MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-313I19
Chromosome	17 (Build37)
Map Location	14,835,032 - 14,835,187
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Tcte2, Mllt4, LOC100041464, EG635895, EG664821, EG664831, 4930488N24Rik, Dact2, Smoc2, LOC664856, Thbs2
Downstream gene	LOC100041236, Wdr27, LOC664893, 1600012H06Rik, Phf10, LOC100041586, LOC100041574, LOC100041289, LOC100041639, LOC100041621, LOC100041301, 9030025P20Rik, Tcte3, C330048F19, LOC664953, Dll1, LOC100041314, 4932442K08Rik, Psmb1, Tbp, Pdcd2, LOC636398, Prdm9, EG626573, LOC665017, LOC100041775
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tcte2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21646 MGI:98641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mllt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17356 MGI:1314653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 177 ESTs, 3 Proteins

name	LOC100041464 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1021 ESTs, 8 Proteins pseudo : _no_value

name	EG635895 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635895 MGI:3643198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 Proteins

name	EG664821 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664821 MGI:3646178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	EG664831 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664831 MGI:3643256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 Proteins

name	4930488N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75011 MGI:1922261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins

name	Dact2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240025 MGI:1920347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smoc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64074 MGI:1929881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664856 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 3 Proteins pseudo : _no_value

name	Thbs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21826 MGI:98738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041236 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 80 mRNAs, 1602 ESTs, 25 Proteins

name	Wdr27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71682 MGI:1918932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	1600012H06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67912 MGI:1915162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Phf10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72057 MGI:1919307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041586 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041586
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 86 ESTs, 6 Proteins

name	LOC100041574 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 45 ESTs, 4 Proteins

name	LOC100041289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 46 ESTs, 1 Protein

name	LOC100041639 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 82 ESTs, 6 Proteins

name	LOC100041621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 45 ESTs, 4 Proteins

name	LOC100041301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 45 ESTs, 1 Protein

name	9030025P20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381062 MGI:3583895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tcte3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21647 MGI:98642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	C330048F19 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC664953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins pseudo : _no_value

name	Dll1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13388 MGI:104659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041314 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4932442K08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67544 MGI:1914794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19170 MGI:104884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21374 MGI:101838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdcd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18567 MGI:104643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC636398 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 8 Proteins pseudo : _no_value

name	Prdm9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213389 MGI:2384854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins

name	EG626573 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626573 MGI:3646669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC665017 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs, 15 Proteins pseudo : _no_value

name	LOC100041775 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Tcte2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114687622 GeneID:21646 MGI:98641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex-associated testis expressed 2 transcript_id : NM_022311.2

name	Mllt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401629 GeneID:17356 MGI:1314653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 167 ESTs, 2 Proteins product : myeloid/lymphoid or mixed lineage-leukemia translocation to 4 homolog (Drosophila), transcript variant 1 transcript_id : XM_890447.2

name	EG635895 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268490 GeneID:635895 MGI:3643198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 31 Proteins product : predicted gene, EG635895 transcript_id : XM_972801.2

name	EG664821 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268469 GeneID:664821 MGI:3646178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins product : predicted gene, EG664821 transcript_id : XM_972876.2

name	EG664831 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268491 GeneID:664831 MGI:3643256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 28 Proteins product : predicted gene, EG664831 transcript_id : XM_972968.2

name	4930488N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268493 GeneID:75011 MGI:1922261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins product : RIKEN cDNA 4930488N24 gene transcript_id : XM_619430.4

name	Dact2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982103 GeneID:240025 MGI:1920347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dapper homolog 2, antagonist of beta-catenin (xenopus) transcript_id : NM_172826.2

name	Smoc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11612492 GeneID:64074 MGI:1929881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPARC related modular calcium binding 2 transcript_id : NM_022315.1

name	Thbs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755778 GeneID:21826 MGI:98738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thrombospondin 2 transcript_id : NM_011581.1

name	LOC100041236 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268471 GeneID:100041236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 80 mRNAs, 1602 ESTs, 25 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript_id : XM_001476020.1

name	Wdr27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089309 GeneID:71682 MGI:1918932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 27 transcript_id : NM_175173.3

name	1600012H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949023 GeneID:67912 MGI:1915162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600012H06 gene transcript_id : NM_001083882.1

name	1600012H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139947530 GeneID:67912 MGI:1915162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600012H06 gene transcript_id : NM_001083881.1

name	1600012H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948378 GeneID:67912 MGI:1915162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600012H06 gene transcript_id : NM_026451.2

name	1600012H06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948865 GeneID:67912 MGI:1915162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600012H06 gene transcript_id : NM_001083880.1

name	Phf10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129262 GeneID:72057 MGI:1919307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 10 transcript_id : NM_024250.3

name	LOC100041586 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268504 GeneID:100041586
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 83 ESTs, 5 Proteins product : similar to T-complex-associated testis-expressed 4, transcript variant 1 transcript_id : XM_001477686.1

name	LOC100041586 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268506 GeneID:100041586
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 1 Protein product : similar to T-complex-associated testis-expressed 4, transcript variant 2 transcript_id : XM_001477697.1

name	LOC100041574 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268500 GeneID:100041574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 45 ESTs, 4 Proteins product : hypothetical protein LOC100041574 transcript_id : XM_001477656.1

name	LOC100041289 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268473 GeneID:100041289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 46 ESTs, 1 Protein product : similar to VIG (Drosophila Vasa Intronic Gene) ortholog family member (vig-1) transcript_id : XM_001476107.1

name	LOC100041639 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268520 GeneID:100041639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 79 ESTs, 5 Proteins product : similar to t-complex-associated testis expressed 3, transcript variant 1 transcript_id : XM_001477804.1

name	LOC100041639 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268522 GeneID:100041639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 1 Protein product : similar to t-complex-associated testis expressed 3, transcript variant 2 transcript_id : XM_001477817.1

name	LOC100041621 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268516 GeneID:100041621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 45 ESTs, 4 Proteins product : hypothetical protein LOC100041621 transcript_id : XM_001477764.1

name	LOC100041301 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268475 GeneID:100041301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 45 ESTs, 1 Protein product : similar to VIG (Drosophila Vasa Intronic Gene) ortholog family member (vig-1) transcript_id : XM_001476126.1

name	9030025P20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88703056 GeneID:381062 MGI:3583895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030025P20 gene transcript_id : NM_001034891.2

name	Tcte3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88758585 GeneID:21647 MGI:98642
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex-associated testis expressed 3 transcript_id : NM_198104.2

name	Tcte3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88758586 GeneID:21647 MGI:98642
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex-associated testis expressed 3 transcript_id : NM_011560.3

name	9030025P20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88703057 GeneID:381062 MGI:3583895
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030025P20 gene transcript_id : NM_001039552.1

name	C330048F19 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268526 GeneID:328747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein C330048F19 transcript_id : XM_001477826.1

name	Dll1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789271 GeneID:13388 MGI:104659
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : delta-like 1 (Drosophila) transcript_id : NM_007865.2

name	LOC100041314 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268477 GeneID:100041314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041314 transcript_id : XM_001476140.1

name	4932442K08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75905502 GeneID:67544 MGI:1914794
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932442K08 gene transcript_id : NM_024203.3

name	Psmb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388089 GeneID:19170 MGI:104884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 1 transcript_id : NM_011185.3

name	Tbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185894 GeneID:21374 MGI:101838
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TATA box binding protein transcript_id : NM_013684.2

name	Pdcd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407032 GeneID:18567 MGI:104643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : programmed cell death 2 transcript_id : NM_008799.2

name	Prdm9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268533 GeneID:213389 MGI:2384854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : PR domain containing 9, transcript variant 1 transcript_id : XM_619431.4

name	EG626573 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401649 GeneID:626573 MGI:3646669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG626573 transcript_id : XM_891173.2

name	Tcte2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114687623 GeneID:21646 MGI:98641
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : t-complex-associated testis expressed 2 protein_id : NP_071706.2

name	Mllt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401630 GeneID:17356 MGI:1314653
definition	codon_start : 1 product : myeloid/lymphoid or mixed lineage-leukemia translocation to 4 homolog isoform 1 protein_id : XP_895540.2

name	EG635895 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401632 GeneID:635895 MGI:3643198
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_977895.1

name	EG664821 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268470 GeneID:664821 MGI:3646178
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_977970.2

name	EG664831 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268492 GeneID:664831 MGI:3643256
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_978062.2

name	4930488N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268494 GeneID:75011 MGI:1922261
definition	codon_start : 1 product : hypothetical protein LOC75011 protein_id : XP_619430.4

name	Dact2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982104 CCDS:CCDS28406.1 GeneID:240025 MGI:1920347
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : dapper 2 protein_id : NP_766414.2

name	Smoc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612493 GeneID:64074 MGI:1929881
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy product : secreted modular calcium-binding protein 2 protein_id : NP_071710.1

name	Thbs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755779 GeneID:21826 MGI:98738
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : thrombospondin 2 protein_id : NP_035711.1

name	LOC100041236 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268472 GeneID:100041236
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_001476070.1

name	Wdr27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089310 GeneID:71682 MGI:1918932
definition	codon_start : 1 product : WD repeat domain 27 protein_id : NP_780382.2

name	1600012H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948866 GeneID:67912 MGI:1915162
definition	codon_start : 1 product : hypothetical protein LOC67912 protein_id : NP_001077349.1

name	1600012H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139947531 GeneID:67912 MGI:1915162
definition	codon_start : 1 product : hypothetical protein LOC67912 protein_id : NP_001077350.1

name	1600012H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139949024 GeneID:67912 MGI:1915162
definition	codon_start : 1 product : hypothetical protein LOC67912 protein_id : NP_001077351.1

name	1600012H06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948379 GeneID:67912 MGI:1915162
definition	codon_start : 1 product : hypothetical protein LOC67912 protein_id : NP_080727.2

name	Phf10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980708 CCDS:CCDS28407.1 GeneID:72057 MGI:1919307
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : PHD finger protein 10 protein_id : NP_077212.2

name	LOC100041586 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268507 GeneID:100041586
definition	codon_start : 1 product : similar to T-complex-associated testis-expressed 4 isoform 2 protein_id : XP_001477747.1

name	LOC100041586 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268505 GeneID:100041586
definition	codon_start : 1 product : similar to T-complex-associated testis-expressed 4 isoform 1 protein_id : XP_001477736.1

name	LOC100041574 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268501 GeneID:100041574
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477706.1

name	LOC100041289 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268474 GeneID:100041289
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476157.1

name	LOC100041639 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268523 GeneID:100041639
definition	codon_start : 1 product : similar to t-complex-associated testis expressed 3 isoform 2 protein_id : XP_001477867.1

name	LOC100041639 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268521 GeneID:100041639
definition	codon_start : 1 product : similar to t-complex-associated testis expressed 3 isoform 1 protein_id : XP_001477854.1

name	LOC100041621 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268517 GeneID:100041621
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477814.1

name	LOC100041301 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268476 GeneID:100041301
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476176.1

name	Tcte3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491908 CCDS:CCDS28409.1 GeneID:21647 MGI:98642
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence IDA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; t-complex testis-expressed 4 product : t-complex-associated testis expressed 3 isoform 2 protein_id : NP_932772.1

name	Tcte3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491912 CCDS:CCDS28408.1 GeneID:21647 MGI:98642
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence IDA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; t-complex testis-expressed 4 product : t-complex-associated testis expressed 3 isoform 1 protein_id : NP_035690.2

name	9030025P20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88703058 GeneID:381062 MGI:3583895
definition	codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC381062 isoform 1 protein_id : NP_001034641.1

name	9030025P20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702244 CCDS:CCDS28410.1 GeneID:381062 MGI:3583895
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC381062 isoform 2 protein_id : NP_001030063.1

name	C330048F19 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268527 GeneID:328747
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477876.1

name	Dll1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789272 GeneID:13388 MGI:104659
definition	GO_component : GO:0031410 - cytoplasmic vesicle [Evidence IDA]; GO:0005576 - extracellular region [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005112 - Notch binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009912 - auditory receptor cell fate commitment [Evidence NAS]; GO:0007154 - cell communication [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0001709 - cell fate determination [Evidence ISS]; GO:0007386 - compartment specification [Evidence IMP]; GO:0007368 - determination of left/right symmetry [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence NAS]; GO:0030097 - hemopoiesis [Evidence ISS]; GO:0048839 - inner ear development [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence NAS]; GO:0045608 - negative regulation of auditory receptor cell differentiation [Evidence IMP]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0007399 - nervous system development [Evidence NAS]; GO:0007219 - Notch signaling pathway [Evidence ISS] [Evidence IEA]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence NAS]; GO:0009887 - organ morphogenesis [Evidence NAS]; GO:0030155 - regulation of cell adhesion [Evidence ISS]; GO:0001757 - somite specification [Evidence IMP]; GO:0001756 - somitogenesis [Evidence IGI] codon_start : 1 note : delta like-1 product : delta-like 1 protein_id : NP_031891.2

name	LOC100041314 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268478 GeneID:100041314
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476190.1

name	4932442K08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51988904 GeneID:67544 MGI:1914794
definition	GO_function : GO:0004527 - exonuclease activity [Evidence IEA] codon_start : 1 product : PPARgamma constitutive coactivator 1 protein_id : NP_077165.2

name	Psmb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242197 CCDS:CCDS28411.1 GeneID:19170 MGI:104884
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : proteasome beta-subunit C5; proteasome subunit C5 product : proteasome (prosome, macropain) subunit, beta type 1 protein_id : NP_035315.1

name	Tbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185895 GeneID:21374 MGI:101838
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0000120 - RNA polymerase I transcription factor complex [Evidence TAS]; GO:0005667 - transcription factor complex [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence IEA] [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence IEA] codon_start : 1 note : TFIID core protein; TATA-binding protein; TATA binding protein product : TATA box binding protein protein_id : NP_038712.2

name	Pdcd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407033 CCDS:CCDS28413.1 GeneID:18567 MGI:104643
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : programmed cell death protein 2 product : programmed cell death 2 protein_id : NP_032825.2

name	Prdm9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268534 GeneID:213389 MGI:2384854
definition	codon_start : 1 product : PR-domain zinc finger protein isoform 1 protein_id : XP_619431.3

name	EG626573 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986575 GeneID:626573 MGI:3646669
definition	codon_start : 1 product : similar to mitochondrial ribosomal protein S21 protein_id : XP_896266.1

name	LOC664893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664893
definition	number : 1 pseudo : _no_value

name	LOC664893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664893
definition	number : 2 pseudo : _no_value

name	LOC100041464 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268487 GeneID:100041464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1021 ESTs, 8 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_033253.1

name	LOC664856 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268495 GeneID:664856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 3 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_033311.1

name	LOC664953 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268528 GeneID:664953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins product : similar to ubiquitin-conjugating enzyme E2L 3 pseudo : _no_value transcript_id : XR_033414.1

name	LOC636398 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268479 GeneID:636398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 8 Proteins product : similar to zinc finger protein 91 pseudo : _no_value transcript_id : XR_032603.1

name	LOC665017 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268480 GeneID:665017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs, 15 Proteins product : similar to Odc1 protein pseudo : _no_value transcript_id : XR_032613.1

name	LOC100041775 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268537 GeneID:100041775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to integrin beta 3 binding protein pseudo : _no_value transcript_id : XR_033510.1

clone name	MSMg01-499L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502E01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307F21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-267E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370N19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-274P22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484D06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260N15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-378N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531H11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-158D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110A04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-421G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-433D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-127E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-084N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-427C22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-433J15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-138A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-276H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-407O06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-530J13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-059B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154F19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-313I19.T7 (MSMg01no313_i19.b1)	MSMg01-313I19.TJ (MSMg01no313_i19.g1)
ACC	AG435444	AG435445
length	1,271	1,293
length of high quality (start - end)	264 (476 - 739)	159 (70 - 228)
definition	CHROMAT_FILE: MSMg01no313_i19.b1 PHD_FILE: MSMg01no313_i19.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:55:22 2005	CHROMAT_FILE: MSMg01no313_i19.g1 PHD_FILE: MSMg01no313_i19.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:55:22 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NGGTTTTNNNNNGGGCATTGGGCGCTATAGACTACTATAGGGAGAGGATC CGCGGAATTCTTTGAAGTCTTAAATGCATTAAGAGATTTAGGCAAATGTC AAAGACTGATGGCCCAACCTTGAATTGAATACACCCCCCTCTGTATGGTC ATCAGGTATATGCAAAAGGGCTATGCCATCAATACAAAGGATAAGCAAAC AGAACCACTAGGAGACACCACTTGACACACATCAAAAAGACCAGGGGCAG TTCTGGATAGGTGGCTCAGATCTTCTTAACAATCAAAAGGACAAAGTGTA GATGGGACTGGAGAAGAGGCTCAGCTGTTAAGAGTGTGGGCTCCTCATGG TTCCTAGCAGCTATGATGGGTGATGCACAACTGCCTGTTACTTAAGTCCT AGGGTATTTGTTTATTCTGTTCTGGCCTCCGTGAGCATCTTCACTCATGT GCATCTATCTCTCTTATGATGTGTACACATACACAACTAAAAATAAAATA ATTCATAAAGATGGGTGATGACAAATGTGGGTGAGGATGTAGAATATTGG AATCTTACACATTGTTGCCAGAGATGTATGCAGACAGTATGGTATGCCCT CAAAACACAAAAACAAAGCACCGTCCTCCCTCCAAATCTACCCTGTTATT CAGCAATGTCGCTACCGGGCCTTTATTCAAAGAATTGGAATCAACAGCTC CAAGAGATCATTGTATCTCGGTGCTTATGGCAACATTGTCACACCTGTGA AGATACAAGTACCCACCGGCAGGCAGAGATAGGTTTTCTGCCCCAAATGA TGCTTGCTTGTCCTGCCTGTGTCACACCTGAAGCTTCTATTGCCTATGAA ATCCAAAAATGAATAAATGTGTACTTTTCCACATTATGACTATACTTTTA ATTCTGCACTTATCTTTAAATGTTACTTATTTCTTTTTGTTAATTTTATC TACAACCTCCTTGTTCCCCCTTCTATCCATTCTTCTTTCAATTTTTTATT ACGTCAATTTATATCATTCTATTATTCTTTCATTTTTATCTTTCTCTATC AATCATCTTTTCACTTAAATTTCATCACTCTTCTCTACATATCCATTTAT TCTATACTTTTCCTTACCATATCTCATCTCAACTCCCTTTTTTCTTATAC TTCTTTACATATTTATTCTAATCTATCACTTACTCTATTCCCTCACATTC TATTCTCTCCTACTTCCTTCTTATACTTTTCTTATTCTTTATCTTCTTCC TTTTAATTTTCTCTTATTTTT	NNCCGTGCTAGGTAGCTGGGGXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXCCATTATGTCCCACAGAGGACAAGTCCTACT GATCTACTGCATCTTAGTTCAGCCCATATGGAAAACCAGGGTAGCCAGTG ATGCTGGCCTAATGGCAGGGGGGAGGAGGGAAGAGAACAGGGTAGTGAGT GTGGAGAAGTTGGAGGANAGACTAGANNACNCCNCNCNCTCCTGCTGGAC NCACTTCTTAAAAGCAGGATAATAGCTTATTATACCAATGCAAGTCACAC AGGAGGCGCTGGTGATGAATCAAGATTTCCTGATAGGATGATCTGTTCTT ATCATATAATTTCTGTTTCTTAGCTGTTTGTTTTTGTGTTCTCTTTTTTT TTTTTATTCTGGCGGACTCATGCTTTCTTTATTGGGGGAGAAGAAGCTTT TTTTTTTTTTCCCCCCCCCCCNNNAGNANNNNCCCTCTCAAAAAAAAGGG GGGGGGNTNNNNTNTTTTTTTTTTCTTTNTCTTTTTTCTCTTTTTTTTTC TCTTTCTTTTTTTTTCTTTTTTTTTCCTTTTTCTCCTTTTTTTTCTTTTT TTCTCTTTCTCTCTTTTTTTTCCTTTTTTTTTTCTTTTCTCTTTTTTTTT TTTCTTTTCTTTTTCTTCCTTTTTTCTTTTTTTTTCTTTTTTTTTTTTTT TTTTTCTTTCTCCTTTCTTTTTTTTTTTTTTTTCTTTTTTTTCTCTCTTT CTTTTCTTTTTTTTTTTTTTTTTTTCTCCCTTTTTCTTTTTTTTTTTTTT TCTCTTTTTTTTCTCTCTTTCCCTTTTTCCTCCCTTTTCTTTTCTTCCTC CTTCTTCTTCTCTTTCCTTCTTTTTTTTTTTCTTTCCTTTTTTTTTCTCC TTCCTCTTCTTCTTCTTTTTTTTCTTTTTTCCTCTCTTTCTCTCTCTTCT TTTTTCTCTTCTCTTTCCCTTTCTTCTTTTTTCTTTTTTTCTTTCTTTCT TTTTTTTCCTTTTTTTTCTCTTCTTTTTTTCCTCTTTCTTCTCTTTTTCT TCCTTCTTCTTTTCTTCTCTTCTCTTTCTTTTTTTTTTCTTCTTTCTCCT TCCTTCTTTTCTCTTTCTTCTTCTCCTCTTCTTTTTTCTCTTCTTTTTCT TCTTCCTCTTCTTTTTTTTTTCCTCTTTTTTTCTTTCTCCTCTTTTCCTC TTTCTTCTTTCTTTCTCTTTTTTCTTCTTCTTTTTCTCCTTCTCTCTTTC TTCTTCTCCTTCTTCTTCTTTCCTTTTTTTTCTCCTTTCTCTT
quality values	Open. Hide. 0 3 9 9 9 9 3 0 0 0 0 0 3 9 6 6 7 7 9 9 9 8 11 8 8 6 6 6 6 8 12 17 10 8 8 8 12 15 19 24 35 32 28 29 29 33 33 34 34 36 37 43 48 48 48 50 50 47 53 50 37 37 36 36 38 36 53 53 36 33 44 39 37 19 15 8 8 8 8 8 10 10 10 12 28 28 33 33 37 37 37 37 53 53 53 50 50 50 50 50 50 57 53 53 53 50 36 36 31 31 31 33 33 27 25 12 11 11 12 10 8 8 8 8 12 15 29 33 33 25 26 12 12 11 16 14 12 11 11 24 21 33 33 33 39 44 50 53 53 53 53 53 50 50 50 53 53 53 53 57 57 57 59 59 59 59 59 59 59 50 50 50 53 53 53 53 53 57 57 53 53 50 50 50 50 36 33 28 10 10 9 9 8 13 17 34 34 59 43 48 48 48 48 48 48 48 47 39 44 47 53 53 53 50 50 50 53 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 44 24 23 9 9 9 15 27 34 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 50 47 47 27 23 11 8 8 8 8 8 17 30 36 59 59 59 59 59 59 59 59 59 59 59 59 59 57 50 50 50 53 53 57 59 59 59 59 57 57 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 30 27 16 10 8 8 8 8 8 12 19 23 24 23 20 20 18 24 22 37 34 59 59 59 59 59 59 59 59 59 59 48 48 59 59 59 59 59 23 19 9 9 9 9 10 12 15 15 30 28 46 47 37 47 59 59 59 59 57 50 53 50 50 50 57 59 59 59 59 59 57 48 48 59 59 68 68 68 68 59 68 59 59 54 59 59 68 57 68 57 57 57 57 59 68 57 57 57 57 54 54 54 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 57 57 43 44 37 43 43 57 57 57 57 57 57 57 57 57 47 48 39 42 42 37 30 44 42 42 42 39 43 43 42 42 37 37 39 43 44 59 47 47 47 48 48 48 54 54 54 54 59 59 68 68 68 68 47 47 47 47 42 42 54 54 48 59 59 59 57 48 57 57 57 57 57 48 48 48 48 44 57 43 43 43 43 41 40 41 39 34 28 21 14 14 28 26 33 33 33 33 33 37 43 39 39 39 43 37 43 35 23 18 28 24 24 22 31 32 20 15 15 12 18 11 16 16 33 21 24 20 27 28 33 37 39 37 34 34 33 28 24 25 21 17 28 34 31 39 28 25 18 11 11 21 16 31 35 33 33 28 19 12 12 12 17 14 10 10 10 10 17 16 13 12 10 10 16 20 12 14 18 18 18 11 12 11 18 18 21 23 19 19 19 22 28 21 21 14 17 9 9 9 15 12 11 9 10 9 10 11 11 15 11 11 12 21 21 21 14 14 14 24 24 15 10 9 8 9 14 15 15 17 8 8 8 8 15 10 10 10 11 17 17 19 16 18 12 12 13 15 8 8 8 15 11 11 11 12 15 12 11 11 11 11 13 15 18 14 10 8 6 6 8 6 7 8 8 8 9 10 9 14 11 15 8 8 8 8 8 7 6 6 6 11 11 11 13 13 10 8 6 7 8 8 11 10 8 10 7 6 6 6 8 8 8 11 13 8 8 8 10 12 10 10 10 13 10 12 10 8 8 8 6 10 8 8 8 8 10 15 9 9 9 10 9 9 8 8 8 8 8 8 10 8 13 10 8 8 8 10 8 6 7 12 8 18 18 8 8 8 10 8 8 11 9 9 9 9 8 8 8 8 8 8 8 8 12 12 10 10 10 11 11 11 11 12 10 10 10 9 11 13 17 11 11 11 12 15 12 21 12 12 10 11 12 10 8 8 8 8 6 7 10 6 6 8 8 6 6 6 6 8 8 9 9 10 10 10 10 8 10 10 10 8 8 8 6 6 8 8 9 12 8 8 8 8 12 10 10 10 10 8 9 9 9 9 9 11 10 10 15 19 19 17 10 9 9 10 13 10 13 12 15 11 8 8 8 8 8 8 8 12 13 15 8 10 10 9 10 10 9 8 8 8 8 8 9 10 13 10 10 6 6 8 8 10 10 10 8 11 10 11 10 8 8 8 10 10 8 8 8 8 9 8 8 8 8 8 8 12 10 10 9 9 9 9 9 13 11 10 8 8 8 6 8 8 8 8 8 10 12 23 12 9 9 9 9 9 9 8 8 8 8 8 6 8 8 9 8 10 10 8 8 8 8 10 13 12 13 8 8 8 8 8 10 10 10 10 10 8 8 8 8 10 8 10 10 15 15 14 12 13 9 9 8 8 11 8 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 12 12 12 11 11 11 12 8 8 8 8 8 8 8 6 8 8 8 8 8 8 8 8 8 8 11 11 10 10 6 6 8 8 10 10 8 8 8 8 8 8 8 10 12 12 14 14 15 13 10 10 10 10 8 10 8 10 10 8 8 6	Open. Hide. 0 0 3 6 6 6 6 6 6 11 6 6 6 6 8 8 6 6 6 7 9 13 13 9 8 8 8 8 15 15 28 21 23 10 10 10 23 21 29 22 22 24 24 21 14 14 14 26 22 40 40 40 40 57 57 59 59 59 59 59 57 57 57 57 68 68 48 57 57 48 48 48 47 50 50 50 50 50 50 50 68 68 50 50 50 51 50 50 53 48 48 48 50 48 48 48 48 47 47 47 47 47 47 47 42 42 37 36 50 50 50 50 36 36 31 31 31 31 27 27 22 22 11 13 12 11 11 17 19 27 34 46 50 59 59 50 50 57 50 50 50 50 50 50 57 57 57 57 57 57 57 57 57 57 57 57 57 43 43 47 47 43 48 54 54 54 68 68 68 68 68 68 68 68 57 57 59 59 54 54 54 57 57 57 57 57 59 59 59 57 50 50 50 50 53 53 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 40 37 37 23 23 3 0 3 22 22 37 37 23 23 3 0 0 3 3 0 3 3 0 3 0 3 0 3 17 19 29 39 37 37 37 19 15 6 3 0 3 11 17 25 23 15 15 13 24 13 15 15 19 19 13 18 19 24 12 8 8 8 8 8 8 12 23 23 30 23 24 13 14 14 19 22 12 14 15 15 13 16 16 15 11 13 15 10 21 21 42 42 48 34 21 10 9 9 9 9 11 17 30 30 20 18 10 10 10 10 9 8 8 6 6 8 8 9 10 12 17 10 9 9 9 9 16 22 19 18 12 15 15 18 18 11 12 11 12 12 11 9 9 13 18 17 12 13 13 13 13 28 23 24 14 10 10 10 12 12 8 8 8 8 11 8 8 8 8 9 12 12 11 13 16 11 12 18 18 28 29 23 20 20 13 16 14 16 19 19 32 14 18 10 9 9 10 12 15 11 9 10 8 8 6 6 8 8 8 11 16 15 18 18 12 11 9 15 11 8 8 8 12 11 12 11 10 10 10 10 8 6 6 6 6 8 8 12 13 16 19 21 32 32 32 26 13 14 11 11 13 16 37 32 30 19 9 10 9 3 0 0 0 3 3 0 3 0 0 0 0 3 6 6 6 6 8 8 10 14 12 13 16 10 9 9 9 9 9 9 11 10 12 9 3 0 3 0 0 0 0 3 0 3 9 9 9 9 9 9 21 17 15 8 7 8 3 0 3 6 6 10 10 10 9 9 12 11 8 8 8 8 8 10 15 12 8 10 12 16 18 15 19 13 10 8 8 8 8 11 10 11 10 13 13 10 13 9 10 12 19 8 10 8 10 17 17 15 10 8 8 8 8 8 8 10 10 8 12 12 13 12 8 8 8 8 8 10 9 10 10 8 8 8 8 8 8 8 9 17 15 15 14 16 21 21 17 16 10 10 10 9 8 9 9 10 10 10 8 8 8 8 9 10 13 15 8 8 8 10 10 17 15 15 15 19 21 21 15 15 15 10 10 10 10 9 9 9 9 12 11 9 9 15 13 10 9 9 9 10 18 13 12 12 21 21 19 10 10 11 16 14 20 14 22 10 10 10 15 15 22 28 23 31 14 13 16 16 22 21 19 10 10 8 8 10 8 8 8 9 9 9 10 15 10 9 9 10 10 10 11 11 14 18 14 16 11 10 8 8 8 8 8 8 11 9 9 9 12 19 10 7 6 8 8 12 10 13 10 10 15 19 10 8 6 6 10 10 12 14 16 22 26 19 12 10 13 10 10 10 15 18 12 11 11 12 8 10 8 8 10 8 8 8 8 8 20 21 28 33 24 20 20 13 10 10 11 10 12 14 10 10 8 8 8 10 15 10 8 8 8 8 10 10 8 6 6 8 6 8 11 8 8 8 8 11 16 15 18 22 20 11 11 11 13 8 9 9 9 8 11 11 11 11 11 10 10 8 8 12 15 8 8 8 8 10 15 16 10 9 9 8 11 8 8 8 8 8 10 21 24 24 20 20 24 23 18 10 10 8 14 14 19 21 20 20 20 14 16 16 16 13 13 14 12 11 13 13 13 16 9 9 9 9 9 10 9 9 9 10 10 10 8 8 8 15 10 15 15 8 8 6 7 8 13 18 18 18 15 13 13 10 8 8 10 8 8 8 6 6 6 6 10 8 8 13 10 8 10 12 10 8 8 12 8 10 10 13 12 10 10 10 19 12 10 10 10 10 9 10 10 11 11 12 11 8 8 8 8 13 12 9 8 8 8 10 11 15 8 9 8 8 10 12 14 18 11 22 13 15 10 9 11 8 8 8 8 6 6 8 8 8 10 13 10 8 6 6 6 6 11 12 8 8 10 9 10 10 10 11 8 8 8 8 8 8 9 9 8 8 8 8 8 8 10 12 16 10 10 10 9 10 11 12 12 12 9 9 9 12 9 9 8 8 8 8 8 8 8 9 8 8 10 19 19 14 9 8 8 8 8 8 9 9 13 11 15 15 8 8 8 9 9 8 8 8 8 11 11 10 9 9 9 10 11 11 8 8 7 7 12 10 9 9 15 15 12 13 8 8 6 7 10 8 10 10 8 8 8 8 9 9 12 12 12 10 10 10 10 12 11 21 11 11 11 13 13 15 13 8 8 8 12 8 8 8 8 8 8 13 13 8 8 10 13 13 14 15 14 14 15 12 15 11 12 10 13 13 12 8 8 8 10 12 8 12 9 8 8 11 12 11 9 10 10 8 8 8 7 7 10 10 15 10 10 10 8 11 8 8 8 8 10 11 14 11 11 11 11 11 9 12 13 10 10 10 10 10 7 9 10 8 13 8 10 8 8 8 8 8 6 6 8 8 8 8 8 8 7 6 8 8 9 8 8 6 6 11 15 19 17 9 8 8 8 8 8 19 12 11 15 15 9 10 10 10 17 13 23 12 18 10 8 8 8 8 8 8 8 10 10 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no313_i19.g1 MSMg01no313_i19.g1 CHROMAT_FILE:
MSMg01no313_i19.g1 PHD_FILE: MSMg01no313_i19.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:55:22 2005
         (159 letters)



>mm_chr17_14834832_14835389
          Length = 558

 Score =  267 bits (138), Expect = 2e-76
 Identities = 152/157 (96%), Gaps = 1/157 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   ccattatgtcccacagaggacaagtcctactgatctactgcatcttagttcagcccatat 60
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| || | 
Sbjct: 201 ccattatgtcccacagaggacaagtcctactgatctactgcatcttagttcagctcagac 260

                                                                       
Query: 61  ggaaaaccagggtagccagtgatgctggcctaatggcaggggggaggagggaagagaaca 120
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 261 ggaaaaccagggtagccagtgatgctggcctaatggcaggggg-aggagggaagagaaca 319

                                                
Query: 121 gggtagtgagtgtggagaagttggagganagactaga 157
           |||||||||||||||||||||||||||| ||||||||
Sbjct: 320 gggtagtgagtgtggagaagttggaggagagactaga 356


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 7
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 159
Length of database: 558
Length adjustment: 8
Effective length of query: 151
Effective length of database: 550
Effective search space:    83050
Effective search space used:    83050
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information