MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-272L08
Chromosome	17 (Build37)
Map Location	22,127,899 - 22,128,193
singlet/doublet	singlet
Overlap gene	4930432O21Rik
Upstream gene	V1rf5, Zfp160, LOC627912, LOC435509, EG627924, 4933430A09, EG665654, EG665662, LOC665666, EG665669, V1rf1, V1rf2, V1rf4, V1rf3, A830058L05Rik, Zfp54, Zfp51, Zfp53, LOC100042508, Zfp52, BC049807, Zfp760, BC043476, 4930515G13Rik, 2610036F08Rik, LOC624960, 3110048L19Rik, LOC665820, LOC665825
Downstream gene	LOC674332, LOC631010, EG665844, EG210853, LOC671007, EG240038, EG631624, 6330416L07Rik, Zfp758, 1300003B13Rik, EG210876, LOC100042656, EG628185, ENSMUSG00000046088, EG383218, EG433078, LOC100042679, A630033E08Rik, LOC671128, LOC665961, EG434701
Link	Open Mouse BAC browser

Click to get alignment info.

name	V1rf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171236 MGI:2159639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224585 MGI:108187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs

name	LOC435509 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	EG627924 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627924 MGI:3648804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins

name	4933430A09 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG665654 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665654 MGI:3643625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	EG665662 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665662 MGI:3647086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	LOC665666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins pseudo : _no_value

name	EG665669 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665669 MGI:3647092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	V1rf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171232 MGI:2159635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171233 MGI:2159636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171235 MGI:2159638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171234 MGI:2159637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830058L05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210503 MGI:3053207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22712 MGI:99201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22709 MGI:99198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24132 MGI:99200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042508 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Zfp52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22710 MGI:99199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC049807 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381066 MGI:3040683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp760 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240034 MGI:2679257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC043476 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381067 MGI:2679295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 23 ESTs, 1 Protein

name	4930515G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75098 MGI:1922348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	2610036F08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75424 MGI:1922674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 22 Proteins pseudo : _no_value

name	3110048L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73233 MGI:1920483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs pseudo : _no_value

name	4930432O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74670 MGI:1921920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665820 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665820
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC665825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 83 ESTs, 35 Proteins pseudo : _no_value

name	LOC674332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs pseudo : _no_value

name	LOC631010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	EG665844 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665844 MGI:3643608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	EG210853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210853 MGI:3646759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 110 ESTs, 3 Proteins pseudo : _no_value

name	EG240038 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240038 MGI:3643318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs, 1 Protein

name	EG631624 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631624 MGI:3648314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein

name	6330416L07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319615 MGI:2442394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224598 MGI:2385044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300003B13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74149 MGI:1921399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG210876 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210876 MGI:3647034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 Proteins

name	LOC100042656 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG628185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628185 MGI:3644292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 Proteins

name	ENSMUSG00000046088 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194612 MGI:3642566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG383218 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383218 MGI:3647439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	EG433078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433078 MGI:3644511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	A630033E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240041 MGI:2445132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins pseudo : _no_value

name	LOC665961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG434701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434701 MGI:3648972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	V1rf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717726 GeneID:171236 MGI:2159639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F5 transcript_id : NM_134202.1

name	Zfp160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703953 GeneID:224585 MGI:108187
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 160 transcript_id : NM_145483.1

name	LOC627912 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94401717 GeneID:627912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs product : similar to l-Afadin transcript_id : XM_892614.2

name	EG627924 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82986763 GeneID:627924 MGI:3648804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins product : predicted gene, EG627924 transcript_id : XM_892630.1

name	4933430A09 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268566 GeneID:328766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein 4933430A09 transcript_id : XM_001477465.1

name	EG665654 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268601 GeneID:665654 MGI:3643625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG665654 transcript_id : XM_978485.2

name	EG665662 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268604 GeneID:665662 MGI:3647086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : predicted gene, EG665662 transcript_id : XM_978514.2

name	EG665669 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268569 GeneID:665669 MGI:3647092
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins product : predicted gene, EG665669 transcript_id : XM_978594.2

name	V1rf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717718 GeneID:171232 MGI:2159635
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F1 transcript_id : NM_134198.1

name	V1rf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407051 GeneID:171233 MGI:2159636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F2 transcript_id : NM_134199.3

name	V1rf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717716 GeneID:171235 MGI:2159638
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F4 transcript_id : NM_134201.1

name	V1rf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717722 GeneID:171234 MGI:2159637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F3 transcript_id : NM_134200.1

name	A830058L05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865955 GeneID:210503 MGI:3053207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830058L05 gene transcript_id : NM_172486.2

name	Zfp54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124269707 GeneID:22712 MGI:99201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 54 transcript_id : NM_011760.2

name	Zfp51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124269709 GeneID:22709 MGI:99198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 51 transcript_id : NM_009558.3

name	Zfp53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680995 GeneID:24132 MGI:99200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 53 transcript_id : NM_013843.3

name	LOC100042508 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268606 GeneID:100042508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to zinc finger protein 54 transcript_id : XM_001478492.1

name	Zfp52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937376 GeneID:22710 MGI:99199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 52 transcript_id : NM_144515.2

name	BC049807 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50284536 GeneID:381066 MGI:3040683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049807 transcript_id : NM_001002008.1

name	Zfp760 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56605853 GeneID:240034 MGI:2679257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 760 transcript_id : NM_001008501.1

name	BC043476 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401701 GeneID:381067 MGI:2679295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 1 Protein product : cDNA sequence BC043476, transcript variant 2 transcript_id : XM_892560.2

name	BC043476 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268612 GeneID:381067 MGI:2679295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 1 Protein product : cDNA sequence BC043476, transcript variant 1 transcript_id : XM_354987.5

name	4930515G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268613 GeneID:75098 MGI:1922348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4930515G13 gene transcript_id : XM_979393.2

name	2610036F08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677475 GeneID:75424 MGI:1922674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610036F08 gene transcript_id : NM_029281.1

name	4930432O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268459 GeneID:74670 MGI:1921920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930432O21 gene transcript_id : XM_001471514.1

name	LOC631010 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268617 GeneID:631010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : similar to EG635895 protein transcript_id : XM_001478616.1

name	EG210853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130448 GeneID:210853 MGI:3646759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG210853 transcript_id : NM_177596.3

name	EG240038 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268619 GeneID:240038 MGI:3643318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs, 1 Protein product : predicted gene, EG240038, transcript variant 1 transcript_id : XM_139814.9

name	6330416L07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802178 GeneID:319615 MGI:2442394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330416L07 gene transcript_id : NM_176962.3

name	Zfp758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842386 GeneID:224598 MGI:2385044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 758 transcript_id : NM_145484.2

name	1300003B13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371067 GeneID:74149 MGI:1921399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300003B13 gene transcript_id : NM_198003.2

name	EG210876 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268576 GeneID:210876 MGI:3647034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 25 Proteins product : predicted gene, EG210876 transcript_id : XM_139816.6

name	LOC100042656 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268624 GeneID:100042656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042656 transcript_id : XM_001478701.1

name	EG628185 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268577 GeneID:628185 MGI:3644292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 Proteins product : predicted gene, EG628185 transcript_id : XM_892918.3

name	ENSMUSG00000046088 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268578 GeneID:194612 MGI:3642566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, ENSMUSG00000046088 transcript_id : XM_001477677.1

name	EG383218 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268628 GeneID:383218 MGI:3647439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG383218 transcript_id : XM_001478718.1

name	EG383218 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268626 GeneID:383218 MGI:3647439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG383218, transcript variant 1 transcript_id : XM_356928.5

name	EG433078 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401745 GeneID:433078 MGI:3644511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG433078 transcript_id : XM_484608.3

name	LOC100042679 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268630 GeneID:100042679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042679 transcript_id : XM_001478735.1

name	A630033E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381579 GeneID:240041 MGI:2445132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630033E08 gene transcript_id : NM_177358.3

name	EG434701 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268583 GeneID:434701 MGI:3648972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG434701 transcript_id : XM_486573.4

name	V1rf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717727 CCDS:CCDS28433.1 GeneID:171236 MGI:2159639
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, F5 protein_id : NP_598963.1

name	Zfp160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703954 CCDS:CCDS28434.1 GeneID:224585 MGI:108187
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 160 protein_id : NP_663458.1

name	LOC627912 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82986760 GeneID:627912
definition	codon_start : 1 product : similar to l-Afadin protein_id : XP_897707.1

name	EG627924 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986764 GeneID:627924 MGI:3648804
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_897723.1

name	4933430A09 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268567 GeneID:328766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477515.1

name	EG665654 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268602 GeneID:665654 MGI:3643625
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_983579.2

name	EG665662 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268605 GeneID:665662 MGI:3647086
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_983608.2

name	EG665669 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268570 GeneID:665669 MGI:3647092
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_983688.2

name	V1rf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717719 CCDS:CCDS28435.1 GeneID:171232 MGI:2159635
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, F1 protein_id : NP_598959.1

name	V1rf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407052 GeneID:171233 MGI:2159636
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, F2 protein_id : NP_598960.3

name	V1rf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717717 CCDS:CCDS28437.1 GeneID:171235 MGI:2159638
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, F4 protein_id : NP_598962.1

name	V1rf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717723 CCDS:CCDS28438.1 GeneID:171234 MGI:2159637
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, F3 protein_id : NP_598961.1

name	A830058L05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865956 CCDS:CCDS28439.1 GeneID:210503 MGI:3053207
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : KRAB-zinc finger protein protein_id : NP_766074.2

name	Zfp54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124269708 GeneID:22712 MGI:99201
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : zinc finger protein 76; clone 18 product : zinc finger protein 54 protein_id : NP_035890.2

name	Zfp51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124269710 GeneID:22709 MGI:99198
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 51 protein_id : NP_033584.3

name	Zfp53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305637 CCDS:CCDS28440.1 GeneID:24132 MGI:99200
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Zinc finger protein 118 product : zinc finger protein 53 protein_id : NP_038871.1

name	LOC100042508 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268607 GeneID:100042508
definition	codon_start : 1 product : similar to zinc finger protein 54 protein_id : XP_001478542.1

name	Zfp52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937377 GeneID:22710 MGI:99199
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : KRAB-zinc finger protein 76 product : zinc finger protein 52 protein_id : NP_653098.2

name	BC049807 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50284537 CCDS:CCDS28441.1 GeneID:381066 MGI:3040683
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC381066 protein_id : NP_001002008.1

name	Zfp760 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605854 GeneID:240034 MGI:2679257
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 760 protein_id : NP_001008501.1

name	BC043476 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38081804 GeneID:381067 MGI:2679295
definition	codon_start : 1 product : similar to BC043476 protein isoform 1 protein_id : XP_354987.1

name	BC043476 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986296 GeneID:381067 MGI:2679295
definition	codon_start : 1 product : similar to BC043476 protein isoform 2 protein_id : XP_897653.1

name	4930515G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401731 GeneID:75098 MGI:1922348
definition	codon_start : 1 product : hypothetical protein LOC75098 protein_id : XP_984487.1

name	2610036F08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85677476 GeneID:75424 MGI:1922674
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75424 protein_id : NP_083557.1

name	4930432O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268460 GeneID:74670 MGI:1921920
definition	codon_start : 1 product : hypothetical protein LOC74670 protein_id : XP_001471564.1

name	LOC631010 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268618 GeneID:631010
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_001478666.1

name	EG210853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243956 GeneID:210853 MGI:3646759
definition	codon_start : 1 product : hypothetical protein LOC210853 protein_id : NP_808264.1

name	EG240038 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268620 GeneID:240038 MGI:3643318
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_139814.9

name	6330416L07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892783 GeneID:319615 MGI:2442394
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319615 protein_id : NP_795936.1

name	Zfp758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842387 GeneID:224598 MGI:2385044
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 758 protein_id : NP_663459.2

name	1300003B13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574094 GeneID:74149 MGI:1921399
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74149 protein_id : NP_932120.1

name	EG210876 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986795 GeneID:210876 MGI:3647034
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_139816.4

name	LOC100042656 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268625 GeneID:100042656
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478751.1

name	EG628185 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986799 GeneID:628185 MGI:3644292
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_898011.1

name	ENSMUSG00000046088 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268579 GeneID:194612 MGI:3642566
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477727.1

name	EG383218 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268629 GeneID:383218 MGI:3647439
definition	codon_start : 1 product : similar to endosulfine-alpha protein_id : XP_001478768.1

name	EG383218 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268627 GeneID:383218 MGI:3647439
definition	codon_start : 1 product : similar to endosulfine-alpha isoform 1 protein_id : XP_356928.5

name	EG433078 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51770048 GeneID:433078 MGI:3644511
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484608.1

name	LOC100042679 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268631 GeneID:100042679
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478785.1

name	A630033E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893509 GeneID:240041 MGI:2445132
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC240041 protein_id : NP_796332.1

name	EG434701 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986820 GeneID:434701 MGI:3648972
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_486573.2

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 4 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 3 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 2 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 1 pseudo : _no_value

name	LOC665666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665666
definition	number : 1 pseudo : _no_value

name	LOC665820 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665820
definition	number : 1 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 6 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 5 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 4 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 3 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 2 pseudo : _no_value

name	LOC665961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665961
definition	number : 1 pseudo : _no_value

name	LOC624960 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268614 GeneID:624960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 22 Proteins product : similar to Y box transcription factor pseudo : _no_value transcript_id : XR_033753.1

name	3110048L19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268616 GeneID:73233 MGI:1920483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 36 ESTs product : RIKEN cDNA 3110048L19 gene pseudo : _no_value transcript_id : XR_035371.1

name	LOC665825 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268615 GeneID:665825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 83 ESTs, 35 Proteins product : similar to Tropomyosin alpha-4 chain (Tropomyosin-4) (TM-4) pseudo : _no_value transcript_id : XR_033760.1

name	LOC674332 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268574 GeneID:674332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs product : hypothetical LOC674332 pseudo : _no_value transcript_id : XR_033292.1

name	EG665844 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268575 GeneID:665844 MGI:3643608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG665844 pseudo : _no_value transcript_id : XR_033298.1

name	LOC671007 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268623 GeneID:671007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 110 ESTs, 3 Proteins product : similar to Sorting nexin 4 pseudo : _no_value transcript_id : XR_033824.1

name	EG631624 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268622 GeneID:631624 MGI:3648314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : predicted gene, EG631624 transcript_id : XR_033816.1

name	LOC671128 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268582 GeneID:671128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_033358.1

clone name	MSMg01-261D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-405C22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-299J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-047D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-294O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405M24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-452H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071N02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-074L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-330B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060F20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-144N02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-272L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459B16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-122B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-320P12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-452H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-274G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-480I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-547G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-102J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-182B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064F07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018I14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-272L08.T7 (MSMg01no272_l08.b1)	MSMg01-272L08.TJ (MSMg01no272_l08.g1)
ACC	AG411916	AG411917
length	762	752
length of high quality (start - end)	326 (39 - 364)	299 (67 - 365)
definition	CHROMAT_FILE: MSMg01no272_l08.b1 PHD_FILE: MSMg01no272_l08.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:11:55 2005	CHROMAT_FILE: MSMg01no272_l08.g1 PHD_FILE: MSMg01no272_l08.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:11:55 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCAT ACAGGAGAAAGAACCTTACAAATGTGAATGTGACATGTGTTTTACCCTAA AATTCAATCGATCTTCATTAGAGAATTCATATGAGAGAGAAGCCTTACAA ATATAATGAATGTGACAAATACTTCAGCCAAAAACAATCTCAGCTCTTAT CAGAGAATGCCTACAGTAGGTACTTTCACAAATGAAGTGAATGAGAAAAA CCCGTTTCCAAGGAAGATCATCTTAGAATTCATCAGAGACTATATATAGG AGAAGGAAATTATAAATGTAGTAAATGTTCAAATCCTTCAGTGTTGGTTC ACCATTTAAAATATTTCTTAGAACGCACCCCCGATTTAAAAAAAAACTTA TGAATTTGATATATGAGGAAAGGTCTTTACCCAAATCTCAGACCTAAGAA AATACCTGGTTATTTATAGTCAGAAAAAAGTGTCCACTGGAAAAACTATG GCATGTGCTTTATACCAGTGGTATTGTTGGCAACACTTGAAGCTCCACAC TAGAGAATTATTATATATGCGAGGAAGTTGGGAAAACATTGAAATAATCC TCAAATTTTAGGAGCAACCCAGGGTTTATGCTCAGAGAACCTGAAAATGC AGCAATGAAGGAAATCTTTCATTAAAAGTTTTTACTTGTTCACTTTTAAA TATGTCATGATGGAGAAGCTAANAGATTATGGAGTTGTATAAATTTTCCT GGAGACTGAAAT	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXCTGATTCATTCATTGAATTTACCTAGTTTGTTTA TGTAAACTCTCTGAAATGTCTAGAGACTTCCAGAATAAGGATAACTCTTG TTATCAACAAAACTTTTTCATTTTCTTTCCTTTATATTTCTCTCCATTCT GTGGAAAAGGAACAGGTGTTATATTCTGTGTAATATCTCCAATCTGTGTA TCTACTTTTAATCAAAACTCCCCAGTTTGAATTCTTTGAAAAGAACTTAA TATTGAGAGCAAGAAAATATATTGCCATATACATATTAAATAGAATATTT TAATTTTATTATTTAAATTCACCCACTCAGTTATGAATTTTAAAAATGCA GAATATTTTGAATAGAGAAAGATCTGTTGGTTGTGAGAATTTTGTTGTAG TTTATTTACTTACGTTTTTACCTGTGGTCTCTATGTTTAGTATTGGTACA ACATGGTTTCTTTTTGATTTTGCTTTGTTTTTTTATTACCTTTGTTTTTT AAAGTCCAGTTGTTACCCTCCTCTCAGTCTACCCTCCCATAGTTCCTCAT CCCATTCCTCCTCCTCACTGTCTTCAAGAGGATGTCTTCCCCACTCCCAG CCCTTGCCACTCTCTGGGGCCTCAAGTCTCTTGAGGGTTAGGTGCATCTG AGATCTGTCCGACATGGAGCCACCAACCAGGCAACATACATGAGCTCCTT CT
quality values	Open. Hide. 28 31 32 33 32 30 28 27 28 26 25 30 30 29 37 44 44 44 35 28 28 28 28 35 44 48 48 48 48 48 48 48 57 42 42 34 32 32 40 43 57 54 41 47 47 47 50 51 50 50 50 47 50 50 50 54 54 48 59 48 47 57 57 50 50 50 50 50 50 50 50 50 68 68 68 68 51 51 51 51 51 51 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 68 68 68 68 68 51 51 51 50 42 42 35 35 35 42 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 44 44 27 28 28 30 39 42 40 59 59 59 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 41 30 24 15 8 8 6 6 7 6 8 8 8 8 11 11 12 11 12 11 11 11 16 12 14 14 19 23 26 26 34 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 59 59 47 47 40 47 37 37 37 37 37 59 47 57 57 57 57 57 57 57 57 57 57 43 43 43 47 44 48 48 57 57 57 68 68 68 57 57 57 59 59 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 57 68 68 59 59 59 59 59 59 59 68 68 68 59 59 68 68 68 59 59 59 59 59 57 57 57 57 54 57 59 57 68 68 57 57 57 59 59 59 59 68 59 59 59 59 59 57 59 59 57 57 57 59 57 57 57 57 57 57 48 48 43 43 48 43 50 57 57 48 57 57 48 48 48 48 48 48 48 50 50 50 59 59 59 59 59 44 41 37 44 43 59 59 59 41 47 48 48 48 48 48 48 48 48 48 48 42 47 47 41 39 39 41 31 34 43 43 43 43 41 32 37 41 41 47 41 41 37 36 39 35 31 36 43 34 43 39 39 46 46 43 37 37 34 34 28 34 34 36 31 31 41 40 37 37 39 39 39 34 31 28 41 36 59 59 43 37 29 29 29 29 32 37 41 43 41 41 37 37 37 37 17 9 9 9 9 9 14 20 20 29 35 41 41 41 32 34 23 20 20 28 28 30 37 37 32 30 27 29 29 32 34 34 28 28 28 28 25 30 30 30 22 26 28 23 19 19 23 28 22 15 3 0 3 13 9 9 9 12 14 18 22 24 27 22 22 19 19 15 19 16 18 10 8 8 8 8 13 15 39 22 22 17 17 17 25 25 34 21 21 11 11	Open. Hide. 16 21 21 11 11 11 17 21 35 37 37 41 41 37 37 41 37 37 41 59 44 47 47 50 50 50 48 27 21 11 11 11 21 21 37 37 32 32 34 39 47 47 47 48 48 53 54 54 57 54 57 50 50 50 47 47 50 57 68 68 50 50 50 50 50 50 68 68 68 68 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 38 38 18 18 25 36 43 43 68 68 68 68 68 68 68 68 51 50 51 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 44 42 33 35 35 44 44 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 43 43 42 44 39 43 57 59 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 48 32 32 23 30 30 33 19 14 14 18 21 12 13 10 10 10 10 10 9 10 10 10 10 11 21 30 59 59 59 35 35 35 37 37 57 57 57 59 59 59 57 57 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 54 50 46 46 43 37 37 32 41 41 43 47 59 59 68 68 68 57 57 68 57 59 54 48 48 48 47 47 57 57 57 68 68 68 57 59 59 59 59 59 59 59 59 59 59 68 68 68 68 68 54 57 57 57 57 59 59 59 59 59 59 59 59 59 57 57 57 48 48 48 59 57 50 50 50 37 37 37 37 37 37 59 44 41 41 44 44 44 47 47 59 59 59 48 48 48 57 57 57 59 57 57 57 59 59 57 57 57 59 59 50 50 50 54 54 54 57 57 57 59 59 59 59 59 59 59 47 47 47 47 47 47 48 48 48 48 48 42 39 39 39 37 39 39 34 34 43 43 44 47 59 50 50 42 37 37 37 34 34 30 31 31 39 43 44 47 59 59 59 48 48 48 48 59 59 59 59 48 48 48 48 41 42 42 41 44 59 44 41 41 44 44 39 39 37 30 31 37 37 46 43 37 37 32 26 22 30 23 20 20 24 26 23 32 32 23 15 10 10 10 20 19 37 37 41 41 47 37 35 26 31 39 31 31 30 25 25 37 37 37 39 37 32 27 22 20 27 24 18 18 28 26 22 34 22 22 20 30 30 37 37 37 30 22 22 22 22 24 22 19 19 25 25 28 32 47 47 25 23 10 10 10 16 16 23 19 19 17 16 18 12 12 12 16 12 18 14 14 14 17 21 37 37 32 32 28 32 34 31 34 32 22 24 21 21 21 15 18 20 26 28 16 16 14 13 12 11 22 24 24 20

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no272_l08.g1 MSMg01no272_l08.g1 CHROMAT_FILE:
MSMg01no272_l08.g1 PHD_FILE: MSMg01no272_l08.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:11:55 2005
         (299 letters)



>mm_chr17_22127699_22128397
          Length = 699

 Score =  571 bits (295), Expect = e-167
 Identities = 295/295 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   ctgattcattcattgaatttacctagtttgtttatgtaaactctctgaaatgtctagaga 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 ctgattcattcattgaatttacctagtttgtttatgtaaactctctgaaatgtctagaga 260

                                                                       
Query: 61  cttccagaataaggataactcttgttatcaacaaaactttttcattttctttcctttata 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 cttccagaataaggataactcttgttatcaacaaaactttttcattttctttcctttata 320

                                                                       
Query: 121 tttctctccattctgtggaaaaggaacaggtgttatattctgtgtaatatctccaatctg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tttctctccattctgtggaaaaggaacaggtgttatattctgtgtaatatctccaatctg 380

                                                                       
Query: 181 tgtatctacttttaatcaaaactccccagtttgaattctttgaaaagaacttaatattga 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tgtatctacttttaatcaaaactccccagtttgaattctttgaaaagaacttaatattga 440

                                                                  
Query: 241 gagcaagaaaatatattgccatatacatattaaatagaatattttaattttatta 295
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 gagcaagaaaatatattgccatatacatattaaatagaatattttaattttatta 495


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 299
Length of database: 699
Length adjustment: 9
Effective length of query: 290
Effective length of database: 690
Effective search space:   200100
Effective search space used:   200100
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information