MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-335N01
Chromosome	17 (Build37)
Map Location	26,424,767 - 26,582,668
singlet/doublet	doublet
Overlap gene	EG240055, C230078M08Rik
Upstream gene	Prss34, Prss28, Prss29, LOC432543, LOC666472, Tpsab1, Mcpt6, Tpsg1, Cacna1h, Tekt4, Sstr5, LOC100042580, Sox8, Tmem112, LOC545396, Gng13, Chtf18, Rpusd1, BC052484, Msln, Narfl, Haghl, Ccdc78, BC008155, Metrn, Fbxl16, Wdr24, 2610003J06Rik, Stub1, Rhbdl1, Rhot2, Wdr90, 9530058B02Rik, 0610011F06Rik, Wfikkn1, Rab40c, LOC100043160, Pigq, F430201B04Rik, D630044L22Rik, Solh, 1700022N22Rik, Rab11fip3, Decr2, Nme4, EG666609, Tmem8, Mrpl28, Axin1, Pdia2, Arhgdig, Rgs11, Itfg3, LOC100042643, Luc7l, EG383229
Downstream gene	Dusp1, EG666668, Ergic1, Atp6v0e, A930001N09Rik, Bnip1, Nkx2-5, Kifc1, Phf1, Cuta, Syngap1, Zbtb9, Bak1, Ggnbp1, Itpr3, 2900010M23Rik, Ihpk3, Lemd2, LOC100042713, ENSMUSG00000073430, Grm4
Link	Open Mouse BAC browser

Click to get alignment info.

name	Prss34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328780 MGI:2681414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114661 MGI:2149951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114662 MGI:2149952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 ESTs, 24 Proteins pseudo : _no_value

name	LOC666472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Tpsab1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17230 MGI:96943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcpt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17229 MGI:96942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpsg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26945 MGI:1349391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna1h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58226 MGI:1928842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tekt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71840 MGI:1919090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sstr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20609 MGI:894282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Sox8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20681 MGI:98370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76483 MGI:1923733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC545396 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Gng13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64337 MGI:1925616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chtf18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214901 MGI:2384887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpusd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106707 MGI:1919186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC052484 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328783 MGI:3607710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56047 MGI:1888992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Narfl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67563 MGI:1914813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Haghl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68977 MGI:1919877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc78 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381077 MGI:2685784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	BC008155 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214917 MGI:2384888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Metrn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70083 MGI:1917333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214931 MGI:2448488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 ESTs, 4 Proteins

name	Wdr24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268933 MGI:2446285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610003J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72106 MGI:1919356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stub1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56424 MGI:1891731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhbdl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214951 MGI:2384891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhot2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214952 MGI:2384892
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr90 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106618 MGI:1921267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 136 ESTs, 5 Proteins

name	9530058B02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68241 MGI:1915491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610011F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68347 MGI:1915597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfikkn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215001 MGI:2670967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 3 Proteins

name	Rab40c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224624 MGI:2183454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043160 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 231 ESTs, 2 Proteins

name	Pigq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14755 MGI:1333114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F430201B04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621239 MGI:3687200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D630044L22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240054 MGI:3709661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Solh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50817 MGI:1355075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700022N22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69431 MGI:1916681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Rab11fip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215445 MGI:2444431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 93 ESTs, 7 Proteins

name	Decr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26378 MGI:1347059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nme4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56520 MGI:1931148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666609 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666609 MGI:3643110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Tmem8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60455 MGI:1926283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68611 MGI:1915861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Axin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12005 MGI:1096327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdia2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69191 MGI:1916441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgdig (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14570 MGI:108430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50782 MGI:1354739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itfg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106581 MGI:2146854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Luc7l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66978 MGI:1914228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG383229 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383229 MGI:3649055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	EG240055 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240055 MGI:3643092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230078M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319749 MGI:2442659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19252 MGI:105120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666668 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666668 MGI:3643826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 226 ESTs, 7 Proteins

name	Ergic1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67458 MGI:1914708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11974 MGI:1328318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930001N09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77128 MGI:1924378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bnip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224630 MGI:109328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkx2-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18091 MGI:97350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kifc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16580 MGI:109596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21652 MGI:98647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cuta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67675 MGI:1914925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Syngap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240057 MGI:3039785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins

name	Zbtb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:474156 MGI:1918022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12018 MGI:1097161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggnbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70772 MGI:3055306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itpr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16440 MGI:96624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900010M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67267 MGI:1914517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ihpk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271424 MGI:3045325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lemd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224640 MGI:2385045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042713 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	ENSMUSG00000073430 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100038429 MGI:3642687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Grm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268934 MGI:1351341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342000 GeneID:328780 MGI:2681414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 34 transcript_id : NM_178372.2

name	Prss28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299757 GeneID:114661 MGI:2149951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 28 transcript_id : NM_053259.2

name	Prss29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981507 GeneID:114662 MGI:2149952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 29 transcript_id : NM_053260.2

name	Tpsab1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981623 GeneID:17230 MGI:96943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptase alpha/beta 1 transcript_id : NM_031187.2

name	Mcpt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130496075 GeneID:17229 MGI:96942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mast cell protease 6 transcript_id : NM_010781.3

name	Tpsg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981315 GeneID:26945 MGI:1349391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptase gamma 1 transcript_id : NM_012034.2

name	Cacna1h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62739189 GeneID:58226 MGI:1928842
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, T type, alpha 1H subunit transcript_id : NM_021415.3

name	Tekt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625870 GeneID:71840 MGI:1919090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tektin 4 transcript_id : NM_027951.1

name	Sstr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803431 GeneID:20609 MGI:894282
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : somatostatin receptor 5 transcript_id : NM_011425.2

name	Sox8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364470 GeneID:20681 MGI:98370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 8 transcript_id : NM_011447.2

name	Tmem112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981341 GeneID:76483 MGI:1923733
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 112 transcript_id : NM_029624.2

name	Gng13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801840 GeneID:64337 MGI:1925616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein 13, gamma transcript_id : NM_022422.4

name	Chtf18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703815 GeneID:214901 MGI:2384887
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) transcript_id : NM_145409.1

name	Rpusd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803202 GeneID:106707 MGI:1919186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA pseudouridylate synthase domain containing 1 transcript_id : NM_028009.2

name	BC052484 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891839 GeneID:328783 MGI:3607710
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC052484 transcript_id : NM_177822.3

name	Msln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9256567 GeneID:56047 MGI:1888992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mesothelin transcript_id : NM_018857.1

name	Narfl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802092 GeneID:67563 MGI:1914813
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear prelamin A recognition factor-like transcript_id : NM_026238.3

name	Haghl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377149 GeneID:68977 MGI:1919877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxyacylglutathione hydrolase-like transcript_id : NM_026897.2

name	Ccdc78 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401811 GeneID:381077 MGI:2685784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : coiled-coil domain containing 78 transcript_id : XM_354998.4

name	BC008155 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348873 GeneID:214917 MGI:2384888
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC008155 transcript_id : NM_145410.3

name	Metrn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56550040 GeneID:70083 MGI:1917333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : meteorin, glial cell differentiation regulator transcript_id : NM_133719.2

name	Fbxl16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268683 GeneID:214931 MGI:2448488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 4 Proteins product : F-box and leucine-rich repeat protein 16, transcript variant 2 transcript_id : XM_001479825.1

name	Fbxl16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268681 GeneID:214931 MGI:2448488
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 28 ESTs, 4 Proteins product : F-box and leucine-rich repeat protein 16, transcript variant 1 transcript_id : XM_001479823.1

name	Wdr24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343449 GeneID:268933 MGI:2446285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 24 transcript_id : NM_173741.2

name	2610003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802052 GeneID:72106 MGI:1919356
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610003J06 gene transcript_id : NM_028101.2

name	Stub1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130581 GeneID:56424 MGI:1891731
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : STIP1 homology and U-Box containing protein 1 transcript_id : NM_019719.3

name	Rhbdl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450188 GeneID:214951 MGI:2384891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhomboid, veinlet-like 1 (Drosophila) transcript_id : NM_144816.1

name	Rhot2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328359 GeneID:214952 MGI:2384892
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member T2 transcript_id : NM_145999.2

name	Wdr90 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268687 GeneID:106618 MGI:1921267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 129 ESTs, 3 Proteins product : WD repeat domain 90, transcript variant 2 transcript_id : XM_001479848.1

name	Wdr90 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268685 GeneID:106618 MGI:1921267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 135 ESTs, 4 Proteins product : WD repeat domain 90, transcript variant 1 transcript_id : XM_001479840.1

name	9530058B02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388442 GeneID:68241 MGI:1915491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530058B02 gene transcript_id : NM_026633.2

name	0610011F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037114 GeneID:68347 MGI:1915597
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610011F06 gene transcript_id : NM_026686.1

name	Wfikkn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401812 GeneID:215001 MGI:2670967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 3 Proteins product : WAP, FS, Ig, KU, and NTR-containing protein 1 transcript_id : XM_128578.5

name	Rab40c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21040230 GeneID:224624 MGI:2183454
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rab40c, member RAS oncogene family transcript_id : NM_139154.1

name	LOC100043160 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268689 GeneID:100043160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 231 ESTs, 2 Proteins product : similar to cytochrome c oxidase, subunit VIIc transcript_id : XM_001479891.1

name	Pigq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130030 GeneID:14755 MGI:1333114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class Q transcript_id : NM_011822.3

name	F430201B04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802990 GeneID:621239 MGI:3687200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F430201B04 gene transcript_id : NM_001039038.2

name	D630044L22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386153 GeneID:240054 MGI:3709661
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA gene D630044L22 gene transcript_id : NM_175505.3

name	Solh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657600 GeneID:50817 MGI:1355075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small optic lobes homolog (Drosophila) transcript_id : NM_015830.1

name	1700022N22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268692 GeneID:69431 MGI:1916681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 1700022N22 gene transcript_id : XM_001479914.1

name	Rab11fip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268695 GeneID:215445 MGI:2444431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 87 ESTs, 7 Proteins product : RAB11 family interacting protein 3 (class II) transcript_id : XM_001479926.1

name	Rab11fip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268694 GeneID:215445 MGI:2444431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 88 ESTs, 4 Proteins product : RAB11 family interacting protein 3 (class II), transcript variant 1 transcript_id : XM_484616.4

name	Rab11fip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401792 GeneID:215445 MGI:2444431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 72 ESTs, 5 Proteins product : RAB11 family interacting protein 3 (class II), transcript variant 9 transcript_id : XM_989054.1

name	Decr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129992 GeneID:26378 MGI:1347059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal transcript_id : NM_011933.2

name	Nme4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790122 GeneID:56520 MGI:1931148
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 4, protein transcript_id : NM_019731.1

name	EG666609 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268621 GeneID:666609 MGI:3643110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG666609 transcript_id : XM_984926.2

name	Tmem8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11140832 GeneID:60455 MGI:1926283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 8 (five membrane-spanning domains) transcript_id : NM_021793.1

name	Mrpl28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26787988 GeneID:68611 MGI:1915861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L28 transcript_id : NM_024227.2

name	Axin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50979283 GeneID:12005 MGI:1096327
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : axin 1 transcript_id : NM_009733.1

name	Pdia2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486723 GeneID:69191 MGI:1916441
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein disulfide isomerase associated 2 transcript_id : NM_001081070.1

name	Arhgdig (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130965 GeneID:14570 MGI:108430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GDP dissociation inhibitor (GDI) gamma transcript_id : NM_008113.3

name	Rgs11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486717 GeneID:50782 MGI:1354739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 11 transcript_id : NM_001081069.1

name	Itfg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386504 GeneID:106581 MGI:2146854
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha FG-GAP repeat containing 3 transcript_id : NM_207217.2

name	Luc7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158676 GeneID:66978 MGI:1914228
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Luc7 homolog (S. cerevisiae)-like transcript_id : NM_028190.2

name	Luc7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158673 GeneID:66978 MGI:1914228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Luc7 homolog (S. cerevisiae)-like transcript_id : NM_025881.2

name	EG383229 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401820 GeneID:383229 MGI:3649055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG383229 transcript_id : XM_356935.3

name	EG240055 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116566 GeneID:240055 MGI:3643092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG240055 transcript_id : NM_001081656.1

name	C230078M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342547 GeneID:319749 MGI:2442659
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230078M08 gene transcript_id : NM_176995.2

name	Dusp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305422 GeneID:19252 MGI:105120
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 1 transcript_id : NM_013642.1

name	EG666668 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401826 GeneID:666668 MGI:3643826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 226 ESTs, 7 Proteins product : predicted gene, EG666668 transcript_id : XM_985281.1

name	Ergic1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129827 GeneID:67458 MGI:1914708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 transcript_id : NM_026170.3

name	Atp6v0e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50659078 GeneID:11974 MGI:1328318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit E transcript_id : NM_025272.2

name	A930001N09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794195 GeneID:77128 MGI:1924378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930001N09 gene transcript_id : NM_029870.1

name	Bnip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382697 GeneID:224630 MGI:109328
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2/adenovirus E1B interacting protein 1, NIP1 transcript_id : NM_172149.4

name	Nkx2-5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677926 GeneID:18091 MGI:97350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NK2 transcription factor related, locus 5 (Drosophila) transcript_id : NM_008700.2

name	Kifc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116642892 GeneID:16580 MGI:109596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member C1 transcript_id : NM_053173.2

name	Phf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185927 GeneID:21652 MGI:98647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 1 transcript_id : NM_009343.2

name	Cuta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21702736 GeneID:67675 MGI:1914925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cutA divalent cation tolerance homolog (E. coli) transcript_id : NM_026307.2

name	Cuta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130306 GeneID:67675 MGI:1914925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cutA divalent cation tolerance homolog (E. coli) transcript_id : NM_026948.2

name	Syngap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268701 GeneID:240057 MGI:3039785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : synaptic Ras GTPase activating protein 1 homolog (rat) transcript_id : XM_985548.2

name	Zbtb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607173 GeneID:474156 MGI:1918022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 9 transcript_id : NM_001005916.2

name	Bak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955301 GeneID:12018 MGI:1097161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-antagonist/killer 1 transcript_id : NM_007523.2

name	Ggnbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54400750 GeneID:70772 MGI:3055306
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gametogenetin binding protein 1 transcript_id : NM_027544.1

name	Itpr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61102727 GeneID:16440 MGI:96624
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-triphosphate receptor 3 transcript_id : NM_080553.2

name	2900010M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802405 GeneID:67267 MGI:1914517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900010M23 gene transcript_id : NM_026063.2

name	Ihpk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376092 GeneID:271424 MGI:3045325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol hexaphosphate kinase 3 transcript_id : NM_173027.2

name	Lemd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122562 GeneID:224640 MGI:2385045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LEM domain containing 2 transcript_id : NM_146075.1

name	LOC100042713 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268632 GeneID:100042713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042713 transcript_id : XM_001478663.1

name	ENSMUSG00000073430 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268634 GeneID:100038429 MGI:3642687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, ENSMUSG00000073430 transcript_id : XM_001478670.1

name	Grm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62945391 GeneID:268934 MGI:1351341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, metabotropic 4 transcript_id : NM_001013385.1

name	Prss34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410030 CCDS:CCDS28514.1 GeneID:328780 MGI:2681414
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IC] codon_start : 1 note : mast cell protease-11; mast cell protease 11 product : protease, serine, 34 protein_id : NP_848459.1

name	Prss28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299758 CCDS:CCDS28515.1 GeneID:114661 MGI:2149951
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IMP] GO_process : GO:0007566 - embryo implantation [Evidence IMP] codon_start : 1 note : implantation serine protease 1 product : protease, serine, 28 protein_id : NP_444489.2

name	Prss29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716593 CCDS:CCDS28516.1 GeneID:114662 MGI:2149952
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : implantation serine protease 2 protein_id : NP_444490.1

name	Tpsab1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981624 GeneID:17230 MGI:96943
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0030019 - tryptase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mast cell protease 7 protein_id : NP_112464.2

name	Mcpt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130496076 CCDS:CCDS28517.1 GeneID:17229 MGI:96942
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0008201 - heparin binding [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0030019 - tryptase activity [Evidence IDA] GO_process : GO:0006954 - inflammatory response [Evidence TAS]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : mast cell protease 6 protein_id : NP_034911.3

name	Tpsg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755819 CCDS:CCDS28518.1 GeneID:26945 MGI:1349391
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence ISS] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transmembrane tryptase product : tryptase gamma 1 protein_id : NP_036164.1

name	Cacna1h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62739190 GeneID:58226 MGI:1928842
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence ISS] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0008332 - low voltage-gated calcium channel activity [Evidence ISS]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : T-type Cav3.2; low-voltage-activated calcium channel alpha13.2 subunit product : calcium channel alpha13.2 subunit protein_id : NP_067390.3

name	Tekt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625871 CCDS:CCDS28519.1 GeneID:71840 MGI:1919090
definition	GO_component : GO:0005874 - microtubule [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : testicular microtubules-related protein 4 product : tektin 4 protein_id : NP_082227.1

name	Sstr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315983 CCDS:CCDS28520.1 GeneID:20609 MGI:894282
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004994 - somatostatin receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0050796 - regulation of insulin secretion [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : somatostatin receptor 5 protein_id : NP_035555.1

name	Sox8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563276 CCDS:CCDS28521.1 GeneID:20681 MGI:98370
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence IEA] GO_process : GO:0045165 - cell fate commitment [Evidence IGI]; GO:0048469 - cell maturation [Evidence IGI] [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SRY-box containing gene 8 protein_id : NP_035577.1

name	Tmem112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981342 GeneID:76483 MGI:1923733
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76483 protein_id : NP_083900.2

name	Gng13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967949 GeneID:64337 MGI:1925616
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IPI]; GO:0016020 - membrane [Evidence TAS] GO_function : GO:0003924 - GTPase activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IDA]; GO:0050909 - sensory perception of taste [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G gamma subunit, clone 2-35 product : guanine nucleotide binding protein 13, gamma protein_id : NP_071867.1

name	Chtf18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703816 CCDS:CCDS28523.1 GeneID:214901 MGI:2384887
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Chl12 homolog product : CTF18, chromosome transmission fidelity factor 18 homolog protein_id : NP_663384.1

name	Rpusd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076995 CCDS:CCDS28524.1 GeneID:106707 MGI:1919186
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0009982 - pseudouridine synthase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 note : ribosomal large subunit pseudouridine synthase C like product : RNA pseudouridylate synthase domain containing 1 protein_id : NP_082285.1

name	BC052484 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244378 CCDS:CCDS28525.1 GeneID:328783 MGI:3607710
definition	codon_start : 1 product : hypothetical protein LOC328783 protein_id : NP_808490.1

name	Msln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256568 CCDS:CCDS28526.1 GeneID:56047 MGI:1888992
definition	codon_start : 1 function : stimulates the megakasryocyte colony forming activity of murine interleukin-3 in mouse bone marrow cell culture note : megakaryocyte potentiating factor product : mesothelin protein_id : NP_061345.1

name	Narfl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981017 GeneID:67563 MGI:1914813
definition	codon_start : 1 exception : mismatches in translation product : nuclear prelamin A recognition factor-like protein_id : NP_080514.2

name	Haghl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312167 CCDS:CCDS28527.1 GeneID:68977 MGI:1919877
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : hydroxyacylglutathione hydrolase-like protein_id : NP_081173.1

name	Ccdc78 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992525 GeneID:381077 MGI:2685784
definition	codon_start : 1 product : coiled-coil domain containing 78 protein_id : XP_354998.3

name	BC008155 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66955879 CCDS:CCDS28528.1 GeneID:214917 MGI:2384888
definition	codon_start : 1 product : hypothetical protein LOC214917 protein_id : NP_663385.2

name	Metrn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317368 CCDS:CCDS28529.1 GeneID:70083 MGI:1917333
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0010001 - glial cell differentiation [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0050772 - positive regulation of axonogenesis [Evidence IDA] codon_start : 1 note : hypoxia/reoxygenation regulatory factor in astrocytes product : meteorin protein_id : NP_598480.1

name	Fbxl16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268682 GeneID:214931 MGI:2448488
definition	codon_start : 1 product : similar to Fbxl16 protein isoform 1 protein_id : XP_001479873.1

name	Fbxl16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268684 GeneID:214931 MGI:2448488
definition	codon_start : 1 product : similar to Fbxl16 protein isoform 2 protein_id : XP_001479875.1

name	Wdr24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424575 CCDS:CCDS28531.1 GeneID:268933 MGI:2446285
definition	codon_start : 1 product : WD repeat domain 24 protein_id : NP_776102.1

name	2610003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312440 CCDS:CCDS28532.1 GeneID:72106 MGI:1919356
definition	codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2610003J06 protein_id : NP_082377.1

name	Stub1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789907 CCDS:CCDS28533.1 GeneID:56424 MGI:1891731
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0031371 - ubiquitin conjugating enzyme complex [Evidence TAS]; GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0030544 - Hsp70 protein binding [Evidence TAS]; GO:0051879 - Hsp90 protein binding [Evidence ISS]; GO:0016874 - ligase activity [Evidence IEA]; GO:0030674 - protein binding, bridging [Evidence TAS]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0046332 - SMAD binding [Evidence ISS]; GO:0004842 - ubiquitin-protein ligase activity [Evidence TAS] [Evidence IEA] GO_process : GO:0043161 - proteasomal ubiquitin-dependent protein catabolism [Evidence ISS]; GO:0006457 - protein folding [Evidence TAS]; GO:0051604 - protein maturation [Evidence TAS]; GO:0000209 - protein polyubiquitination [Evidence ISS]; GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0030579 - ubiquitin-dependent SMAD protein catabolism [Evidence ISS] codon_start : 1 note : carboxy terminus of Hsp70-interacting protein product : STIP1 homology and U-box containing protein 1 protein_id : NP_062693.1

name	Rhbdl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450189 CCDS:CCDS28534.1 GeneID:214951 MGI:2384891
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : rhomboid, veinlet-like 1 protein_id : NP_659065.1

name	Rhot2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122457 GeneID:214952 MGI:2384892
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0031307 - integral to mitochondrial outer membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0019725 - cell homeostasis [Evidence ISS]; GO:0047497 - mitochondrion transport along microtubule [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : mitochondrial Rho 2 product : ras homolog gene family, member T2 protein_id : NP_666111.1

name	Wdr90 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268688 GeneID:106618 MGI:1921267
definition	codon_start : 1 product : hypothetical protein LOC106618 isoform 2 protein_id : XP_001479898.1

name	Wdr90 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268686 GeneID:106618 MGI:1921267
definition	codon_start : 1 product : hypothetical protein LOC106618 isoform 1 protein_id : XP_001479890.1

name	9530058B02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386124 CCDS:CCDS28535.1 GeneID:68241 MGI:1915491
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC68241 protein_id : NP_080909.1

name	0610011F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037115 CCDS:CCDS28536.1 GeneID:68347 MGI:1915597
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68347 protein_id : NP_080962.1

name	Wfikkn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992527 GeneID:215001 MGI:2670967
definition	codon_start : 1 product : similar to putative multivalent protease inhibitor WFIKKN protein_id : XP_128578.4

name	Rab40c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21040231 CCDS:CCDS28537.1 GeneID:224624 MGI:2183454
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : RAR (RAS like GTPASE) like; SOCS box containing protein RAR3 product : Rab40c, member RAS oncogene family protein_id : NP_631893.1

name	LOC100043160 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268690 GeneID:100043160
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479941.1

name	Pigq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981380 CCDS:CCDS28538.1 GeneID:14755 MGI:1333114
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017176 - phosphatidylinositol N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence IEA] codon_start : 1 note : phosphatidylinositol glycan, class Q; glycosylphosphatidylinositol homolog product : glycosylphosphatidylinositol 1 homolog protein_id : NP_035952.2

name	F430201B04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702336 CCDS:CCDS28539.1 GeneID:621239 MGI:3687200
definition	codon_start : 1 product : hypothetical protein LOC621239 protein_id : NP_001034127.1

name	Solh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657601 CCDS:CCDS28540.1 GeneID:50817 MGI:1355075
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004198 - calpain activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : small optic lobes protein_id : NP_056645.1

name	D630044L22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425260 GeneID:240054 MGI:3709661
definition	codon_start : 1 product : hypothetical protein LOC240054 protein_id : NP_780714.1

name	1700022N22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268693 GeneID:69431 MGI:1916681
definition	codon_start : 1 product : hypothetical protein LOC69431 protein_id : XP_001479964.1

name	Rab11fip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268696 GeneID:215445 MGI:2444431
definition	codon_start : 1 product : RAB11 family interacting protein 3 (class II) protein_id : XP_001479976.1

name	Rab11fip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770135 GeneID:215445 MGI:2444431
definition	codon_start : 1 product : RAB11 family interacting protein 3 (class II) isoform 1 protein_id : XP_484616.1

name	Rab11fip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401793 GeneID:215445 MGI:2444431
definition	codon_start : 1 product : RAB11 family interacting protein 3 (class II) isoform 9 protein_id : XP_994148.1

name	Decr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753622 CCDS:CCDS28543.1 GeneID:26378 MGI:1347059
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0008670 - 2,4-dienoyl-CoA reductase (NADPH) activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0007031 - peroxisome organization and biogenesis [Evidence IEA] codon_start : 1 product : 2-4-dienoyl-Coenzyme A reductase 2, peroxisomal protein_id : NP_036063.1

name	Nme4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790123 CCDS:CCDS28544.1 GeneID:56520 MGI:1931148
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 note : nucleoside diphosphate kinase product : nucleoside diphosphate kinase 4 protein_id : NP_062705.1

name	EG666609 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401818 GeneID:666609 MGI:3643110
definition	codon_start : 1 product : similar to Sm protein G protein_id : XP_990020.1

name	Tmem8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11140833 CCDS:CCDS28546.1 GeneID:60455 MGI:1926283
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : transmembrane protein 6; type I transmembrane protein product : transmembrane protein 8 (five membrane-spanning domains) protein_id : NP_068565.1

name	Mrpl28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26787989 GeneID:68611 MGI:1915861
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein L28 protein_id : NP_077189.2

name	Axin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50979284 CCDS:CCDS28547.1 GeneID:12005 MGI:1096327
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016328 - lateral plasma membrane [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA]; GO:0030163 - protein catabolism [Evidence IDA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0016055 - Wnt receptor signaling pathway [Evidence IPI] [Evidence IDA] codon_start : 1 exception : mismatches in translation note : axis inhibition product : axin 1 protein_id : NP_033863.1

name	Pdia2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486724 GeneID:69191 MGI:1916441
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0003756 - protein disulfide isomerase activity [Evidence TAS]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : protein disulfide isomerase (pancreas) like; protein disulfide isomerase, pancreatic product : protein disulfide isomerase associated 2 protein_id : NP_001074539.1

name	Arhgdig (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679989 CCDS:CCDS28548.1 GeneID:14570 MGI:108430
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005094 - Rho GDP-dissociation inhibitor activity [Evidence IEA] codon_start : 1 note : guanosine diphosphate (GDP) dissociation inhibitor 5, Rho associated product : Rho GDP dissociation inhibitor (GDI) gamma protein_id : NP_032139.1

name	Rgs11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486718 GeneID:50782 MGI:1354739
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS] [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 product : regulator of G-protein signaling 11 protein_id : NP_001074538.1

name	Itfg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402185 GeneID:106581 MGI:2146854
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : integrin alpha FG-GAP repeat containing 3 protein_id : NP_997100.1

name	Luc7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158677 CCDS:CCDS28549.1 GeneID:66978 MGI:1914228
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045843 - negative regulation of striated muscle development [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Luc7 homolog (S. cerevisiae)-like isoform 2 protein_id : NP_082466.2

name	Luc7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536228 CCDS:CCDS28550.1 GeneID:66978 MGI:1914228
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045843 - negative regulation of striated muscle development [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Luc7 homolog (S. cerevisiae)-like isoform 1 protein_id : NP_080157.1

name	EG383229 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401821 GeneID:383229 MGI:3649055
definition	codon_start : 1 product : similar to Hemoglobin subunit alpha (Hemoglobin alpha chain) (Alpha-globin) protein_id : XP_356935.3

name	EG240055 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116567 GeneID:240055 MGI:3643092
definition	codon_start : 1 note : neuralized-2 product : neuralized 2 protein_id : NP_001075125.1

name	C230078M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892843 GeneID:319749 MGI:2442659
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319749 protein_id : NP_795969.1

name	Dusp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305423 CCDS:CCDS28552.1 GeneID:19252 MGI:105120
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : protein tyrosine phosphatase, non-receptor type 16 product : dual specificity phosphatase 1 protein_id : NP_038670.1

name	EG666668 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401827 GeneID:666668 MGI:3643826
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990375.1

name	Ergic1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385678 CCDS:CCDS28553.1 GeneID:67458 MGI:1914708
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 protein_id : NP_080446.1

name	Atp6v0e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384606 CCDS:CCDS28554.1 GeneID:11974 MGI:1328318
definition	GO_component : GO:0016020 - membrane [Evidence ISS]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA] GO_process : GO:0015991 - ATP hydrolysis coupled proton transport [Evidence ISS]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting lysosomal (vacuolar proton pump), 9.2 kDa; lysosomal 9kDa; ATPase, H+ transporting, lysosomal 9kD V0 subunit E; ATPase, H+ transporting, V0 subunit product : ATPase, H+ transporting, V0 subunit e protein_id : NP_079548.1

name	A930001N09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794196 GeneID:77128 MGI:1924378
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77128 protein_id : NP_084146.1

name	Bnip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098151 CCDS:CCDS28555.1 GeneID:224630 MGI:109328
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA] [Evidence ISS]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0031201 - SNARE complex [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS] [Evidence IEA]; GO:0016320 - endoplasmic reticulum membrane fusion [Evidence ISS]; GO:0007029 - endoplasmic reticulum organization and biogenesis [Evidence ISS]; GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : SNARE protein SEC20 product : BCL2/adenovirus E1B 19kDa-interacting protein 1, NIP1 protein_id : NP_742161.3

name	Nkx2-5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679068 CCDS:CCDS28556.1 GeneID:18091 MGI:97350
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0007512 - adult heart development [Evidence IMP]; GO:0048738 - cardiac muscle development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0035050 - embryonic heart tube development [Evidence IGI]; GO:0007507 - heart development [Evidence IMP]; GO:0001947 - heart looping [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI] [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Drosophila NK2 transcription factor related, locus 5 product : NK2 transcription factor related, locus 5 protein_id : NP_032726.1

name	Kifc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116642893 GeneID:16580 MGI:109596
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA] [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence ISS] [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : kinesin family member C5A; kinesin-related protein KIFC5A; kinesin family c-terminal 5A; kinesin motor protein KIFC4 product : kinesin family member C1 protein_id : NP_444403.2

name	Phf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185928 GeneID:21652 MGI:98647
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : t-complex testis-expressed 3 product : PHD finger protein 1 protein_id : NP_033369.2

name	Cuta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62198210 CCDS:CCDS28557.1 GeneID:67675 MGI:1914925
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; divalent cation tolerant protein CUTA product : divalent cation tolerant protein CUTA isoform 1 protein_id : NP_080583.3

name	Cuta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62198239 GeneID:67675 MGI:1914925
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; divalent cation tolerant protein CUTA product : divalent cation tolerant protein CUTA isoform 2 protein_id : NP_081224.1

name	Syngap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268702 GeneID:240057 MGI:3039785
definition	codon_start : 1 product : similar to SynGAP-a protein_id : XP_990642.2

name	Zbtb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54400753 GeneID:474156 MGI:1918022
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger and BTB domain containing 9 protein_id : NP_001005916.1

name	Bak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955302 CCDS:CCDS28558.1 GeneID:12018 MGI:1097161
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0008635 - caspase activation via cytochrome c [Evidence IMP] codon_start : 1 note : Bcl2 homologous antagonist/killer product : BCL2-antagonist/killer 1 protein_id : NP_031549.2

name	Ggnbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54400751 CCDS:CCDS28559.1 GeneID:70772 MGI:3055306
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : gametogenin binding protein 1 product : gametogenetin binding protein 1 protein_id : NP_081820.1

name	Itpr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61102728 CCDS:CCDS28560.1 GeneID:16440 MGI:96624
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005220 - inositol 1,4,5-triphosphate-sensitive calcium-release channel activity [Evidence IDA]; GO:0008095 - inositol-1,4,5-triphosphate receptor activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : inositol 1,4,5-triphosphate receptor 3 protein_id : NP_542120.2

name	2900010M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385560 CCDS:CCDS28561.1 GeneID:67267 MGI:1914517
definition	codon_start : 1 product : hypothetical protein LOC67267 protein_id : NP_080339.1

name	Ihpk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370542 CCDS:CCDS28562.1 GeneID:271424 MGI:3045325
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0050517 - inositol hexakisphosphate kinase activity [Evidence IEA]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : inositol hexaphosphate kinase 3 protein_id : NP_766615.1

name	Lemd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122563 GeneID:224640 MGI:2385045
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005635 - nuclear envelope [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : nuclear envelope constituent product : LEM domain containing 2 protein_id : NP_666187.1

name	LOC100042713 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268633 GeneID:100042713
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478713.1

name	ENSMUSG00000073430 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268635 GeneID:100038429 MGI:3642687
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478720.1

name	Grm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945392 CCDS:CCDS28563.1 GeneID:268934 MGI:1351341
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001642 - group III metabotropic glutamate receptor activity [Evidence TAS]; GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007612 - learning [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IMP] codon_start : 1 note : G protein-coupled receptor GRM4; G protein-coupled receptor, family C, group 1, member D product : glutamate receptor, metabotropic 4 protein_id : NP_001013403.1

name	LOC432543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:432543
definition	number : 2 pseudo : _no_value

name	LOC432543 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:432543
definition	number : 1 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 1 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 2 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 3 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 4 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 5 pseudo : _no_value

name	LOC666472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666472
definition	number : 6 pseudo : _no_value

name	LOC100042580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042580
definition	number : 2 pseudo : _no_value

name	LOC100042580 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042580
definition	number : 1 pseudo : _no_value

name	LOC545396 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:545396
definition	number : 1 pseudo : _no_value

name	LOC100042643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042643
definition	number : 1 pseudo : _no_value

name	LOC100042643 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042643
definition	number : 2 pseudo : _no_value

clone name	MSMg01-299P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-399H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141H23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-088C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146M19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-269D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445D14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-051A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-335N01.b	B6Ng01-335N01.g
ACC	GA120923	GA120924
length	1,078	727
definition	B6Ng01-335N01.b	B6Ng01-335N01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(26,424,767 - 26,425,846)	(26,581,942 - 26,582,668)
sequence	gaattccacagaagctgggatgtaagtgaatagcggaatgtttactttgc atgaggaaggttcttgcttcagtccccagcactgcaaaaatgaatagaca gtaagagaaagagataacataaagaactgagattaaaaaaaaaaatgtgt ctggggaataaaaaaggctatcctttcattctctctatttttttttctct ttcactccccctccactcatatcttttcttcctcttatgtgtggacagtt gtcctgctgggatctatgttgtatgctcttctccccgaactgcagcttca gaaaggtccctgggacaagatactttgactagactctgttggcatgtcaa ggacacagacaaatcaggtatacgtacacgttactcatactaagaggtgc aggtgtctaaccagacatagggcatggccatgagccaagagaatgagggc tgtattacaagtctgaggtttatggtacctggagggttagcattgtcttc acagcagcaaaaagcttgtctgtggaggtgtgaacctcaggggtggataa atctggttgtaacttggtcatgcttactggcatgcttggctcaggaacta tggggaaaggaaccaaaggtcagtggctgtacacaccacaggaggttctc tcatattaggtgaaggaccaacaatacctcagatcccaggtcacacccct gcacagccagcagtcacctcagggttgatggagtcctcatgcagagcctc gacaggaggaaactctgggctgacatgacagtccaaatgttatctaggtg gcctgccgagttgttgaatgtatatggcacctcttgccttgggctgctcc ctggccggagagggagtcatgccttagtaagggagtcggtcttgtaggag gctaaactgtggagtgtcttcaggaagatagagttcagaggcagaggctg catgagggaaggcagcttgccctcctgcagactggcaggtcagaaaggtc ccttgcctctcccagggccttctgtgctaacatggccactgtccgtcctg atcaggaccttacctccattagtaagag	gaattcagggctcttgtgcatccccgttccagtgcctggaagtggcaggg agttttctgcccagagactccctgtgggtggtcattaactggtgggatct tggctgtttggcaagggctcactcaccataaagaacacccctaaggtagg tgcagaaagtattgtgggcatctatttagatggatccaaggcaatagaat ggtcaagaaagcccacatgctccaccctgtcttgccctgctgaaggtacc actcaggcatcagggctgggtgcttgctctctgttgccccttatagcagc tggcatcctgagggcactcagcaaatgtttgttgagtgactttgtgtcca tatatatataatggatgctatttcaccaaccccctgaccactcctaacct ggctcctgatctgatctgcagtcttttactgagcacctactatgtgctag cacaagccccaactccagagtgatcaaatcagtttatgatctcttgcctg agagctgcccacaggccttgccttttgtcccagtcttcaacctcatgttc tgaccatgagccatgctggtaagtggatgctgaacaagtgaaaatgtgtg tcgcagcctgcacaggacagctgcccaagagggccaaccagtaagaggag gagcctgcttagcctgggaaacaactattttccagaaattcccagggggc agggatatggctgctatgtataggggg
quality values	Open. Hide. 58 33 27 22 58 58 41 16 53 41 54 49 62 48 62 62 62 62 62 24 30 62 62 62 62 62 62 62 49 62 54 62 56 62 56 56 44 56 47 62 62 62 59 62 59 62 49 62 62 59 62 62 62 59 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 59 62 59 59 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 54 62 62 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 59 59 62 62 62 49 62 62 62 59 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 51 62 62 54 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 62 62 62 62 62 62 62 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 52 43 62 62 62 62 54 58 58 54 58 58 54 39 58 52 58 49 58 58 54 45 58 58 58 54 41 58 58 58 54 58 58 58 50 58 58 54 54 54 58 58 58 54 58 58 54 58 58 54 58 58 58 58 58 54 58 54 58 54 58 58 52 58 54 58 58 54 54 58 58 54 58 58 58 58 54 58 49 52 25 58 58 49 46 51 53 58 51 58 58 58 58 58 50 46 58 58 37 37 48 52 54 45 42 58 53 53 46 49 50 58 49 50 58 54 50 46 51 54 52 58 58 58 51 48 49 29 58 29 20 49 46 58 50 58 54 58 53 53 53 50 51 50 52 51 49 50 44 58 51 21 54 41 29 50 41 39 53 41 43 51 42 50 58 51 53 42 37 39 32 37 58 50 42 53 50 52 39 39 41 50 37 51 54 54 50 50 50 31 52 42 50 44 38 23 52 39 45 29 50 45 39 45 49 53 35 40 23 51 53 42 53 41 34 22 54 24 35 26 32 45 45 42 34 30 35 40 35 32 29 53 31 44 42 42 53 21 31 40 32 47 53 45 27 40 53 54 28 22 45 40 42 45 54 39 37 52 40 30 20 26 34 37 34 33 40 34 35 32 32 30 51 32 31 40 34 53 36 43 53 43 35 28 14 31 43 45 31 29 31 34 31 46 24 35 22 32 33 31 14 53 31 33 33 31 42 31 28 39 33 36 30 40 22 31 33 31 36 39 31 30 30 30 31 27 22 37 40 38 30 31 35 32 43 32 48 31 36 36 31 7 46 31 35 30 7 34 23 41 32 32 15 33 33 33 31 31 29 42 38 24 6 6 11 38 25 23 46 11 29 9 32 29 10 20 22 37 31 22 39 21 25 32 30 33 21 16 11 31 19 31 31 34 31 43 35 25 22 33 14 24 33 31 26 44 13 23 24 16 21 15 21 7 31 20 21 11 26 18 32 25 32 19 11 26 7 19 29 19 9 24 11 18 20 31 31 33 22 28 20 23 6 31 25 13 9 4 4 4 19 21 21 34 43 11 19 39 15 8 5 21 27 27 32 32 14 34 22 21 28 16 13 18 24 25 5 8 33 15 33 39 20 14 10 27 19 30 15 15 8 21 20 21 21 11 17 10 27 13 11 21 28 23 9 11 33 20 6 4 4 5 11 20 20 24 14 13 13 8 25 21 3 4 6 15 19 8 13 5 10 5 27 13 15 6 7 20 25 20 10 11 10 27 11 9 23 13 23 11 14 24 5 6 8 25 10 17 4 6 16 6 5 18 7	Open. Hide. 62 49 51 47 62 44 41 56 62 56 56 56 56 59 56 49 56 59 62 59 62 62 62 62 62 62 62 62 62 59 43 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 54 59 62 62 62 62 54 49 54 59 62 62 62 59 62 59 59 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 54 62 62 58 58 58 58 58 58 58 58 54 58 45 58 58 58 58 58 58 58 58 58 58 58 58 58 58 39 54 52 58 58 58 58 58 54 58 58 58 43 58 58 58 58 54 58 52 52 54 54 58 58 58 58 58 58 54 58 58 58 58 58 58 58 52 54 54 58 58 58 58 58 58 58 58 58 58 58 51 42 54 58 58 53 58 52 58 58 50 54 58 58 51 58 58 54 58 51 51 54 51 58 47 49 58 51 58 58 58 51 50 50 58 50 51 58 58 58 58 41 51 58 39 53 58 58 53 53 49 52 58 32 54 58 51 58 50 53 53 53 33 58 39 30 54 50 58 52 54 51 54 46 32 41 33 58 41 58 50 40 51 37 43 42 40 39 50 50 47 54 32 54 35 47 44 24 49 51 25 42 51 53 54 42 53 52 39 34 53 51 52 42 44 49 54 54 39 38 53 37 53 53 42 49 33 36 51 41 38 33 29 21 11 11 6 9 13 49 46 45 32 54 49 42 39 40 45 26 54 44 28 26 29 52 41 46 36 51 47 37 52 31 32 22 28 17 24 21 24 40 40 40 14

Alignment Information

BAC End 1

BAC End 2

seq1: chr17_26424767_26425846
seq2: B6Ng01-335N01.b_47_1124

seq1  GAATTCCACAGAAGCTGGGATGTAAGTGAATAGCGGAATGTTTACTTTGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCACAGAAGCTGGGATGTAAGTGAATAGCGGAATGTTTACTTTGC  50

seq1  ATGAGGAAGGTTCTTGCTTCAGTCCCCAGCACTGCAAAAATGAATAGACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGGAAGGTTCTTGCTTCAGTCCCCAGCACTGCAAAAATGAATAGACA  100

seq1  GTAAGAGAAAGAGATAACATAAAGAACTGAGATTAAAAAAAAAAATGTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGAGAAAGAGATAACATAAAGAACTGAGATTAAAAAAAAAAATGTGT  150

seq1  CTGGGGAATAAAAAAGGCTATCCTTTCATTCTCTCTATTTTTTTTTCTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGGAATAAAAAAGGCTATCCTTTCATTCTCTCTATTTTTTTTTCTCT  200

seq1  TTCACTCCCCCTCCACTCATATCTTTTCTTCCTCTTATGTGTGGACAGTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACTCCCCCTCCACTCATATCTTTTCTTCCTCTTATGTGTGGACAGTT  250

seq1  GTCCTGCTGGGATCTATGTTGTATGCTCTTCTCCCCGAACTGCAGCTTCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTGCTGGGATCTATGTTGTATGCTCTTCTCCCCGAACTGCAGCTTCA  300

seq1  GAAAGGTCCCTGGGACAAGATACTTTGACTAGACTCTGTTGGCATGTCAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGGTCCCTGGGACAAGATACTTTGACTAGACTCTGTTGGCATGTCAA  350

seq1  GGACACAGACAAATCAGGTATACGTACACGTTACTCATACTAAGAGGTGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACACAGACAAATCAGGTATACGTACACGTTACTCATACTAAGAGGTGC  400

seq1  AGGTGTCTAACCAGACATAGGGCATGGCCATGAGCCAAGAGAATGAGGGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGTCTAACCAGACATAGGGCATGGCCATGAGCCAAGAGAATGAGGGC  450

seq1  TGTATTACAAGTCTGAGGTTTATGGTACCTGGAGGGTTAGCATTGTCTTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTACAAGTCTGAGGTTTATGGTACCTGGAGGGTTAGCATTGTCTTC  500

seq1  ACAGCAGCAAAAAGCTTGTCTGTGGAGGTGTGAACCTCAGGGGTGGATAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCAGCAAAAAGCTTGTCTGTGGAGGTGTGAACCTCAGGGGTGGATAA  550

seq1  ATCTGGTTGTAACTTGGTCATGCTTACTGGCATGCTTGGCTCAGGAACTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGGTTGTAACTTGGTCATGCTTACTGGCATGCTTGGCTCAGGAACTA  600

seq1  TGGGGAAAGGAACCAAAGGTCAGTGGCTGTACACACCACAGGAGGTTCTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGAAAGGAACCAAAGGTCAGTGGCTGTACACACCACAGGAGGTTCTC  650

seq1  TCATATTAGGTGAAGGACCAACAATACCTCAGATCCCAGGTCACACCCCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATATTAGGTGAAGGACCAACAATACCTCAGATCCCAGGTCACACCCCT  700

seq1  GCACAGCCAGCAGTCACCTCAGGGTTGATGGAGTCCTCATGCAGAGCCTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAGCCAGCAGTCACCTCAGGGTTGATGGAGTCCTCATGCAGAGCCTC  750

seq1  GACAGGAGGAAACTCTGGGCTGACATGACAGTCCAAATGTTATCTAGGTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGAGGAAACTCTGGGCTGACATGACAGTCCAAATGTTATCTAGGTG  800

seq1  GCCTGCCGAGTTGTTGAATGTATATGGCACCTCTTGCCTTGGGCTGCTCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGCCGAGTTGTTGAATGTATATGGCACCTCTTGCCTTGGGCTGCTCC  850

seq1  CTGGCCGGAGAGGGAGTCATGCCTTAGGTAAGGGAGTCGGTCTTGTAGGA  900
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  CTGGCCGGAGAGGGAGTCATGCCTTA-GTAAGGGAGTCGGTCTTGTAGGA  899

seq1  GGCTAAACTGTGGAGTGTCTTCAGGAAGAATAGAGTTCAGAGGCAGAGGC  950
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  GGCTAAACTGTGGAGTGTCTTCAGGAAG-ATAGAGTTCAGAGGCAGAGGC  948

seq1  TGCATGAGGGAAGGGCAGCTTTGCCCT-CTGCAGACTGGGCAGGGCAGAA  999
      |||||||||||| |||||| ||||||| ||||||||| |||||| |||||
seq2  TGCATGAGGGAA-GGCAGC-TTGCCCTCCTGCAGACT-GGCAGGTCAGAA  995

seq1  AGGTTCCCTTGCCTCT-CCAGGG-CTTCTGTGCTAACATGGGCACTGTTC  1047
      ||| |||||||||||| |||||| ||||||||||||||||| |||||| |
seq2  AGG-TCCCTTGCCTCTCCCAGGGCCTTCTGTGCTAACATGGCCACTGTCC  1044

seq1  GTCCTGATCAGGA-CTTACCTTCATTAGTAAGAG  1080
      ||||||||||||| ||||||| ||||||||||||
seq2  GTCCTGATCAGGACCTTACCTCCATTAGTAAGAG  1078

seq1: chr17_26581942_26582668
seq2: B6Ng01-335N01.g_71_797 (reverse)

seq1  CCCCCTATACATAGCAGCCATATCCCTGCCCCCTGGGAATTTCTGGAAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCCTATACATAGCAGCCATATCCCTGCCCCCTGGGAATTTCTGGAAAA  50

seq1  TAGTTGTTTCCCAGGCTAAGCAGGCTCCTCCTCTTACTGGTTGGCCCTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTGTTTCCCAGGCTAAGCAGGCTCCTCCTCTTACTGGTTGGCCCTCT  100

seq1  TGGGCAGCTGTCCTGTGCAGGCTGCGACACACATTTTCACTTGTTCAGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCAGCTGTCCTGTGCAGGCTGCGACACACATTTTCACTTGTTCAGCA  150

seq1  TCCACTTACCAGCATGGCTCATGGTCAGAACATGAGGTTGAAGACTGGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACTTACCAGCATGGCTCATGGTCAGAACATGAGGTTGAAGACTGGGA  200

seq1  CAAAAGGCAAGGCCTGTGGGCAGCTCTCAGGCAAGAGATCATAAACTGAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAGGCAAGGCCTGTGGGCAGCTCTCAGGCAAGAGATCATAAACTGAT  250

seq1  TTGATCACTCTGGAGTTGGGGCTTGTGCTAGCACATAGTAGGTGCTCAGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATCACTCTGGAGTTGGGGCTTGTGCTAGCACATAGTAGGTGCTCAGT  300

seq1  AAAAGACTGCAGATCAGATCAGGAGCCAGGTTAGGAGTGGTCAGGGGGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGACTGCAGATCAGATCAGGAGCCAGGTTAGGAGTGGTCAGGGGGTT  350

seq1  GGTGAAATAGCATCCATTATATATATATGGACACAAAGTCACTCAACAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGAAATAGCATCCATTATATATATATGGACACAAAGTCACTCAACAAA  400

seq1  CATTTGCTGAGTGCCCTCAGGATGCCAGCTGCTATAAGGGGCAACAGAGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTGCTGAGTGCCCTCAGGATGCCAGCTGCTATAAGGGGCAACAGAGA  450

seq1  GCAAGCACCCAGCCCTGATGCCTGAGTGGTACCTTCAGCAGGGCAAGACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGCACCCAGCCCTGATGCCTGAGTGGTACCTTCAGCAGGGCAAGACA  500

seq1  GGGTGGAGCATGTGGGCTTTCTTGACCATTCTATTGCCTTGGATCCATCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGGAGCATGTGGGCTTTCTTGACCATTCTATTGCCTTGGATCCATCT  550

seq1  AAATAGATGCCCACAATACTTTCTGCACCTACCTTAGGGGTGTTCTTTAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAGATGCCCACAATACTTTCTGCACCTACCTTAGGGGTGTTCTTTAT  600

seq1  GGTGAGTGAGCCCTTGCCAAACAGCCAAGATCCCACCAGTTAATGACCAC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGAGTGAGCCCTTGCCAAACAGCCAAGATCCCACCAGTTAATGACCAC  650

seq1  CCACAGGGAGTCTCTGGGCAGAAAACTCCCTGCCACTTCCAGGCACTGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACAGGGAGTCTCTGGGCAGAAAACTCCCTGCCACTTCCAGGCACTGGA  700

seq1  ACGGGGATGCACAAGAGCCCTGAATTC  727
      |||||||||||||||||||||||||||
seq2  ACGGGGATGCACAAGAGCCCTGAATTC  727

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information