MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-321N01
Chromosome	17 (Build37)
Map Location	46,789,824 - 46,943,391
singlet/doublet	doublet
Overlap gene	Cul7, BC011248, Klhdc3, Mea1, Ppp2r5d, Pex6, Gnmt, Tnrc5, Ptcra, 2310039H08Rik, Rpl7l1, BC032203
Upstream gene	Capn11, Tmem63b, Mrpl14, LOC100043363, Vegfa, Mrps18a, 1700027N10Rik, Mad2l1bp, Gtpbp2, Polh, Xpo5, Rpo1-1, Yipf3, Gm88, Tjap1, Egfl9, Abcc10, BC040756, Zfp318, LOC677168, Crip3, Slc22a7, EG328825, Ttbk1, BC048355, Parc, Srf, Ptk7, Klc4, Mrpl2
Downstream gene	A330017A19Rik, Tbcc, Prph2, Ubr2, LOC100043385, EG240110, Trerf1, Mrps10, Guca1b, Guca1a, EG545208, 1700001C19Rik, AI661453, Tbn, Ccnd3, Bysl, Trfp, LOC668463, Usp49, 1110002E23Rik, Frs3, Pgc, LOC100043405, Tcfeb
Link	Open Mouse BAC browser

Click to get alignment info.

name	Capn11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268958 MGI:1352490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem63b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224807 MGI:2387609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68463 MGI:1333864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043363 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Vegfa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22339 MGI:103178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Mrps18a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68565 MGI:1915815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700027N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75564 MGI:1922814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mad2l1bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66591 MGI:1913841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtpbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56055 MGI:1860138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80905 MGI:1891457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpo5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72322 MGI:1913789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpo1-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20016 MGI:103288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Yipf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28064 MGI:106280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224813 MGI:2684934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 3 Proteins

name	Tjap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74094 MGI:1921344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egfl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106565 MGI:2146838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcc10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224814 MGI:2386976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC040756 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414073 MGI:3041251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Zfp318 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57908 MGI:1889348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC677168 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs pseudo : _no_value

name	Crip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114570 MGI:2152434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc22a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108114 MGI:1859559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG328825 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328825 MGI:3644404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 550 ESTs, 7 Proteins

name	Ttbk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106763 MGI:2147036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs, 7 Proteins

name	BC048355 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381101 MGI:3039376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78309 MGI:1925559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20807 MGI:106658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptk7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71461 MGI:1918711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74764 MGI:1922014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27398 MGI:1351622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cul7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66515 MGI:1913765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC011248 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224823 MGI:2385053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhdc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71765 MGI:2651568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mea1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17256 MGI:96957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp2r5d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21770 MGI:2388481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224824 MGI:2385054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14711 MGI:1202304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72029 MGI:1919279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptcra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19208 MGI:104857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310039H08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67101 MGI:1914351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl7l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66229 MGI:1913479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC032203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210982 MGI:2673855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 103 ESTs, 2 Proteins

name	A330017A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442840 MGI:3045380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs

name	Tbcc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72726 MGI:1919976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19133 MGI:102791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224826 MGI:1861099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043385 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	EG240110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240110 MGI:3647512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 4 Proteins

name	Trerf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224829 MGI:2442086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64657 MGI:1928139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Guca1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107477 MGI:1194489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Guca1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14913 MGI:102770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545208 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545208 MGI:3648910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 347 ESTs, 4 Proteins

name	1700001C19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75462 MGI:1922712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI661453 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224833 MGI:2146908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63856 MGI:1926879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12445 MGI:88315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Bysl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53414 MGI:1858419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trfp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56771 MGI:1929648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668463 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 15 Proteins pseudo : _no_value

name	Usp49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224836 MGI:2685391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110002E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66119 MGI:1913369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107971 MGI:2135965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109820 MGI:98909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Tcfeb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21425 MGI:103270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131210 GeneID:268958 MGI:1352490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 11 transcript_id : NM_001013767.2

name	Tmem63b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376394 GeneID:224807 MGI:2387609
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 63b transcript_id : NM_198167.2

name	Mrpl14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980860 GeneID:68463 MGI:1333864
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L14 transcript_id : NM_026732.2

name	Vegfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131120 GeneID:22339 MGI:103178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vascular endothelial growth factor A transcript_id : NM_001025257.2

name	Vegfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130279 GeneID:22339 MGI:103178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vascular endothelial growth factor A transcript_id : NM_009505.3

name	Vegfa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131137 GeneID:22339 MGI:103178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vascular endothelial growth factor A transcript_id : NM_001025250.2

name	Mrps18a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359013 GeneID:68565 MGI:1915815
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S18A transcript_id : NM_026768.2

name	1700027N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357778 GeneID:75564 MGI:1922814
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700027N10 gene transcript_id : NM_029338.2

name	Mad2l1bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352597 GeneID:66591 MGI:1913841
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAD2L1 binding protein transcript_id : NM_025649.2

name	Gtpbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980943 GeneID:56055 MGI:1860138
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 2 transcript_id : NM_019581.2

name	Polh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378119 GeneID:80905 MGI:1891457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), eta (RAD 30 related) transcript_id : NM_030715.3

name	Xpo5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130447 GeneID:72322 MGI:1913789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exportin 5 transcript_id : NM_028198.2

name	Rpo1-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226250 GeneID:20016 MGI:103288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA polymerase 1-1 transcript_id : NM_009085.2

name	Yipf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703703 GeneID:28064 MGI:106280
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Yip1 domain family, member 3 transcript_id : NM_145353.1

name	Gm88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268856 GeneID:224813 MGI:2684934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 3 Proteins product : gene model 88, (NCBI) transcript_id : XM_001481057.1

name	Tjap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27229172 GeneID:74094 MGI:1921344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tight junction associated protein 1 transcript_id : NM_028751.2

name	Egfl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:102468233 GeneID:106565 MGI:2146838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGF-like-domain, multiple 9 transcript_id : NM_207666.2

name	Abcc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:102467836 GeneID:224814 MGI:2386976
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 10 transcript_id : NM_170680.2

name	Abcc10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:102467835 GeneID:224814 MGI:2386976
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 10 transcript_id : NM_145140.2

name	BC040756 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268721 GeneID:414073 MGI:3041251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : cDNA sequence BC040756 transcript_id : XM_001480054.1

name	Zfp318 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946663 GeneID:57908 MGI:1889348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 318 transcript_id : NM_021346.1

name	Zfp318 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849777 GeneID:57908 MGI:1889348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 318 transcript_id : NM_207671.2

name	Crip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891750 GeneID:114570 MGI:2152434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich protein 3 transcript_id : NM_053250.2

name	Crip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892348 GeneID:114570 MGI:2152434
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich protein 3 transcript_id : NM_181664.2

name	Slc22a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450072 GeneID:108114 MGI:1859559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 22 (organic anion transporter), member 7 transcript_id : NM_144856.1

name	EG328825 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94402013 GeneID:328825 MGI:3644404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 550 ESTs, 7 Proteins product : predicted gene, EG328825 transcript_id : XM_286185.6

name	Ttbk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268724 GeneID:106763 MGI:2147036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs, 7 Proteins product : tau tubulin kinase 1 transcript_id : XM_001480065.1

name	BC048355 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802674 GeneID:381101 MGI:3039376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048355 transcript_id : NM_207161.3

name	Parc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486736 GeneID:78309 MGI:1925559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : p53-associated parkin-like cytoplasmic protein transcript_id : NM_001081335.1

name	Srf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892959 GeneID:20807 MGI:106658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum response factor transcript_id : NM_020493.2

name	Ptk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351040 GeneID:71461 MGI:1918711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PTK7 protein tyrosine kinase 7 transcript_id : NM_175168.3

name	Klc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366781 GeneID:74764 MGI:1922014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin light chain 4 transcript_id : NM_029091.2

name	Mrpl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130368 GeneID:27398 MGI:1351622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L2 transcript_id : NM_025302.3

name	Cul7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58761521 GeneID:66515 MGI:1913765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cullin 7 transcript_id : NM_025611.5

name	BC011248 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450074 GeneID:224823 MGI:2385053
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC011248 transcript_id : NM_144857.1

name	Klhdc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801739 GeneID:71765 MGI:2651568
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 3 transcript_id : NM_027910.2

name	Mea1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754673 GeneID:17256 MGI:96957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : male enhanced antigen 1 transcript_id : NM_010787.1

name	Ppp2r5d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942058 GeneID:21770 MGI:2388481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), delta isoform transcript_id : NM_009358.2

name	Pex6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703961 GeneID:224824 MGI:2385054
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 6 transcript_id : NM_145488.1

name	Gnmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754025 GeneID:14711 MGI:1202304
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine N-methyltransferase transcript_id : NM_010321.1

name	Tnrc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982623 GeneID:72029 MGI:1919279
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 5 transcript_id : NM_028065.2

name	Ptcra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755215 GeneID:19208 MGI:104857
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre T-cell antigen receptor alpha transcript_id : NM_011195.1

name	2310039H08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286871 GeneID:67101 MGI:1914351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310039H08 gene transcript_id : NM_025966.3

name	Rpl7l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130326 GeneID:66229 MGI:1913479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L7-like 1 transcript_id : NM_025433.3

name	BC032203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268859 GeneID:210982 MGI:2673855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 102 ESTs, 2 Proteins product : cDNA sequence BC032203 transcript_id : XM_001001238.2

name	Tbcc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044900 GeneID:72726 MGI:1919976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin-specific chaperone c transcript_id : NM_178385.3

name	Prph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7110698 GeneID:19133 MGI:102791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peripherin 2 transcript_id : NM_008938.1

name	Ubr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58615692 GeneID:224826 MGI:1861099
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin protein ligase E3 component n-recognin 2 transcript_id : NM_146078.2

name	LOC100043385 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268726 GeneID:100043385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to high mobility group nucleosomal binding domain 2 transcript_id : XM_001480078.1

name	EG240110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268862 GeneID:240110 MGI:3647512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 4 Proteins product : predicted gene, EG240110 transcript_id : XM_140042.9

name	Trerf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369895 GeneID:224829 MGI:2442086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcriptional regulating factor 1 transcript_id : NM_172622.1

name	Mrps10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147048 GeneID:64657 MGI:1928139
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S10 transcript_id : NM_183086.1

name	Guca1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122570 GeneID:107477 MGI:1194489
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase activator 1B transcript_id : NM_146079.1

name	Guca1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254632 GeneID:14913 MGI:102770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase activator 1a (retina) transcript_id : NM_008189.2

name	EG545208 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268863 GeneID:545208 MGI:3648910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 347 ESTs, 4 Proteins product : predicted gene, EG545208 transcript_id : XM_619467.4

name	1700001C19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037410 GeneID:75462 MGI:1922712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001C19 gene transcript_id : NM_029296.1

name	AI661453 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703963 GeneID:224833 MGI:2146908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI661453 transcript_id : NM_145489.1

name	Tbn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803261 GeneID:63856 MGI:1926879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taube nuss transcript_id : NM_022015.3

name	Ccnd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012532 GeneID:12445 MGI:88315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D3 transcript_id : NM_001081636.1

name	Ccnd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012503 GeneID:12445 MGI:88315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D3 transcript_id : NM_001081635.1

name	Ccnd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012528 GeneID:12445 MGI:88315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D3 transcript_id : NM_007632.2

name	Bysl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46560590 GeneID:53414 MGI:1858419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bystin-like transcript_id : NM_016859.2

name	Trfp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802099 GeneID:56771 MGI:1929648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Trf (TATA binding protein-related factor)-proximal protein homolog (Drosophila) transcript_id : NM_020048.3

name	Usp49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38259219 GeneID:224836 MGI:2685391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 49 transcript_id : NM_198421.1

name	1110002E23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982675 GeneID:66119 MGI:1913369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110002E23 gene transcript_id : NM_025365.2

name	Frs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130081 GeneID:107971 MGI:2135965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor substrate 3 transcript_id : NM_144939.2

name	Pgc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375746 GeneID:109820 MGI:98909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progastricsin (pepsinogen C) transcript_id : NM_025973.3

name	Tcfeb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538818 GeneID:21425 MGI:103270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor EB transcript_id : NM_011549.2

name	Capn11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000644 GeneID:268958 MGI:1352490
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004198 - calpain activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : calcium-dependent thiol protease product : calpain 11 protein_id : NP_001013789.1

name	Tmem63b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718987 CCDS:CCDS28814.1 GeneID:224807 MGI:2387609
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : transmembrane protein 63b protein_id : NP_937810.1

name	Mrpl14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312028 CCDS:CCDS28815.1 GeneID:68463 MGI:1333864
definition	GO_component : GO:0005761 - mitochondrial ribosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : mitochondrial ribosomal protein L32 product : mitochondrial ribosomal protein L14 protein_id : NP_081008.1

name	Vegfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608153 CCDS:CCDS28817.1 GeneID:22339 MGI:103178
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI] [Evidence IDA] [Evidence IMP]; GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016477 - cell migration [Evidence IDA] [Evidence IGI]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; vascular permeability factor product : vascular endothelial growth factor A isoform 3 protein_id : NP_001020428.1

name	Vegfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254603 CCDS:CCDS28818.1 GeneID:22339 MGI:103178
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI] [Evidence IDA] [Evidence IMP]; GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016477 - cell migration [Evidence IDA] [Evidence IGI]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; vascular permeability factor product : vascular endothelial growth factor A isoform 2 protein_id : NP_033531.2

name	Vegfa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608149 CCDS:CCDS28816.1 GeneID:22339 MGI:103178
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI] [Evidence IDA] [Evidence IMP]; GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0001568 - blood vessel development [Evidence IMP]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016477 - cell migration [Evidence IDA] [Evidence IGI]; GO:0008283 - cell proliferation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030855 - epithelial cell differentiation [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0007498 - mesoderm development [Evidence IMP]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; vascular permeability factor product : vascular endothelial growth factor A isoform 1 protein_id : NP_001020421.1

name	Mrps18a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17505206 CCDS:CCDS28819.1 GeneID:68565 MGI:1915815
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S18A protein_id : NP_081044.1

name	1700027N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312974 CCDS:CCDS28820.1 GeneID:75564 MGI:1922814
definition	codon_start : 1 product : hypothetical protein LOC75564 protein_id : NP_083614.1

name	Mad2l1bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385110 CCDS:CCDS28821.1 GeneID:66591 MGI:1913841
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0007094 - mitotic spindle checkpoint [Evidence ISS]; GO:0007096 - regulation of exit from mitosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MAD2L1 binding protein protein_id : NP_079925.1

name	Gtpbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9624994 GeneID:56055 MGI:1860138
definition	GO_function : GO:0005525 - GTP binding [Evidence ISS] [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : GTP binding protein 2 protein_id : NP_062527.1

name	Polh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17105328 CCDS:CCDS28822.1 GeneID:80905 MGI:1891457
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016451 - nu DNA polymerase activity [Evidence IDA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006301 - postreplication repair [Evidence IDA]; GO:0006290 - pyrimidine dimer repair [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : DNA polymerase eta product : polymerase (DNA directed), eta (RAD 30 related) protein_id : NP_109640.1

name	Xpo5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24429570 GeneID:72322 MGI:1913789
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0000049 - tRNA binding [Evidence IDA] GO_process : GO:0006611 - protein export from nucleus [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : exportin 5 protein_id : NP_082474.1

name	Rpo1-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226251 GeneID:20016 MGI:103288
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : RNA polymerase 1-1 (40 kDa subunit) product : RNA polymerase 1-1 protein_id : NP_033111.2

name	Yipf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703704 CCDS:CCDS28823.1 GeneID:28064 MGI:106280
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : natural killer cell-specific antigen KLIP1 protein_id : NP_663328.1

name	Gm88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268857 GeneID:224813 MGI:2684934
definition	codon_start : 1 product : similar to OTTHUMP00000016460 protein_id : XP_001481107.1

name	Tjap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311861 CCDS:CCDS28824.1 GeneID:74094 MGI:1921344
definition	GO_component : GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : hdlg-binding protein Pilt product : tight junction protein 4 (peripheral) protein_id : NP_083027.1

name	Egfl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:102468234 GeneID:106565 MGI:2146838
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : EGF-like-domain, multiple 9 protein_id : NP_997549.2

name	Abcc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24850123 GeneID:224814 MGI:2386976
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA] codon_start : 1 note : isoform mrp7B is encoded by transcript variant mrp7B; multidrug resistance-associated protein 7 product : ATP-binding cassette, sub-family C, member 10 isoform mrp7B protein_id : NP_733780.1

name	Abcc10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553091 CCDS:CCDS28825.1 GeneID:224814 MGI:2386976
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA] codon_start : 1 note : isoform mrp7A is encoded by transcript variant mrp7A; multidrug resistance-associated protein 7 product : ATP-binding cassette, sub-family C, member 10 isoform mrp7A protein_id : NP_660122.1

name	BC040756 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268722 GeneID:414073 MGI:3041251
definition	codon_start : 1 product : similar to BC040756 protein protein_id : XP_001480104.1

name	Zfp318 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946664 CCDS:CCDS28826.1 GeneID:57908 MGI:1889348
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : zinc finger protein 318 isoform 2 protein_id : NP_067321.1

name	Zfp318 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575920 CCDS:CCDS28827.1 GeneID:57908 MGI:1889348
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : zinc finger protein 318 isoform 1 protein_id : NP_997554.1

name	Crip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982457 CCDS:CCDS28828.1 GeneID:114570 MGI:2152434
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 note : isoform TLP-A is encoded by transcript variant TLP-A; thymus LIM protein product : cysteine-rich protein 3 isoform TLP-A protein_id : NP_858050.1

name	Crip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716577 GeneID:114570 MGI:2152434
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 note : isoform TLP-B is encoded by transcript variant TLP-B; thymus LIM protein product : cysteine-rich protein 3 isoform TLP-B protein_id : NP_444480.1

name	Slc22a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450073 CCDS:CCDS28829.1 GeneID:108114 MGI:1859559
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008514 - organic anion transporter activity [Evidence TAS] [Evidence IDA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015711 - organic anion transport [Evidence TAS]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 22 member 7 protein_id : NP_659105.1

name	EG328825 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38082564 GeneID:328825 MGI:3644404
definition	codon_start : 1 product : similar to ribosomal protein L11 protein_id : XP_286185.2

name	Ttbk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268725 GeneID:106763 MGI:2147036
definition	codon_start : 1 product : tau tubulin kinase 1 protein_id : XP_001480115.1

name	BC048355 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625744 CCDS:CCDS28830.1 GeneID:381101 MGI:3039376
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : c-Myc-responsive product : putative c-Myc-responsive protein_id : NP_997044.2

name	Parc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486737 GeneID:78309 MGI:1925559
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : p53-associated parkin-like cytoplasmic protein protein_id : NP_001074804.1

name	Srf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048414 CCDS:CCDS28831.1 GeneID:20807 MGI:106658
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0001947 - heart looping [Evidence IMP]; GO:0046716 - muscle maintenance [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : serum response factor protein_id : NP_065239.1

name	Ptk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425042 GeneID:71461 MGI:1918711
definition	GO_function : GO:0005524 - ATP binding [Evidence IC]; GO:0016301 - kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IDA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0045198 - establishment of epithelial cell polarity [Evidence IMP]; GO:0001843 - neural tube closure [Evidence IGI] [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : receptor tyrosine kinase-like protein product : PTK7 protein tyrosine kinase 7 protein_id : NP_780377.1

name	Klc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386370 CCDS:CCDS28832.1 GeneID:74764 MGI:1922014
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] codon_start : 1 product : kinesin-like 8 protein_id : NP_083367.1

name	Mrpl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384660 GeneID:27398 MGI:1351622
definition	GO_component : GO:0005762 - mitochondrial large ribosomal subunit [Evidence ISS] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS] [Evidence IEA] codon_start : 1 note : ribosomal protein, mitochondrial, L14 product : mitochondrial ribosomal protein L2 protein_id : NP_079578.1

name	Cul7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57013279 CCDS:CCDS28833.1 GeneID:66515 MGI:1913765
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : cullin 7 protein_id : NP_079887.3

name	BC011248 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450075 GeneID:224823 MGI:2385053
definition	codon_start : 1 product : hypothetical protein LOC224823 protein_id : NP_659106.1

name	Klhdc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17017965 CCDS:CCDS28834.1 GeneID:71765 MGI:2651568
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0000790 - nuclear chromatin [Evidence IDA] [Evidence ISS] GO_function : GO:0003682 - chromatin binding [Evidence ISS] GO_process : GO:0007126 - meiosis [Evidence IEA]; GO:0007131 - meiotic recombination [Evidence ISS] codon_start : 1 exception : mismatches in translation note : testis intracellular mediator protein product : kelch domain containing 3 protein_id : NP_082186.1

name	Mea1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754674 CCDS:CCDS28835.1 GeneID:17256 MGI:96957
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : male-enhanced antigen-1 product : male enhanced antigen 1 protein_id : NP_034917.1

name	Ppp2r5d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942059 CCDS:CCDS28836.1 GeneID:21770 MGI:2388481
definition	GO_component : GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : testis expressed gene 271 product : delta isoform of regulatory subunit B56, protein phosphatase 2A protein_id : NP_033384.2

name	Pex6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703962 CCDS:CCDS28837.1 GeneID:224824 MGI:2385054
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : peroxisomal biogenesis factor 6 protein_id : NP_663463.1

name	Gnmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754026 CCDS:CCDS28838.1 GeneID:14711 MGI:1202304
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : glycine N methyl transferase product : glycine N-methyltransferase protein_id : NP_034451.1

name	Tnrc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312510 CCDS:CCDS28839.1 GeneID:72029 MGI:1919279
definition	codon_start : 1 product : trinucleotide repeat containing 5 protein_id : NP_082341.1

name	Ptcra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755216 CCDS:CCDS28840.1 GeneID:19208 MGI:104857
definition	codon_start : 1 product : pre T-cell antigen receptor alpha protein_id : NP_035325.1

name	2310039H08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385462 CCDS:CCDS28841.1 GeneID:67101 MGI:1914351
definition	codon_start : 1 product : hypothetical protein LOC67101 protein_id : NP_080242.1

name	Rpl7l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754134 CCDS:CCDS28842.1 GeneID:66229 MGI:1913479
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L7-like 1 protein_id : NP_079709.2

name	BC032203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268860 GeneID:210982 MGI:2673855
definition	codon_start : 1 product : similar to Uncharacterized protein KIAA0240 protein_id : XP_001001238.2

name	Tbcc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87044901 CCDS:CCDS28843.1 GeneID:72726 MGI:1919976
definition	codon_start : 1 product : tubulin-specific chaperone c protein_id : NP_848472.2

name	Prph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110699 CCDS:CCDS28844.1 GeneID:19133 MGI:102791
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : retinal degeneration slow; retinal degeneration 2 product : retinal degeneration, slow (retinitis pigmentosa 7) protein_id : NP_032964.1

name	Ubr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58615693 CCDS:CCDS28845.1 GeneID:224826 MGI:1861099
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence IGI] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IGI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IGI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007141 - male meiosis I [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006512 - ubiquitin cycle [Evidence IGI]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IDA] codon_start : 1 note : ubiquitin ligase E3 alpha-II product : ubiquitin protein ligase E3 component n-recognin 2 protein_id : NP_666190.2

name	LOC100043385 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268727 GeneID:100043385
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480128.1

name	EG240110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20900391 GeneID:240110 MGI:3647512
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_140042.1

name	Trerf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369896 GeneID:224829 MGI:2442086
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : transcriptional regulating protein 132 product : transcriptional regulating factor 1 protein_id : NP_766210.1

name	Mrps10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147049 CCDS:CCDS28846.1 GeneID:64657 MGI:1928139
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial ribosomal protein S10 protein_id : NP_898909.1

name	Guca1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122571 CCDS:CCDS28847.1 GeneID:107477 MGI:1194489
definition	GO_function : GO:0008048 - calcium sensitive guanylate cyclase activator activity [Evidence IDA]; GO:0030249 - guanylate cyclase regulator activity [Evidence IGI] GO_process : GO:0007602 - phototransduction [Evidence IMP]; GO:0031282 - regulation of guanylate cyclase activity [Evidence IGI]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : GCAP2 (retina) product : guanylate cyclase activator 1B protein_id : NP_666191.1

name	Guca1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254633 CCDS:CCDS28848.1 GeneID:14913 MGI:102770
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008048 - calcium sensitive guanylate cyclase activator activity [Evidence IDA]; GO:0030249 - guanylate cyclase regulator activity [Evidence IGI] GO_process : GO:0007602 - phototransduction [Evidence IMP]; GO:0031282 - regulation of guanylate cyclase activity [Evidence IGI]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 product : guanylate cyclase activator 1a (retina) protein_id : NP_032215.2

name	EG545208 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268864 GeneID:545208 MGI:3648910
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619467.2

name	1700001C19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037411 CCDS:CCDS28849.1 GeneID:75462 MGI:1922712
definition	codon_start : 1 product : hypothetical protein LOC75462 protein_id : NP_083572.1

name	AI661453 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703964 GeneID:224833 MGI:2146908
definition	codon_start : 1 product : hypothetical protein LOC224833 protein_id : NP_663464.1

name	Tbn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528498 GeneID:63856 MGI:1926879
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0045598 - regulation of fat cell differentiation [Evidence ISS] codon_start : 1 product : TBP-associated factor 8 protein_id : NP_071298.1

name	Ccnd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126012504 GeneID:12445 MGI:88315
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 product : cyclin D3 protein_id : NP_001075104.1

name	Ccnd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126012533 GeneID:12445 MGI:88315
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 product : cyclin D3 protein_id : NP_001075105.1

name	Ccnd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6724313 CCDS:CCDS28850.1 GeneID:12445 MGI:88315
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 product : cyclin D3 protein_id : NP_031658.1

name	Bysl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560591 GeneID:53414 MGI:1858419
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA] codon_start : 1 product : bystin-like protein_id : NP_058555.2

name	Trfp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910590 CCDS:CCDS28851.1 GeneID:56771 MGI:1929648
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA]; GO:0016592 - Srb-mediator complex [Evidence ISS] GO_function : GO:0003899 - DNA-directed RNA polymerase activity [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence ISS] [Evidence IEA] codon_start : 1 note : ubiquitin specific protease 49 product : Trf-proximal protein homolog protein_id : NP_064432.1

name	Usp49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259220 CCDS:CCDS28852.1 GeneID:224836 MGI:2685391
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin specific protease 49 product : ubiquitin specific protease 49 homolog protein_id : NP_940813.1

name	1110002E23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384732 GeneID:66119 MGI:1913369
definition	codon_start : 1 product : hypothetical protein LOC66119 protein_id : NP_079641.1

name	Frs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450353 CCDS:CCDS28854.1 GeneID:107971 MGI:2135965
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : suc1-associated neurotrophic factor target 2 (FGFR signalling adaptor) product : fibroblast growth factor receptor substrate 3 protein_id : NP_659188.1

name	Pgc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244579 CCDS:CCDS28855.1 GeneID:109820 MGI:98909
definition	EC_number : 3.4.23.3 GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0007586 - digestion [Evidence IEA] codon_start : 1 note : urinary pepsinogen 1 product : progastricsin (pepsinogen C) protein_id : NP_080249.2

name	Tcfeb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538819 CCDS:CCDS28856.1 GeneID:21425 MGI:103270
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : transcription factor EB protein_id : NP_035679.2

name	LOC100043363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043363
definition	number : 1 pseudo : _no_value

name	LOC100043405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043405
definition	number : 3 pseudo : _no_value

name	LOC100043405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043405
definition	number : 2 pseudo : _no_value

name	LOC100043405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043405
definition	number : 1 pseudo : _no_value

name	LOC677168 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268858 GeneID:677168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs product : similar to ISG15 ubiquitin-like modifier pseudo : _no_value transcript_id : XR_034969.1

name	A330017A19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268861 GeneID:442840 MGI:3045380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs product : RIKEN cDNA A330017A19 gene transcript_id : XR_035471.1

name	LOC668463 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268865 GeneID:668463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 15 Proteins product : similar to Chain C, Mouse Importin Alpha- Phosphorylated Sv40 Cn Peptide Complex pseudo : _no_value transcript_id : XR_034991.1

clone name	MSMg01-389H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472B01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-315E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354M01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-130N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-321N01.b	B6Ng01-321N01.g
ACC	GA110825	GA110826
length	818	1,114
definition	B6Ng01-321N01.b	B6Ng01-321N01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(46,942,594 - 46,943,391)	(46,789,824 - 46,790,930)
sequence	gaattctgggaaggaaaaactgacaaagttgagaggggtgtgtggatata ccaagactggctggtctacaagatccaaactggaatttcgcattcagtta aggccctggttttccccattaaacttcaaatcctgtctttctaatcttgg agaactaaattgagccaggggcttctcagtgtatttggaaaggcccttgc gctgcattagaaagcatcagtgcagcatggtccccgattgtgagcagagg actttcccctcggccgaccagggtcccgccccctgcgagctttccagttt tccctactgacaacgggctcactgtggagcccggctgacctggtgctctt gtgtaggccaggctgtccttaaaccacacagcctgtctctgcctcccaag tgctgaggtgagaggggtgagcactcagatccaaatccacccctttaaaa tattttttaaaatgttttttctgtttcatttttaaaagatatgtttatcg attggttgattgattggtgtaatatatgtgagtacactgtcactatcttc agacataccagaagaaggcatcagatctcattacagatggttgtgagtca ccatgtggttgctggaatttgaactcaggacctctggaagagcagtcagt gctcttaactgccaagctgtctctcccagccccctcctatttccctaaga tttccttttttaaattatgtgtgtatgggcaggcagcacatgtgagtgta agtgaccagaaaggtgctgggtccttcttcgggctggagttagagacagc tggaaaccctcctgaaaa	gaattcagtatggccatgggcactctgatctctgagctggtgcaggccat gcgctgggacggggcctcaagcagaccagagagttcttcctcctccacct tccagcctcggccagcacagttccgcccctacacccagcgtttcaggagg tcgaggcggtttcgcccccgtgcctcgtttgccagttttaatacctatgc cttgtatgtgcgggacacgctgcggcccgggatgcgggtacggatgctgg agaattacgaggagatcgctgctggggatgagggccagttccgacagagc aatgatggcgttcccccagcgcaggtatgggctctacagactgtgacact gaattttcattctgggtgaggcatccaatacacactgggcattctatact gcggctcagttaagttccaaaggacacggagcccttggaatatgggagca aaggtgcgtcagacccaagaagaaaccgatggattagaatttggaagatg ggctttctgaggccagatggaagtactgagccatggtatctaagacagag aggatccaggccgtggtaggatgcttgtaatcccagaggtagagagaggc agaaagatagggagttcaaggccagccatggccacatagcaatgttgagg tcagtttgggacccccgtctgaaagaaaggaaaaatgaaattagactaaa gggcataaggaagtaaagggcattgctgaggaggaaggtgaggctgtctg tatactgtatacattgtttgcatatatagtctatatagtctatagacagt ggtcaccttatgggccttagctggtcaatagcaggtcctcttccccttcc tttcctcctgcctccaaccctccaggtgttgtgggattcaacaggccata cctactggggtgcactggcacattgctggagatcttgggctttgaggaag acatcgaggatgtgattgatattgaagagtacaggagctaggggccaatg ggagcactggagcatcgttggagctctgggctgaggttggctcttgagca gaaggagattaacctaacctggggcagtccgggaactggccgttgccaca ataccatttattac
quality values	Open. Hide. 58 33 34 37 58 58 38 49 62 62 47 62 54 62 47 62 62 62 56 47 54 62 49 54 42 62 62 62 62 62 62 62 51 62 38 49 49 38 44 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 49 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 54 56 56 62 62 62 41 47 62 62 62 56 62 62 43 54 56 62 62 62 62 56 62 62 62 62 54 41 62 62 56 56 62 62 54 56 62 62 42 52 62 30 62 54 47 62 62 52 54 62 31 15 19 33 41 33 52 52 18 13 10 12 14 47 46 43 52 43 46 52 23 10 9 9 8 9 52 45 15 47 52 52 52 52 44 52 34 22 41 8 23 25 35 52 46 42 27 46 27 23 15 22 22 30 42 37 34 48 54 52 34 32 37 33 22 34 37 54 40 37 37 41 15 29 27 22 34 37 34 47 52 40 54 52 54 52 54 32 27 27 17 19 19 35 58 54 14 25 27 52 47 41 39 16 54 52 52 47 25 22 18 20 28 26 22 13 19 19 50 34 52 26 26 46 39 50 42 50 41 37 54 19 40 12 19 22 32 27 40 47 50 23 37 27 30 34 37 26 26 16 27 22 18 12 24 22 23 30 27 30 26 35 19 32 34 28 11 15 9 7 21 23 28 25 16 19 18 13 9 18 16 19 14 9 9 14 7 12 26 11 11 27 8 25 27 22 7 23 19 9 15 13 23 14 11 19 39 22 22 23 16 13 9 25 27 24	Open. Hide. 62 49 51 47 62 47 36 51 56 51 59 49 37 32 33 46 59 62 62 62 59 62 59 62 62 62 37 33 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 42 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 49 54 59 62 62 49 54 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 59 62 62 49 54 62 54 42 42 62 62 62 54 62 59 59 62 62 49 42 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 56 62 62 62 43 62 62 62 62 62 62 54 54 62 62 56 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 38 49 47 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 54 62 62 62 62 62 62 62 62 62 54 62 52 62 54 62 62 62 52 62 39 47 45 39 54 58 41 58 58 58 58 54 37 54 58 47 54 30 58 36 25 58 58 58 58 58 52 52 54 54 54 58 58 52 58 58 29 58 54 54 52 58 58 58 52 58 52 58 47 58 54 58 54 52 52 47 37 52 52 58 58 54 52 54 58 52 47 54 54 58 37 54 41 53 45 42 30 52 58 58 31 42 40 51 52 58 50 49 41 50 58 50 58 46 51 50 53 46 58 50 50 50 46 53 58 48 48 58 44 50 27 50 50 50 49 46 50 50 52 51 38 58 32 32 58 43 48 32 54 50 58 58 58 50 40 51 31 31 15 46 53 46 50 41 40 41 29 58 49 44 54 53 46 32 50 26 39 32 24 25 51 26 50 26 54 58 32 58 43 29 36 47 58 50 50 51 50 54 11 30 53 32 28 49 16 13 41 29 42 51 15 44 29 45 52 39 34 33 50 30 27 45 33 40 39 52 30 38 42 37 52 34 53 50 26 6 44 24 39 35 37 37 32 45 45 39 33 44 27 49 28 50 25 27 52 32 23 42 42 33 52 27 22 30 39 34 28 42 24 43 36 16 31 22 40 52 31 36 23 25 37 54 54 22 52 32 25 34 14 21 32 33 33 27 31 31 31 35 32 26 31 31 22 27 15 16 46 32 28 47 34 31 51 40 32 53 24 40 40 32 49 26 31 31 24 21 29 16 18 27 32 23 21 46 18 31 31 51 29 9 13 31 12 21 18 28 30 23 42 39 21 32 28 27 25 10 18 29 31 6 18 21 24 28 9 21 24 17 27 23 12 16 19 27 28 31 42 42 23 21 31 26 20 19 26 33 23 12 23 31 26 25 6 22 31 27 30 29 23 5 14 9 15 24 30 23 39 17 16 15 46 33 21 17 18 10 35 33 12 31 14 14 37 34 18 28 14 10 11 11 23 35 18 21 29 25 15 6 7 5 5 25 18 17 13 10 26 5 8 7 31 9 30 21 29 18 25 34 21 13 32 21 31 12 8 23 11 16 7 36 6 11 7 23 8 16 23 11 14 33 7 21 19 34 15 22 9 6 8 5 8 16 33 20 15 17 7 43 31 31 6 26 10 7 31 6 10 15 25 6 12 7 5 13 21 27 7 17 28 7 11 3 3 3 5 6 13 13 5 5 12 17 11 6 7 9 12 5 7 5 24 29 19 5 9 15 4 6 4 7 10 6 16 19 13 23 15 17 5 3 6 6 7 5 10 19 5 6 5 4 3 3 6 6 4 14 6 15 8 4 4 18 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_46942594_46943391
seq2: B6Ng01-321N01.b_46_850 (reverse)

seq1  TTCCAGCTGTCTCTAACTCCAGCCCG-AGAAGG-GCCAGCACCTTTCTGG  48
      |||||||||||||||||||||||||| ||||||  |||||||||||||||
seq2  TTCCAGCTGTCTCTAACTCCAGCCCGAAGAAGGACCCAGCACCTTTCTGG  50

seq1  TCACTTACACTCACATGTGCTGCCTG-CCATACACACATAATTT-AAAAA  96
      |||||||||||||||||||||||||| ||||||||||||||||| |||||
seq2  TCACTTACACTCACATGTGCTGCCTGCCCATACACACATAATTTAAAAAA  100

seq1  GGAAATCTTA-GGAAATAGGA-GGGGCT-GGAGAGACAGCTTGGCAGTTA  143
      |||||||||| |||||||||| |||||| |||||||||||||||||||||
seq2  GGAAATCTTAGGGAAATAGGAGGGGGCTGGGAGAGACAGCTTGGCAGTTA  150

seq1  AGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATTCCAGCAACCA  193
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATTCCAGCAACCA  200

seq1  CATGGTGACTCACAACCATCTGTAATGAGATCTGATGCCTTCTTCTGGTA  243
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGTGACTCACAACCATCTGTAATGAGATCTGATGCCTTCTTCTGGTA  250

seq1  TGTCTGAAGATAGTGACAGTGTACTCACATATATTACACCAATCAATCAA  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTGAAGATAGTGACAGTGTACTCACATATATTACACCAATCAATCAA  300

seq1  CCAATCGATAAACATATCTTTTAAAAATGAAACAGAAAAAACATTTTAAA  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATCGATAAACATATCTTTTAAAAATGAAACAGAAAAAACATTTTAAA  350

seq1  AAATATTTTAAAGGGGTGGATTTGGATCTGAGTGCTCACCCCTCTCACCT  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATATTTTAAAGGGGTGGATTTGGATCTGAGTGCTCACCCCTCTCACCT  400

seq1  CAGCACTTGGGAGGCAGAGACAGGCTGTGTGGTTTAAGGACAGCCTGGCC  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCACTTGGGAGGCAGAGACAGGCTGTGTGGTTTAAGGACAGCCTGGCC  450

seq1  TACACAAGAGCACCAGGTCAGCCGGGCTCCACAGTGAGCCCGTTGTCAGT  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACAAGAGCACCAGGTCAGCCGGGCTCCACAGTGAGCCCGTTGTCAGT  500

seq1  AGGGAAAACTGGAAAGCTCGCAGGGGGCGGGACCCTGGTCGGCCGAGGGG  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAAAACTGGAAAGCTCGCAGGGGGCGGGACCCTGGTCGGCCGAGGGG  550

seq1  AAAGTCCTCTGCTCACAATCGGGGACCATGCTGCACTGATGCTTTCTAAT  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTCCTCTGCTCACAATCGGGGACCATGCTGCACTGATGCTTTCTAAT  600

seq1  GCAGCGCAAGGGCCTTTCCAAATACACTGAGAAGCCCCTGGCTCAATTTA  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCGCAAGGGCCTTTCCAAATACACTGAGAAGCCCCTGGCTCAATTTA  650

seq1  GTTCTCCAAGATTAGAAAGACAGGATTTGAAGTTTAATGGGGAAAACCAG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTCCAAGATTAGAAAGACAGGATTTGAAGTTTAATGGGGAAAACCAG  700

seq1  GGCCTTAACTGAATGCGAAATTCCAGTTTGGATCTTGTAGACCAGCCAGT  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTTAACTGAATGCGAAATTCCAGTTTGGATCTTGTAGACCAGCCAGT  750

seq1  CTTGGTATATCCACACACCCCTCTCAACTTTGTCAGTTTTTCCTTCCCAG  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGTATATCCACACACCCCTCTCAACTTTGTCAGTTTTTCCTTCCCAG  800

seq1  AATTC  798
      |||||
seq2  AATTC  805

seq1: chr17_46789824_46790930
seq2: B6Ng01-321N01.g_68_1181

seq1  GAATTCAGTATGGCCATGGGCACTCTGATCTCTGAGCTGGTGCAGGCCAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTATGGCCATGGGCACTCTGATCTCTGAGCTGGTGCAGGCCAT  50

seq1  GCGCTGGGACGGGGCCTCAAGCAGACCAGAGAGTTCTTCCTCCTCCACCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGCTGGGACGGGGCCTCAAGCAGACCAGAGAGTTCTTCCTCCTCCACCT  100

seq1  TCCAGCCTCGGCCAGCACAGTTCCGCCCCTACACCCAGCGTTTCAGGAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGCCTCGGCCAGCACAGTTCCGCCCCTACACCCAGCGTTTCAGGAGG  150

seq1  TCGAGGCGGTTTCGCCCCCGTGCCTCGTTTGCCAGTTTTAATACCTATGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGAGGCGGTTTCGCCCCCGTGCCTCGTTTGCCAGTTTTAATACCTATGC  200

seq1  CTTGTATGTGCGGGACACGCTGCGGCCCGGGATGCGGGTACGGATGCTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTATGTGCGGGACACGCTGCGGCCCGGGATGCGGGTACGGATGCTGG  250

seq1  AGAATTACGAGGAGATCGCTGCTGGGGATGAGGGCCAGTTCCGACAGAGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATTACGAGGAGATCGCTGCTGGGGATGAGGGCCAGTTCCGACAGAGC  300

seq1  AATGATGGCGTTCCCCCAGCGCAGGTATGGGCTCTACAGACTGTGACACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGATGGCGTTCCCCCAGCGCAGGTATGGGCTCTACAGACTGTGACACT  350

seq1  GAATTTTCATTCTGGGTGAGGCATCCAATACACACTGGGCATTCTATACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTTTCATTCTGGGTGAGGCATCCAATACACACTGGGCATTCTATACT  400

seq1  GCGGCTCAGTTAAGTTCCAAAGGACACGGAGCCCTTGGAATATGGGAGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGCTCAGTTAAGTTCCAAAGGACACGGAGCCCTTGGAATATGGGAGCA  450

seq1  AAGGTGCGTCAGACCCAAGAAGAAACCGATGGATTAGAATTTGGAAGATG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTGCGTCAGACCCAAGAAGAAACCGATGGATTAGAATTTGGAAGATG  500

seq1  GGCTTTCTGAGGCCAGATGGAAGTACTGAGCCATGGTATCTAAGACAGAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTTCTGAGGCCAGATGGAAGTACTGAGCCATGGTATCTAAGACAGAG  550

seq1  AGGATCCAGGCCGTGGTAGGATGCTTGTAATCCCAGAGGTAGAGAGAGGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATCCAGGCCGTGGTAGGATGCTTGTAATCCCAGAGGTAGAGAGAGGC  600

seq1  AGAAAGATAGGGAGTTCAAGGCCAGCCATGGCCACATAGCAATGTTGAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAGATAGGGAGTTCAAGGCCAGCCATGGCCACATAGCAATGTTGAGG  650

seq1  TCAGTTTGGGACCCCCGTCTGAAAGAAAGGAAAAATGAAATTAGACTAAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTTTGGGACCCCCGTCTGAAAGAAAGGAAAAATGAAATTAGACTAAA  700

seq1  GGGCATAAGGAAGTAAAGGGCATTGCTGAGGAGGAAGGTGAGGCTGTCTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCATAAGGAAGTAAAGGGCATTGCTGAGGAGGAAGGTGAGGCTGTCTG  750

seq1  TATACTGTATACATTG-TTGCATATATAGTCTATATAGTCTATAGACAGT  799
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  TATACTGTATACATTGTTTGCATATATAGTCTATATAGTCTATAGACAGT  800

seq1  GGTCACCTTATGGGCCTTAGCTGGTCAATAGCAGGTCCTCTTCCCCTTCC  849
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  GGTCACCTTATGGGCCTTAGCTGGTCAATAGCAGGTCCTCTTCCCCTT-C  849

seq1  CTTTCCTCCTGCCTCCAACCCTCCAGGTGTTGTGGGATTCAACAGGCCAT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCCTCCTGCCTCCAACCCTCCAGGTGTTGTGGGATTCAACAGGCCAT  899

seq1  ACCTACT-GGGTGCACTGGCACA-TGCTGGAGATCTTGGGCTTTGAGGAA  947
      ||||||| ||||||||||||||| ||||||||||||||||||||||||||
seq2  ACCTACTGGGGTGCACTGGCACATTGCTGGAGATCTTGGGCTTTGAGGAA  949

seq1  GACATCGAGGATGTGATTGATATTGAAGAGTTACAGGAGCTAGGGGCCAA  997
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  GACATCGAGGATGTGATTGATATTGAAGAG-TACAGGAGCTAGGGGCCAA  998

seq1  T-GGAGCACT-GAGCATCGGT-GAGCTCTGGGCTGGAGGTTGGCTC-TGA  1043
      | |||||||| |||||||| | |||||||||||| ||||||||||| |||
seq2  TGGGAGCACTGGAGCATCGTTGGAGCTCTGGGCT-GAGGTTGGCTCTTGA  1047

seq1  GCAGAGAGAGATAGACCT-ACCT-GGGCAGGCCGTGACTTGGCTGTTGCC  1091
      |||||  |||||  |||| |||| |||||| ||| ||  |||| ||||||
seq2  GCAGAAGGAGATTAACCTAACCTGGGGCAGTCCGGGAACTGGCCGTTGCC  1097

seq1  AC-ATACCATTTACTAC  1107
      || |||||||||| |||
seq2  ACAATACCATTTATTAC  1114

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information