GeneID:14976 MGI:95908
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : H2-K region expressed gene 2 protein_id : NP_034515.1

name	Wdr46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181122 CCDS:CCDS28637.1 GeneID:57315 MGI:1931871
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : WD repeat domain 46 protein_id : NP_065628.1

name	B3galt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506417 CCDS:CCDS28638.1 GeneID:54218 MGI:1859517
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0047915 - ganglioside galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 function : ganglioside glycosyltransferase note : UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4 product : UDP-Gal:betaGalNAc beta 1,3-galactosyltransferase, polypeptide 4 protein_id : NP_062293.1

name	Rps18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755368 GeneID:20084 MGI:98146
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0019843 - rRNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein S18 protein_id : NP_035426.1

name	Vps52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60687520 GeneID:224705 MGI:1330304
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : SAC2 product : vacuolar protein sorting 52 protein_id : NP_766208.1

name	EG630499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486608 GeneID:630499 MGI:3644203
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 product : predicted gene, EG630499 protein_id : NP_001074484.1

name	AA388235 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701480 GeneID:433100 MGI:3035178
definition	codon_start : 1 product : hypothetical protein LOC433100 protein_id : NP_001013815.1

name	H2-K1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922588 GeneID:14972 MGI:95904
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA]; GO:0006952 - defense response [Evidence TAS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; MHC class I H2-K-b-alpha-2 cell surface glycoprotein; MHC H2-K transplantation antigen; MHC K-bm6 transplantation antigen; MHC class I heavy chain H2-K; H-2Kd homolog; class I major histocompatibility antigen H-2Kd; MHC class Ia H2-K antigen; MHC (A.CA/J(H-2K-f) class I antigen product : histocompatibility 2, K1, K region isoform 1 protein_id : NP_001001892.2

name	Ring1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982046 GeneID:19763 MGI:1101770
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0031519 - PcG protein complex [Evidence IDA]; GO:0001739 - sex chromatin [Evidence IDA]; GO:0000151 - ubiquitin ligase complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP] [Evidence IGI]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IGI]; GO:0016574 - histone ubiquitination [Evidence IDA] [Evidence IGI]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ring finger protein 1 protein_id : NP_033092.2

name	H2-Ke6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305125 GeneID:14979 MGI:95911
definition	EC_number : 1.1.1.62 GO_component : GO:0005624 - membrane fraction [Evidence IDA]; GO:0005740 - mitochondrial envelope [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0004303 - estradiol 17-beta-dehydrogenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0050327 - testosterone 17-beta-dehydrogenase activity [Evidence IDA] GO_process : GO:0008209 - androgen metabolism [Evidence IDA]; GO:0008210 - estrogen metabolism [Evidence IDA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : 17-beta-hydroxysteroid dehydrogenase 8; 17-beta-HSD 8; Estrogen 17-oxidoreductase product : estradiol 17 beta-dehydrogenase 8 protein_id : NP_038571.1

name	Slc39a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118150668 GeneID:14977 MGI:95909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006829 - zinc ion transport [Evidence IEA] codon_start : 1 note : H2-K region expressed gene 4 product : solute carrier family 39, member 7 protein_id : NP_001071177.1

name	Slc39a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118150670 GeneID:14977 MGI:95909
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006829 - zinc ion transport [Evidence IEA] codon_start : 1 note : H2-K region expressed gene 4 product : solute carrier family 39, member 7 protein_id : NP_032228.2

name	Rxrb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13489062 GeneID:20182 MGI:98215
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : retinoid X receptor beta protein_id : NP_035436.1

name	Col11a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753482 CCDS:CCDS28640.1 GeneID:12815 MGI:88447
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : procollagen, type XI, alpha 2 protein_id : NP_034056.1

name	H2-Oa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680151 GeneID:15001 MGI:95924
definition	GO_function : GO:0003823 - antigen binding [Evidence IEA]; GO:0045012 - MHC class II receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IMP]; GO:0019884 - antigen processing and presentation of exogenous antigen [Evidence IEA]; GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP]; GO:0045580 - regulation of T cell differentiation [Evidence IMP] codon_start : 1 exception : mismatches in translation function : unknown product : histocompatibility 2, O region alpha locus protein_id : NP_032232.1

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 11 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 10 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 9 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 8 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 7 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 6 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 5 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 4 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 3 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 2 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 1 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 1 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 2 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 3 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 4 pseudo : _no_value

name	LOC623809 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623809
definition	number : 1 pseudo : _no_value

name	LOC100042989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042989
definition	number : 2 pseudo : _no_value

name	LOC100042989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042989
definition	number : 1 pseudo : _no_value

name	LOC672505 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672505
definition	number : 4 pseudo : _no_value

name	LOC672505 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672505
definition	number : 3 pseudo : _no_value

name	LOC672505 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672505
definition	number : 2 pseudo : _no_value

name	LOC672505 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672505
definition	number : 1 pseudo : _no_value

name	H2-Pa (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : H2-Pa-ps note : H2-Pa sequence after removal of the inserted nucleotide g at the position 136, insertion of a deleted nucleotide after the position 835, and deletion of B1 repeat plus 15 duplicated nucleotides pseudo : _no_value

name	LOC100043434 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268733 GeneID:100043434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to ribosomal protein L34 pseudo : _no_value transcript_id : XR_034714.1

name	LOC631266 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268752 GeneID:631266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 10 Proteins product : similar to ribosomal protein L7 pseudo : _no_value transcript_id : XR_034756.1

clone name	MSMg01-392C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359P08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-420H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181C23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-313N16.b	B6Ng01-313N16.g
ACC	GA104950	GA104951
length	1,105	1,180
definition	B6Ng01-313N16.b	B6Ng01-313N16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(33,110,742 - 33,111,857)	(33,240,924 - 33,242,116)
sequence	gaattcatctagcaatatggaatttcatcaaagaagtaaaattatagtta gctgatgatctagctatatgattaggaaatataaaggaaatgttcacatg ggcatacaataaaaacaccttcatatccaaatttatgacctcatagttta gaatagccaagtcaaaaaaaaaatagccaaatactattcagaaaataatt tacttggatttttttattgtgttctaagttcttttcacataccaccatta ctctcacttcttttccttctgaagcatttattcctaacaggtccctctct ttgtttgtgccctactgaatttaaggagcattgcttgaatgaacctgggt atatttttatattttgtttttgagataggctctcactgtatagctctagt aggcctggaacttgagagttttgcctgcctttgcttccatcttttgggat taaatgtgtatgccaccctacccagctgttggtcatctgttgatttgttt ttactggtgtgtagggaactatagctctggacaaaatgattcatttccgt tagtgttagcagccactaacagtcagtatcctcagaaaggggaatcgcct caggaagggtgatgggcattatcctgtgcccgttaccacagcctctgtga attgcggtatattgcctatgtttgtcaagaagaccacatttcacacctct ctttgatgacccatttaggcctaagcactcaccaatcacttgatctcaga acattgaccagctccgtagtctctgcattaactattaactactgcaaata aatgtcccctcaccaagactgaaagcagtgcatatctgtggatagactta tacatatttagagaaccattttgaaagcatttcagtttagaaaaacaaaa ctaattagtaccccctttgggcctgtcacctccctaagcaatagtttaaa gtaacagccgtgtgtcgttcctatggagaatccctgaaatccaatcagaa gcgttagtttcggttgctgtgataaacgcccttatcaaaagcacatgggg gagcgatggtttatttttcttaactcagttgtcattgaggaagtcagcca acaac	gaattctttcatggcgtggaagtgaactttgaccagtgaaagctttccca caatacttacatacaaagggtttctctccgctgtgaatcctgtcatgacg tcgaagggaaccacgactagggaaggctttcccacagtggttacatatgt agggtttctcaccggtatgagttctttcatgtcttcgaaccttacttgaa gaagaaaaggctttcccacattgatgacatttatacggtttctcaatggt gtgggtatttccatgtttcagatagcactcaggatacatgaaggttttcc cacactccctaaatttatagagactgtcttcatatacctcatattcatat cgtttatgtcctggttgaagaggaatatgcatatttaggggtggaagacc aataagtatgtcttcacataaattactttcacaccgttttactccatgag aggttttcttgttcataacagtatctggaaactcactgaagattccgtca cattgtctgccttcactgggtttatacaataattccaccagtccacgtct gtaaaaagtagaaggcatagcactcagatttcacttataagttaccagtc agaaccattgttcatagtttacatggctagaattctttaacatgaatgtg ctaaatgtcccacaggatttctagagaacatatgtgaagattctggtatt catatagatgttaacacttttaccaagtaaaatattctgcaaacactgaa tgcccatgccattatgcttgcttattcacttgtttatttttcattattca tttgttctggagtcttgcttcttgctgtgctgcttaagtttgaactaact accatctattgctagaactgtcattagtcagtactaaaggtgcctctcta tgacacatattctttaaacaaaatgcttctacaaaaatgctttcagattt taaaatacttgcatatattcagtaaattttgagatgataccagtgaaaga aacattccttcagcttttaaattattatactgggttagtagagggagact tgtattaaaggtctagaggaaacttggttggagtcatacactcttcatta aaaggaaaaaaatctcatactcaagcctggaagagagtcatacattctac ctattatttatctttaaacgagtattattt
quality values	Open. Hide. 58 41 27 28 62 41 20 47 62 54 47 62 47 56 62 62 62 47 62 62 62 62 47 62 62 59 44 62 59 59 62 36 34 45 28 34 51 34 28 32 46 59 62 62 62 59 59 62 59 59 62 62 62 62 59 59 62 59 59 62 62 59 62 62 59 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 54 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 54 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 46 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 54 54 58 58 58 54 58 58 54 58 58 52 58 58 58 54 58 58 58 58 58 58 54 58 54 54 58 58 58 58 58 58 58 54 58 54 58 58 58 58 52 58 58 54 54 58 54 54 54 54 54 54 58 52 58 58 52 48 58 58 52 47 48 51 51 40 45 54 51 51 50 37 58 58 51 38 58 41 41 58 45 42 58 58 58 50 49 51 58 54 58 49 58 58 58 52 58 51 58 58 58 54 54 46 49 41 39 58 53 51 58 58 58 54 51 58 50 50 58 37 34 58 58 39 58 58 50 41 39 50 49 58 54 35 41 44 52 51 51 51 58 49 58 50 50 50 49 40 58 49 39 46 22 41 52 53 53 51 58 58 53 50 50 53 53 54 58 49 58 52 50 54 53 52 37 30 41 41 32 46 44 37 51 54 49 39 31 54 34 44 40 32 32 32 53 32 46 47 42 35 52 50 27 49 53 52 40 41 54 44 39 41 52 42 53 37 31 34 54 53 37 33 46 53 42 37 35 35 37 34 52 41 33 54 34 34 42 30 52 52 40 41 45 45 32 28 41 38 35 31 32 34 31 31 34 31 45 34 39 34 52 31 52 32 31 51 36 41 32 53 31 42 53 32 32 46 46 45 34 31 28 23 40 24 42 31 36 29 31 29 33 51 38 30 37 35 31 28 41 28 26 31 30 31 31 31 37 34 43 31 34 34 31 30 30 25 29 42 31 28 25 32 27 31 26 32 47 29 32 31 42 31 31 31 21 36 24 43 46 46 32 29 43 48 38 30 28 23 32 47 25 30 35 31 31 47 32 27 23 38 48 48 48 33 30 30 48 46 31 33 33 37 31 31 41 34 24 24 31 31 41 32 23 18 31 47 22 28 44 31 14 19 32 37 19 22 20 18 15 21 26 48 25 26 21 25 22 31 26 24 19 31 27 37 48 32 32 47 27 33 31 31 23 21 17 14 20 26 27 15 20 16 17 43 11 21 22 22 19 37 31 24 21 30 19 34 11 14 30 27 23 40 26 33 21 26 47 18 20 17 26 22 17 18 23 31 9 43 16 13 19 15 18 19 32 18 26 30 16 20 11 23 23 10 23 15 24 24 24 20 28 18 14 40 27 14 14 24 28 11 13 15 24 24 9 10 34 31 21 24 10 11 4 15 20 28 34 47 34 7 10 15 4 7 22 15 15 19 9 26 6 14 17 29 28 19 5 6 7 14 9 5 6 15 3 4 7 16 8 19 5 11 15 23 17 12 10 11 17 7 8 8 18 10 4 5 1 5 21 7 12 6 4 11	Open. Hide. 62 47 51 47 62 62 62 62 62 44 23 51 46 38 32 45 46 62 51 59 62 62 62 62 62 62 59 62 62 62 62 59 62 59 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 49 58 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 46 58 58 46 54 58 58 38 43 58 58 58 58 58 58 58 52 58 58 58 58 58 52 58 54 58 58 49 51 49 51 58 58 51 58 58 54 58 54 51 53 58 42 58 58 53 53 54 58 51 49 54 41 58 58 58 58 50 58 42 37 58 58 54 53 53 58 44 47 58 50 58 58 58 53 54 53 50 50 51 50 58 58 41 52 53 40 58 58 58 49 58 53 53 58 40 40 51 50 51 58 53 41 50 52 52 51 58 58 44 50 58 50 53 53 41 50 58 50 47 58 52 49 58 50 37 50 50 29 58 39 31 58 50 52 52 53 52 50 40 51 38 38 38 52 52 53 51 40 44 54 54 42 45 30 49 53 45 54 54 37 42 40 52 45 29 52 39 52 47 40 42 41 53 47 38 32 32 42 34 53 39 54 54 37 37 47 32 32 52 29 21 16 54 54 38 40 43 45 47 53 37 35 31 26 54 47 38 37 37 40 53 46 24 29 37 26 52 42 31 40 53 53 45 31 45 53 45 40 37 37 52 32 52 41 29 52 32 39 32 33 28 34 34 42 52 33 52 24 35 27 49 52 53 41 34 31 26 51 31 30 31 31 31 46 37 27 38 23 24 31 19 29 46 43 31 30 30 34 25 40 31 36 34 30 31 17 32 25 31 31 19 32 32 31 31 29 30 42 21 33 31 32 47 35 31 34 33 31 30 32 28 31 31 27 18 32 29 31 38 38 36 34 32 38 24 29 31 31 42 32 23 21 31 32 30 27 31 41 31 31 38 33 29 23 31 32 31 28 31 44 33 37 42 33 36 25 25 16 25 32 32 27 23 23 25 27 21 14 25 18 32 22 29 32 32 31 48 31 28 48 34 31 29 44 41 24 21 42 31 33 35 26 28 26 25 6 41 38 44 33 31 29 14 30 47 26 17 21 19 31 18 48 48 22 24 43 43 16 15 13 23 19 15 34 33 19 23 23 27 21 27 37 33 31 31 22 24 37 10 19 47 39 18 18 18 6 24 11 21 33 14 22 6 20 21 15 15 4 4 19 13 7 12 21 18 7 5 28 28 14 12 10 9 14 25 10 19 28 38 38 20 11 31 10 27 13 18 15 17 9 34 11 28 20 32 47 27 7 9 33 12 7 20 6 9 6 22 10 16 6 7 11 13 5 5 9 6 5 9 10 29 15 10 11 16 12 19 12 7 11 7 16 11 29 15 8 7 8 20 19 4 7 18 7 11 4 6 10 21 6 4 6 6 10 10 10 4 19 10 12 6 14 7 23 26 13 7 4 18 28 28 28 25 17 3 2 4 10 21 7 4 5 9 5 7 18 16 8 10 16 4 11 6 21 18 9 5 3 2 2 6 11 3 4 5 12 1 5 3 4 7 6 4 2 5 2 2 3 8 4 13 6 24 4 14 12 25 4 12 10 6 5 5 8 4 5 13 22 7 5 4 3 12

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_33110742_33111857
seq2: B6Ng01-313N16.b_46_1150

seq1  GAATTCATCTAGCAATATGGAATTTCATCAAAGAAGTAAAATTATAGTTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCTAGCAATATGGAATTTCATCAAAGAAGTAAAATTATAGTTA  50

seq1  GCTGATGATCTAGCTATATGATTAGGAAATATAAAGGAAATGTTCACATG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGATGATCTAGCTATATGATTAGGAAATATAAAGGAAATGTTCACATG  100

seq1  GGCATACAATAAAAACACCTTCATATCCAAATTTATGACCTCATAGTTTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATACAATAAAAACACCTTCATATCCAAATTTATGACCTCATAGTTTA  150

seq1  GAATAGCCAAGTCAAAAAAAAAATAGCCAAATACTATTCAGAAAATAATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATAGCCAAGTCAAAAAAAAAATAGCCAAATACTATTCAGAAAATAATT  200

seq1  TACTTGGATTTTTTTATTGTGTTCTAAGTTCTTTTCACATACCACCATTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTGGATTTTTTTATTGTGTTCTAAGTTCTTTTCACATACCACCATTA  250

seq1  CTCTCACTTCTTTTCCTTCTGAAGCATTTATTCCTAACAGGTCCCTCTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCACTTCTTTTCCTTCTGAAGCATTTATTCCTAACAGGTCCCTCTCT  300

seq1  TTGTTTGTGCCCTACTGAATTTAAGGAGCATTGCTTGAATGAACCTGGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTGTGCCCTACTGAATTTAAGGAGCATTGCTTGAATGAACCTGGGT  350

seq1  ATATTTTTATATTTTGTTTTTGAGATAGGCTCTCACTGTATAGCTCTAGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTTTTATATTTTGTTTTTGAGATAGGCTCTCACTGTATAGCTCTAGT  400

seq1  AGGCCTGGAACTTGAGAGTTTTGCCTGCCTTTGCTTCCATCTTTTGGGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCTGGAACTTGAGAGTTTTGCCTGCCTTTGCTTCCATCTTTTGGGAT  450

seq1  TAAATGTGTATGCCACCCTACCCAGCTGTTGGTCATCTGTTGATTTGTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATGTGTATGCCACCCTACCCAGCTGTTGGTCATCTGTTGATTTGTTT  500

seq1  TTACTGGTGTGTAGGGAACTATAGCTCTGGACAAAATGATTCATTTCCGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTGGTGTGTAGGGAACTATAGCTCTGGACAAAATGATTCATTTCCGT  550

seq1  TAGTGTTAGCAGCCACTAACAGTCAGTATCCTCAGAAAGGGGAATCGCCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGTTAGCAGCCACTAACAGTCAGTATCCTCAGAAAGGGGAATCGCCT  600

seq1  CAGGAAGGGTGATGGGCATTATCCTGTGCCCGTTACCACAGCCTCTGTGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAGGGTGATGGGCATTATCCTGTGCCCGTTACCACAGCCTCTGTGA  650

seq1  ATTGCGGTATATTGCCTATGTTTGTCAAGAAGACCACATTTCACACCTCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGCGGTATATTGCCTATGTTTGTCAAGAAGACCACATTTCACACCTCT  700

seq1  CTTTGATGACCCATTTAGGCCTAAGCACTCACCAATCACTTGATCTCAGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGATGACCCATTTAGGCCTAAGCACTCACCAATCACTTGATCTCAGA  750

seq1  ACATTGACCAGCTCCGTAGTCTCTGCATTAACTATTAACTACTGCAAATA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTGACCAGCTCCGTAGTCTCTGCATTAACTATTAACTACTGCAAATA  800

seq1  AATGTCCCCTCACCAAGACTGAAAGCAGTGCATATCTGTGGATAGACTTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTCCCCTCACCAAGACTGAAAGCAGTGCATATCTGTGGATAGACTTA  850

seq1  TACATATTTAGAGAACCATTTTGAAAGCATTTCAGTTTAGAAAAACAAAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATATTTAGAGAACCATTTTGAAAGCATTTCAGTTTAGAAAAACAAAA  900

seq1  CTAATTAGTACCCCCTTTGGGCCTGTCACCTCCCTAAGCAATAGTTTAAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATTAGTACCCCCTTTGGGCCTGTCACCTCCCTAAGCAATAGTTTAAA  950

seq1  GTAACAGCCGTGTGTTCGTTCCTATGGAGAATCCCTGAAATCCAATCAGA  1000
      |||||||||||||| |||||||||||||||||||||||||||||||||| 
seq2  GTAACAGCCGTGTG-TCGTTCCTATGGAGAATCCCTGAAATCCAATCAG-  998

seq1  AAGCGTTAGTTTCGGTTGCTGTGATAAAACGCCCTTATCAAAAGCAACAT  1050
      ||||||||||||||||||||||||| ||||||||||||||||||| ||||
seq2  AAGCGTTAGTTTCGGTTGCTGTGAT-AAACGCCCTTATCAAAAGC-ACAT  1046

seq1  GGGGGAGGCGATGGTTTATTTTTCTTACACTTCCAGTTGGTCATTGAGGG  1100
      |||||| |||||||||||||||||||| |||  ||||| |||||||| ||
seq2  GGGGGA-GCGATGGTTTATTTTTCTTA-ACT--CAGTT-GTCATTGA-GG  1090

seq1  AAGTCAGGGCAACAAC  1116
      |||||| | |||||||
seq2  AAGTCA-GCCAACAAC  1105

seq1: chr17_33240924_33242116
seq2: B6Ng01-313N16.g_69_1248 (reverse)

seq1  AAATAAATACTGTTTTAAAGATTAAATAATAAAAGTAGAAAATGTATGAC  50
      |||| ||||||  |||||||| ||||||||  | ||||  ||||||||||
seq2  AAAT-AATACTCGTTTAAAGA-TAAATAAT--AGGTAG--AATGTATGAC  44

seq1  ATCATCTT-CAGGCTTTGAGTATGAGATTTTTTTTCTTTTAATGAAGAGT  99
       || |||| ||||| ||||||||||||||||||| |||||||||||||||
seq2  -TC-TCTTCCAGGC-TTGAGTATGAGATTTTTTTCCTTTTAATGAAGAGT  91

seq1  GTATTGACTCC-ACCAAGTTTTCCTCTAAGACCTTT-ATAC-AGTCT-CC  145
      ||| ||||||| |||||| |||||||| |||||||| |||| ||||| ||
seq2  GTA-TGACTCCAACCAAG-TTTCCTCT-AGACCTTTAATACAAGTCTCCC  138

seq1  TCTACTTACCCAGTAATAATAATTTAAAAGCTTGAAGGAATGTTTTCTTT  195
      |||||| ||||||| |||||||||||||||| |||||||||| |||||||
seq2  TCTACTAACCCAGT-ATAATAATTTAAAAGC-TGAAGGAATG-TTTCTTT  185

seq1  CCACTGGTTATCATCTTCAAAATTTACTGAATATATGCAAGTATTTTAAA  245
       |||||| ||||||| ||||||||||||||||||||||||||||||||||
seq2  -CACTGG-TATCATC-TCAAAATTTACTGAATATATGCAAGTATTTTAAA  232

seq1  ATCTGAAAGCATTTTTGTAGAAGCATTTTGTTTAAAGAATATGTGTCATA  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGAAAGCATTTTTGTAGAAGCATTTTGTTTAAAGAATATGTGTCATA  282

seq1  GAGAGGCACCTTTAGTACTGACTAATGACAGTTCTAGCAATAGATGGTAG  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGGCACCTTTAGTACTGACTAATGACAGTTCTAGCAATAGATGGTAG  332

seq1  TTAGTTCAAACTTAAGCAGCACAGCAAGAAGCAAGACTCCAGAACAAATG  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTTCAAACTTAAGCAGCACAGCAAGAAGCAAGACTCCAGAACAAATG  382

seq1  AATAATGAAAAATAAACAAGTGAATAAGCAAGCATAATGGCATGGGCATT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAATGAAAAATAAACAAGTGAATAAGCAAGCATAATGGCATGGGCATT  432

seq1  CAGTGTTTGCAGAATATTTTACTTGGTAAAAGTGTTAACATCTATATGAA  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGTTTGCAGAATATTTTACTTGGTAAAAGTGTTAACATCTATATGAA  482

seq1  TACCAGAATCTTCACATATGTTCTCTAGAAATCCTGTGGGACATTTAGCA  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCAGAATCTTCACATATGTTCTCTAGAAATCCTGTGGGACATTTAGCA  532

seq1  CATTCATGTTAAAGAATTCTAGCCATGTAAACTATGAACAATGGTTCTGA  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCATGTTAAAGAATTCTAGCCATGTAAACTATGAACAATGGTTCTGA  582

seq1  CTGGTAACTTATAAGTGAAATCTGAGTGCTATGCCTTCTACTTTTTACAG  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTAACTTATAAGTGAAATCTGAGTGCTATGCCTTCTACTTTTTACAG  632

seq1  ACGTGGACTGGTGGAATTATTGTATAAACCCAGTGAAGGCAGACAATGTG  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTGGACTGGTGGAATTATTGTATAAACCCAGTGAAGGCAGACAATGTG  682

seq1  ACGGAATCTTCAGTGAGTTTCCAGATACTGTTATGAACAAGAAAACCTCT  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGGAATCTTCAGTGAGTTTCCAGATACTGTTATGAACAAGAAAACCTCT  732

seq1  CATGGAGTAAAACGGTGTGAAAGTAATTTATGTGAAGACATACTTATTGG  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGAGTAAAACGGTGTGAAAGTAATTTATGTGAAGACATACTTATTGG  782

seq1  TCTTCCACCCCTAAATATGCATATTCCTCTTCAACCAGGACATAAACGAT  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCACCCCTAAATATGCATATTCCTCTTCAACCAGGACATAAACGAT  832

seq1  ATGAATATGAGGTATATGAAGACAGTCTCTATAAATTTAGGGAGTGTGGG  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAATATGAGGTATATGAAGACAGTCTCTATAAATTTAGGGAGTGTGGG  882

seq1  AAAACCTTCATGTATCCTGAGTGCTATCTGAAACATGGAAATACCCACAC  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACCTTCATGTATCCTGAGTGCTATCTGAAACATGGAAATACCCACAC  932

seq1  CATTGAGAAACCGTATAAATGTCATCAATGTGGGAAAGCCTTTTCTTCTT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGAGAAACCGTATAAATGTCATCAATGTGGGAAAGCCTTTTCTTCTT  982

seq1  CAAGTAAGGTTCGAAGACATGAAAGAACTCATACCGGTGAGAAACCCTAC  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTAAGGTTCGAAGACATGAAAGAACTCATACCGGTGAGAAACCCTAC  1032

seq1  ATATGTAACCACTGTGGGAAAGCCTTCCCTAGTCGTGGTTCCCTTCGACG  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGTAACCACTGTGGGAAAGCCTTCCCTAGTCGTGGTTCCCTTCGACG  1082

seq1  TCATGACAGGATTCACAGCGGAGAGAAACCCTTTGTATGTAAGTATTGTG  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGACAGGATTCACAGCGGAGAGAAACCCTTTGTATGTAAGTATTGTG  1132

seq1  GGAAAGCTTTCACTGGTCAAAGTTCACTTCCACGCCATGAAAGAATTC  1193
      ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAGCTTTCACTGGTCAAAGTTCACTTCCACGCCATGAAAGAATTC  1180

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information