MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-371L23
Chromosome	17 (Build37)
Map Location	47,856,477 - 47,856,798
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Pex6, Gnmt, Tnrc5, Ptcra, 2310039H08Rik, Rpl7l1, BC032203, A330017A19Rik, Tbcc, Prph2, Ubr2, LOC100043385, EG240110, Trerf1, Mrps10, Guca1b, Guca1a, EG545208, 1700001C19Rik, AI661453, Tbn, Ccnd3, Bysl, Trfp, LOC668463, Usp49, 1110002E23Rik, Frs3
Downstream gene	Pgc, LOC100043405, Tcfeb, Mdfi, Foxp4, LOC383250, 1700122O11Rik, 1700067P10Rik, 9830107B12Rik, A530064D06Rik, LOC100043419, Trem1, Trem3, Treml4, Treml2, B430306N03Rik, Trem2, Treml1, Nfya, AI314976, Apobec2, Bzrpl1, Unc5cl
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pex6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224824 MGI:2385054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14711 MGI:1202304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnrc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72029 MGI:1919279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptcra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19208 MGI:104857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310039H08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67101 MGI:1914351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl7l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66229 MGI:1913479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC032203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210982 MGI:2673855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 103 ESTs, 2 Proteins

name	A330017A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442840 MGI:3045380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs

name	Tbcc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72726 MGI:1919976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19133 MGI:102791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224826 MGI:1861099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043385 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	EG240110 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240110 MGI:3647512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 4 Proteins

name	Trerf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224829 MGI:2442086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64657 MGI:1928139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Guca1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107477 MGI:1194489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Guca1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14913 MGI:102770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545208 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545208 MGI:3648910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 347 ESTs, 4 Proteins

name	1700001C19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75462 MGI:1922712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI661453 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224833 MGI:2146908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63856 MGI:1926879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12445 MGI:88315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Bysl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53414 MGI:1858419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trfp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56771 MGI:1929648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668463 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 15 Proteins pseudo : _no_value

name	Usp49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224836 MGI:2685391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110002E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66119 MGI:1913369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107971 MGI:2135965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109820 MGI:98909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Tcfeb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21425 MGI:103270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdfi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17240 MGI:107687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74123 MGI:1921373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC383250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	1700122O11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76651 MGI:1923901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	1700067P10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68224 MGI:1915474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9830107B12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328829 MGI:3608415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530064D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328830 MGI:2443476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043419 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Trem1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58217 MGI:1930005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trem3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58218 MGI:1930003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Treml4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224840 MGI:1923239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Treml2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328833 MGI:2147038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B430306N03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320148 MGI:2443478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trem2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83433 MGI:1913150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Treml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71326 MGI:1918576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfya (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18044 MGI:97316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI314976 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106821 MGI:2146818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apobec2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11811 MGI:1343178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bzrpl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70026 MGI:1917276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc5cl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76589 MGI:1923839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703961 GeneID:224824 MGI:2385054
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 6 transcript_id : NM_145488.1

name	Gnmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754025 GeneID:14711 MGI:1202304
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine N-methyltransferase transcript_id : NM_010321.1

name	Tnrc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982623 GeneID:72029 MGI:1919279
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trinucleotide repeat containing 5 transcript_id : NM_028065.2

name	Ptcra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755215 GeneID:19208 MGI:104857
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pre T-cell antigen receptor alpha transcript_id : NM_011195.1

name	2310039H08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286871 GeneID:67101 MGI:1914351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310039H08 gene transcript_id : NM_025966.3

name	Rpl7l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130326 GeneID:66229 MGI:1913479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L7-like 1 transcript_id : NM_025433.3

name	BC032203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268859 GeneID:210982 MGI:2673855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 102 ESTs, 2 Proteins product : cDNA sequence BC032203 transcript_id : XM_001001238.2

name	Tbcc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87044900 GeneID:72726 MGI:1919976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin-specific chaperone c transcript_id : NM_178385.3

name	Prph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7110698 GeneID:19133 MGI:102791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peripherin 2 transcript_id : NM_008938.1

name	Ubr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58615692 GeneID:224826 MGI:1861099
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin protein ligase E3 component n-recognin 2 transcript_id : NM_146078.2

name	LOC100043385 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268726 GeneID:100043385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to high mobility group nucleosomal binding domain 2 transcript_id : XM_001480078.1

name	EG240110 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268862 GeneID:240110 MGI:3647512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 4 Proteins product : predicted gene, EG240110 transcript_id : XM_140042.9

name	Trerf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369895 GeneID:224829 MGI:2442086
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcriptional regulating factor 1 transcript_id : NM_172622.1

name	Mrps10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147048 GeneID:64657 MGI:1928139
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S10 transcript_id : NM_183086.1

name	Guca1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122570 GeneID:107477 MGI:1194489
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase activator 1B transcript_id : NM_146079.1

name	Guca1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254632 GeneID:14913 MGI:102770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase activator 1a (retina) transcript_id : NM_008189.2

name	EG545208 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268863 GeneID:545208 MGI:3648910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 347 ESTs, 4 Proteins product : predicted gene, EG545208 transcript_id : XM_619467.4

name	1700001C19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037410 GeneID:75462 MGI:1922712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001C19 gene transcript_id : NM_029296.1

name	AI661453 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703963 GeneID:224833 MGI:2146908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI661453 transcript_id : NM_145489.1

name	Tbn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803261 GeneID:63856 MGI:1926879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taube nuss transcript_id : NM_022015.3

name	Ccnd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012532 GeneID:12445 MGI:88315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D3 transcript_id : NM_001081636.1

name	Ccnd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012503 GeneID:12445 MGI:88315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D3 transcript_id : NM_001081635.1

name	Ccnd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126012528 GeneID:12445 MGI:88315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin D3 transcript_id : NM_007632.2

name	Bysl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46560590 GeneID:53414 MGI:1858419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bystin-like transcript_id : NM_016859.2

name	Trfp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802099 GeneID:56771 MGI:1929648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Trf (TATA binding protein-related factor)-proximal protein homolog (Drosophila) transcript_id : NM_020048.3

name	Usp49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38259219 GeneID:224836 MGI:2685391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 49 transcript_id : NM_198421.1

name	1110002E23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982675 GeneID:66119 MGI:1913369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110002E23 gene transcript_id : NM_025365.2

name	Frs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130081 GeneID:107971 MGI:2135965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor substrate 3 transcript_id : NM_144939.2

name	Pgc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375746 GeneID:109820 MGI:98909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : progastricsin (pepsinogen C) transcript_id : NM_025973.3

name	Tcfeb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538818 GeneID:21425 MGI:103270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor EB transcript_id : NM_011549.2

name	Mdfi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754665 GeneID:17240 MGI:107687
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MyoD family inhibitor transcript_id : NM_010783.1

name	Foxp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21630274 GeneID:74123 MGI:1921373
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box P4 transcript_id : NM_028767.1

name	1700122O11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268728 GeneID:76651 MGI:1923901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700122O11 gene transcript_id : XM_001480119.1

name	1700067P10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126722639 GeneID:68224 MGI:1915474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700067P10 gene transcript_id : NM_026625.2

name	9830107B12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130515 GeneID:328829 MGI:3608415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9830107B12 gene transcript_id : NM_177824.3

name	A530064D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802702 GeneID:328830 MGI:2443476
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530064D06 gene transcript_id : NM_178796.4

name	Trem1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362336 GeneID:58217 MGI:1930005
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells 1 transcript_id : NM_021406.3

name	Trem3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378895 GeneID:58218 MGI:1930003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells 3 transcript_id : NM_021407.2

name	Treml4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369889 GeneID:224840 MGI:1923239
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells-like 4 transcript_id : NM_172623.1

name	Treml4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76677892 GeneID:224840 MGI:1923239
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells-like 4 transcript_id : NM_001033922.1

name	Treml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133908635 GeneID:328833 MGI:2147038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells-like 2 transcript_id : NM_001033405.2

name	B430306N03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802088 GeneID:320148 MGI:2443478
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B430306N03 gene transcript_id : NM_177083.3

name	Trem2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981415 GeneID:83433 MGI:1913150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells 2 transcript_id : NM_031254.2

name	Treml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037246 GeneID:71326 MGI:1918576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : triggering receptor expressed on myeloid cells-like 1 transcript_id : NM_027763.1

name	Nfya (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754847 GeneID:18044 MGI:97316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear transcription factor-Y alpha transcript_id : NM_010913.1

name	AI314976 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382757 GeneID:106821 MGI:2146818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI314976 transcript_id : NM_207219.3

name	Apobec2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803136 GeneID:11811 MGI:1343178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein B editing complex 2 transcript_id : NM_009694.2

name	Bzrpl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368798 GeneID:70026 MGI:1917276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : benzodiazapine receptor, peripheral-like 1 transcript_id : NM_027292.2

name	Unc5cl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301485 GeneID:76589 MGI:1923839
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-5 homolog C (C. elegans)-like transcript_id : NM_152823.3

name	Pex6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703962 CCDS:CCDS28837.1 GeneID:224824 MGI:2385054
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : peroxisomal biogenesis factor 6 protein_id : NP_663463.1

name	Gnmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754026 CCDS:CCDS28838.1 GeneID:14711 MGI:1202304
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : glycine N methyl transferase product : glycine N-methyltransferase protein_id : NP_034451.1

name	Tnrc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312510 CCDS:CCDS28839.1 GeneID:72029 MGI:1919279
definition	codon_start : 1 product : trinucleotide repeat containing 5 protein_id : NP_082341.1

name	Ptcra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755216 CCDS:CCDS28840.1 GeneID:19208 MGI:104857
definition	codon_start : 1 product : pre T-cell antigen receptor alpha protein_id : NP_035325.1

name	2310039H08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385462 CCDS:CCDS28841.1 GeneID:67101 MGI:1914351
definition	codon_start : 1 product : hypothetical protein LOC67101 protein_id : NP_080242.1

name	Rpl7l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754134 CCDS:CCDS28842.1 GeneID:66229 MGI:1913479
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L7-like 1 protein_id : NP_079709.2

name	BC032203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268860 GeneID:210982 MGI:2673855
definition	codon_start : 1 product : similar to Uncharacterized protein KIAA0240 protein_id : XP_001001238.2

name	Tbcc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87044901 CCDS:CCDS28843.1 GeneID:72726 MGI:1919976
definition	codon_start : 1 product : tubulin-specific chaperone c protein_id : NP_848472.2

name	Prph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110699 CCDS:CCDS28844.1 GeneID:19133 MGI:102791
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : retinal degeneration slow; retinal degeneration 2 product : retinal degeneration, slow (retinitis pigmentosa 7) protein_id : NP_032964.1

name	Ubr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58615693 CCDS:CCDS28845.1 GeneID:224826 MGI:1861099
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000151 - ubiquitin ligase complex [Evidence IGI] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IGI]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IGI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007141 - male meiosis I [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006512 - ubiquitin cycle [Evidence IGI]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IDA] codon_start : 1 note : ubiquitin ligase E3 alpha-II product : ubiquitin protein ligase E3 component n-recognin 2 protein_id : NP_666190.2

name	LOC100043385 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268727 GeneID:100043385
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480128.1

name	EG240110 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20900391 GeneID:240110 MGI:3647512
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_140042.1

name	Trerf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369896 GeneID:224829 MGI:2442086
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : transcriptional regulating protein 132 product : transcriptional regulating factor 1 protein_id : NP_766210.1

name	Mrps10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147049 CCDS:CCDS28846.1 GeneID:64657 MGI:1928139
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial ribosomal protein S10 protein_id : NP_898909.1

name	Guca1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122571 CCDS:CCDS28847.1 GeneID:107477 MGI:1194489
definition	GO_function : GO:0008048 - calcium sensitive guanylate cyclase activator activity [Evidence IDA]; GO:0030249 - guanylate cyclase regulator activity [Evidence IGI] GO_process : GO:0007602 - phototransduction [Evidence IMP]; GO:0031282 - regulation of guanylate cyclase activity [Evidence IGI]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : GCAP2 (retina) product : guanylate cyclase activator 1B protein_id : NP_666191.1

name	Guca1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254633 CCDS:CCDS28848.1 GeneID:14913 MGI:102770
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008048 - calcium sensitive guanylate cyclase activator activity [Evidence IDA]; GO:0030249 - guanylate cyclase regulator activity [Evidence IGI] GO_process : GO:0007602 - phototransduction [Evidence IMP]; GO:0031282 - regulation of guanylate cyclase activity [Evidence IGI]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 product : guanylate cyclase activator 1a (retina) protein_id : NP_032215.2

name	EG545208 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268864 GeneID:545208 MGI:3648910
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619467.2

name	1700001C19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037411 CCDS:CCDS28849.1 GeneID:75462 MGI:1922712
definition	codon_start : 1 product : hypothetical protein LOC75462 protein_id : NP_083572.1

name	AI661453 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703964 GeneID:224833 MGI:2146908
definition	codon_start : 1 product : hypothetical protein LOC224833 protein_id : NP_663464.1

name	Tbn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528498 GeneID:63856 MGI:1926879
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0045598 - regulation of fat cell differentiation [Evidence ISS] codon_start : 1 product : TBP-associated factor 8 protein_id : NP_071298.1

name	Ccnd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126012504 GeneID:12445 MGI:88315
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 product : cyclin D3 protein_id : NP_001075104.1

name	Ccnd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126012533 GeneID:12445 MGI:88315
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 product : cyclin D3 protein_id : NP_001075105.1

name	Ccnd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6724313 CCDS:CCDS28850.1 GeneID:12445 MGI:88315
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004693 - cyclin-dependent protein kinase activity [Evidence IDA]; GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA]; GO:0042098 - T cell proliferation [Evidence IMP] codon_start : 1 product : cyclin D3 protein_id : NP_031658.1

name	Bysl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560591 GeneID:53414 MGI:1858419
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA] codon_start : 1 product : bystin-like protein_id : NP_058555.2

name	Trfp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910590 CCDS:CCDS28851.1 GeneID:56771 MGI:1929648
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA]; GO:0016592 - Srb-mediator complex [Evidence ISS] GO_function : GO:0003899 - DNA-directed RNA polymerase activity [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence ISS] [Evidence IEA] codon_start : 1 note : ubiquitin specific protease 49 product : Trf-proximal protein homolog protein_id : NP_064432.1

name	Usp49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259220 CCDS:CCDS28852.1 GeneID:224836 MGI:2685391
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin specific protease 49 product : ubiquitin specific protease 49 homolog protein_id : NP_940813.1

name	1110002E23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384732 GeneID:66119 MGI:1913369
definition	codon_start : 1 product : hypothetical protein LOC66119 protein_id : NP_079641.1

name	Frs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450353 CCDS:CCDS28854.1 GeneID:107971 MGI:2135965
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : suc1-associated neurotrophic factor target 2 (FGFR signalling adaptor) product : fibroblast growth factor receptor substrate 3 protein_id : NP_659188.1

name	Pgc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244579 CCDS:CCDS28855.1 GeneID:109820 MGI:98909
definition	EC_number : 3.4.23.3 GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0007586 - digestion [Evidence IEA] codon_start : 1 note : urinary pepsinogen 1 product : progastricsin (pepsinogen C) protein_id : NP_080249.2

name	Tcfeb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538819 CCDS:CCDS28856.1 GeneID:21425 MGI:103270
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : transcription factor EB protein_id : NP_035679.2

name	Mdfi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754666 GeneID:17240 MGI:107687
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 product : MyoD family inhibitor protein_id : NP_034913.1

name	Foxp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630275 GeneID:74123 MGI:1921373
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0048617 - embryonic foregut morphogenesis [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : fork head-related protein like A product : winged-helix repressor FOXP4 protein_id : NP_083043.1

name	1700122O11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268729 GeneID:76651 MGI:1923901
definition	codon_start : 1 product : hypothetical protein LOC76651 protein_id : XP_001480169.1

name	1700067P10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126722640 CCDS:CCDS28857.1 GeneID:68224 MGI:1915474
definition	codon_start : 1 product : hypothetical protein LOC68224 protein_id : NP_080901.2

name	9830107B12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244382 GeneID:328829 MGI:3608415
definition	codon_start : 1 product : hypothetical protein LOC328829 protein_id : NP_808492.1

name	A530064D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559837 CCDS:CCDS28859.1 GeneID:328830 MGI:2443476
definition	codon_start : 1 product : hypothetical protein LOC328830 protein_id : NP_848911.2

name	Trem1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946760 CCDS:CCDS28860.1 GeneID:58217 MGI:1930005
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : triggering receptor expressed in monocytes 1 product : triggering receptor expressed on myeloid cells 1 protein_id : NP_067381.1

name	Trem3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946762 CCDS:CCDS28861.1 GeneID:58218 MGI:1930003
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : triggering receptor expressed on monocytes 3 product : triggering receptor expressed on myeloid cells 3 protein_id : NP_067382.1

name	Treml4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369890 CCDS:CCDS28862.1 GeneID:224840 MGI:1923239
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; IG-like domain containing protein IDCP1c product : triggering receptor expressed on myeloid cells-like 4 isoform 2 protein_id : NP_766211.1

name	Treml4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76677893 GeneID:224840 MGI:1923239
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; IG-like domain containing protein IDCP1c product : triggering receptor expressed on myeloid cells-like 4 isoform 1 protein_id : NP_001029094.1

name	Treml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133908636 GeneID:328833 MGI:2147038
definition	codon_start : 1 note : trem-like transcript 2 product : triggering receptor expressed on myeloid cells-like 2 protein_id : NP_001028577.2

name	B430306N03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893001 CCDS:CCDS28864.1 GeneID:320148 MGI:2443478
definition	codon_start : 1 product : hypothetical protein LOC320148 protein_id : NP_796057.1

name	Trem2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994125 CCDS:CCDS28865.1 GeneID:83433 MGI:1913150
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence ISS] codon_start : 1 note : triggering receptor expressed on myeloid cells 2c; triggering receptor expressed on myeloid cells 2a; triggering receptor expressed on myeloid cells 2b product : triggering receptor expressed on myeloid cells 2 protein_id : NP_112544.1

name	Treml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037247 CCDS:CCDS28866.1 GeneID:71326 MGI:1918576
definition	GO_component : GO:0009986 - cell surface [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence TAS] GO_process : GO:0009968 - negative regulation of signal transduction [Evidence TAS] codon_start : 1 product : triggering receptor expressed on myeloid cells-like 1 protein_id : NP_082039.1

name	Nfya (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754848 CCDS:CCDS28867.1 GeneID:18044 MGI:97316
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nuclear transcription factor-Y alpha protein_id : NP_035043.1

name	AI314976 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625732 GeneID:106821 MGI:2146818
definition	codon_start : 1 product : hypothetical protein LOC106821 protein_id : NP_997102.2

name	Apobec2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753098 CCDS:CCDS28868.1 GeneID:11811 MGI:1343178
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016814 - hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003969 - RNA editase activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006381 - mRNA editing [Evidence IMP]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 product : apolipoprotein B editing complex 2 protein_id : NP_033824.1

name	Bzrpl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229096 CCDS:CCDS28869.1 GeneID:70026 MGI:1917276
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : benzodiazapine receptor, peripheral-like 1 protein_id : NP_081568.1

name	Unc5cl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65301486 CCDS:CCDS28870.1 GeneID:76589 MGI:1923839
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ZU5 and death domain-containing inhibitor of NF-kB product : unc-5 homolog C (C. elegans)-like protein_id : NP_690036.3

name	LOC100043405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043405
definition	number : 3 pseudo : _no_value

name	LOC100043405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043405
definition	number : 2 pseudo : _no_value

name	LOC100043405 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043405
definition	number : 1 pseudo : _no_value

name	LOC383250 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383250
definition	number : 1 pseudo : _no_value

name	LOC100043419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043419
definition	number : 1 pseudo : _no_value

name	LOC100043419 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043419
definition	number : 2 pseudo : _no_value

name	A330017A19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268861 GeneID:442840 MGI:3045380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs product : RIKEN cDNA A330017A19 gene transcript_id : XR_035471.1

name	LOC668463 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268865 GeneID:668463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 15 Proteins product : similar to Chain C, Mouse Importin Alpha- Phosphorylated Sv40 Cn Peptide Complex pseudo : _no_value transcript_id : XR_034991.1

clone name	MSMg01-319P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354M01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-130N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-541P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281J05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-371L23.T7 (MSMg01no371_l23.b1)	MSMg01-371L23.TJ (MSMg01no371_l23.g1)
ACC	AG478178	AG478179
length	784	665
length of high quality (start - end)	321 (78 - 398)	---
definition	CHROMAT_FILE: MSMg01no371_l23.b1 PHD_FILE: MSMg01no371_l23.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:10:18 2005	CHROMAT_FILE: MSMg01no371_l23.g1 PHD_FILE: MSMg01no371_l23.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:10:18 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	NNNCCGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXTATTGGATCACACACCTACTTCT GGACCCATCTGCTGCGGCCAGCAGCTTGGAACCTACTAGATCCTGGCTAT TCCCTCAGGAGACACCTTGAAGAGGGTGGACAGGAACACTCGGTTGTAAG TCCTCAGGAGAAGTAAGACCCTGGGAGGAGCAGGGTGTTTTGGGGTCAAG ACGATAAATGTTCACATTTCTGTGGTGGCCCCCACGGGCCCTGCATCCAT CTTCATCCTCCTCTCTCTTCGTGCATTTGAAAGACTGTCGCATGTCTTAC CATTACGTTCTTTGGAAACCAGTGTCTACTGTCTATCTGCTCTTTGGGCC TGACAAGCCACTTGCTTTCTGAGCCCCAGATAAAATGAGATGAGGAAACT CTGCAGTGTAGCCACCTAATCCCGCGAAACCCCCATTACGGAGGACGAGA AAGGCTGAAAAATTTTAAGCACGGGTTAATGGTAAAGGTCTGGGGGGGGA AAATCTTAAAGCCAGGGTTTGGTGGGGCTGGTTAGTGGGTTTTAAAGAGG GTTGGGAAGTGTGTCTCTCCCGTTAGTGGTTAGGGATTGATTAGCGCTCT GGCTTGGAGCCGGGGACCTGTCCTTACTCGGGCGGTGTGCGTGTCCGGTG TGGGGTTGCTTAGGGGGTGTGGGTTCTTGTTCCTTTTTTTGNAGTGTTAT GCGTTTCCGTCGTTCTCTCCTTTTTCTTCATGTA	TCCCCAAAAAGCGACCCAAACACCACAACGTAACCAACCCGGAAACACTC AGTAACCACCTGACCTTCGAACCAGAAACCCCTGCTGGGATAAAGGCATG CCTGGCGAGTGTTTTTGTGTTTGATAGATTATCAAATGAAAACACACAAA AACAACCCAACAACACCAAAACCCCAACACACCCCACACCCCCACACCCA CACACAAAAAACAAACACCCCCCAAAACACCAAAACACACAACCAAACCA CAAAACACAAAAACAAAAAACAAAACCCACAACCCCAAAAAAACAAAAAA AAAAAAAAATAAAAAAACAACAACACCCCAACCACCAAAACACCACCAAA CAACACCACACAACCACACAAAACACAACCAAACCCCCCCACACACCCCA ACCAACAAGAAAAACAAAAACAACCAAANACAAAAACAACACCCAACCCA CACCACAAAAAACAAAACAAAAAAACCACAAACAAAAAAACAAAACAAAA ACAAAAAAACCAACAACCAACAAACAACCCAAAACCCCCCCCCCCAAAAA AACCAAACACCAACAAAACCACATAAAAAAAGACAACCACAACACACAAC AATCAAAAAAAAAANAAAAAAAAACNACAACCACAAAAAAAACAAACACA AAAAAACAACAAAAC
quality values	Open. Hide. 0 0 0 3 6 6 10 10 10 8 7 8 7 7 9 9 15 18 32 31 32 43 36 36 28 30 25 21 21 25 39 32 29 23 23 23 16 25 17 17 10 10 10 18 21 44 53 53 48 39 39 47 42 42 47 47 57 53 50 50 50 53 26 29 24 24 29 40 42 57 54 41 42 41 41 50 50 57 68 68 68 68 68 68 68 57 54 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 57 57 57 57 57 57 50 57 57 57 57 57 57 57 57 57 57 57 57 68 57 57 57 57 57 57 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 57 68 68 68 57 57 59 59 57 57 57 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 39 37 57 57 57 57 59 59 59 68 68 68 57 57 57 57 57 57 57 57 57 57 57 68 57 59 54 59 59 57 32 32 41 48 48 48 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 59 57 57 54 57 57 57 57 68 68 57 57 54 48 48 48 44 42 37 37 37 48 43 54 54 57 57 54 54 54 57 57 57 59 57 57 57 54 47 48 48 48 68 68 48 54 48 48 43 43 37 39 35 36 36 43 39 43 43 26 15 9 9 9 19 19 43 39 40 40 41 33 22 21 17 15 17 18 30 24 23 10 11 11 22 22 31 28 22 22 12 12 9 8 8 22 13 20 16 22 13 16 16 26 23 19 17 12 13 15 13 8 8 8 8 8 14 21 22 28 24 22 22 29 20 19 9 9 9 14 16 18 11 11 9 10 8 8 8 13 12 8 6 6 7 6 10 10 15 14 9 9 9 14 13 10 8 8 8 8 12 14 12 12 13 11 12 9 9 9 9 13 13 13 11 10 10 10 8 8 8 8 6 6 6 6 8 10 11 12 12 14 17 13 11 10 11 12 8 8 8 8 8 8 13 13 8 9 13 14 9 9 10 13 10 10 8 8 8 8 8 8 8 15 13 10 9 9 10 10 10 6 6 6 8 6 6 8 8 8 8 8 8 10 10 8 8 8 10 10 9 9 9 8 8 8 8 8 8 8 8 8 6 8 6 6 8 8 9 12 10 10 6 6 6 6 8 8 12 10 10 8 8 10 8 10 11 8 6 6 6 6 8 9 9 11 11 8 8 8 8 10 10 8 8 8 10 10 12 8 8 8 8 8 10 10 9 9 9 9 9 8 8 8 8 8 8 8 8 10 6 6 8 8 10 9 8 6 8 6 6 8 8 12 12 10 9 9 10 9 9 8 8 8 8 8 8 8 8 8 9 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 10 9 9 11 11 11 10 11 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 9 8 8 10 8 10 10 13 10 9 9 9 11 14 10 9 3 0 3 6 6 6 8 6 10 10 10 10 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 10 8 10 9 9 9 11 8 8 8 8 8 8	Open. Hide. 9 9 9 9 9 12 10 10 9 8 8 8 8 6 8 8 10 8 8 8 8 6 6 6 6 8 13 9 8 6 6 6 6 6 6 7 7 14 19 9 19 17 8 8 8 8 15 10 10 6 6 8 15 15 21 21 13 8 8 15 19 19 11 15 9 10 9 14 16 9 17 15 15 8 8 17 12 9 16 22 22 20 20 40 30 28 18 19 9 9 10 10 21 25 36 22 18 16 16 22 29 23 21 12 12 10 19 19 21 21 15 15 14 18 10 10 9 11 10 10 10 9 8 8 8 8 8 9 10 10 10 10 10 10 10 10 11 8 8 6 6 6 6 8 8 8 6 6 8 8 8 8 8 8 6 6 8 8 9 10 11 10 8 10 8 8 8 10 8 8 6 6 8 8 8 8 8 8 8 8 6 6 8 8 7 6 8 8 11 11 8 8 6 6 8 8 10 9 9 9 8 8 6 6 8 8 8 8 8 8 6 7 8 8 8 8 8 7 8 8 9 10 10 10 10 8 8 7 7 8 8 8 8 8 8 8 10 10 10 10 9 10 9 9 9 9 11 9 8 8 8 8 8 8 6 6 7 6 8 8 8 8 8 8 8 8 8 10 8 8 10 8 8 9 9 9 9 9 9 8 8 6 6 8 8 9 9 12 12 10 8 6 6 6 8 8 10 8 8 8 10 10 11 9 10 9 9 9 8 8 8 8 8 8 10 11 9 9 9 10 10 9 8 8 10 10 10 12 8 8 8 8 6 6 8 8 9 8 10 8 8 6 6 8 8 9 9 9 9 9 9 8 8 6 6 8 8 8 8 10 11 11 10 12 11 11 11 11 9 9 9 9 8 8 8 8 8 8 10 10 10 10 10 10 8 8 8 8 8 8 8 8 6 6 8 8 10 10 9 9 9 9 9 9 10 8 8 7 7 8 10 10 8 10 6 7 10 8 8 8 9 8 8 8 8 8 8 3 0 3 8 8 8 8 8 6 6 8 6 6 8 8 10 7 7 8 8 9 9 9 9 9 9 9 9 8 8 10 8 8 10 11 11 11 13 11 11 11 9 9 9 12 10 10 10 10 10 12 8 8 8 8 8 8 8 8 9 10 8 8 8 8 8 9 9 9 9 9 10 9 9 9 9 9 9 9 9 9 8 8 8 8 8 8 8 8 8 8 8 10 9 9 8 8 8 8 8 8 11 10 10 9 9 10 10 10 10 9 10 8 8 8 8 8 10 12 14 15 13 9 9 6 6 6 6 8 8 12 12 10 8 8 11 10 10 8 9 10 10 10 10 8 8 7 7 8 9 8 8 8 9 6 8 6 6 8 8 9 11 8 8 8 10 10 6 6 6 7 8 8 8 8 9 9 9 10 10 10 13 10 10 10 10 3 0 3 12 16 16 13 13 11 11 9 3 0 3 6 6 8 8 8 8 8 8 8 8 8 8 10 12 9 9 9 9 9 10 11 11 11 15 12 13 13 10 10 10 10 10 10 10 10 10 10 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no371_l23.b1 MSMg01no371_l23.b1 CHROMAT_FILE:
MSMg01no371_l23.b1 PHD_FILE: MSMg01no371_l23.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:10:18 2005
         (321 letters)



>mm_chr17_47856277_47856999
          Length = 723

 Score =  580 bits (300), Expect = e-170
 Identities = 316/322 (98%), Gaps = 2/322 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   tattggatcacacacctacttctggacccatctgctgcggccagcagcttggaacctact 60
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 522 tattggatcacacacctactcctggacccatctgctgcggccagcagcttggaacctact 463

                                                                       
Query: 61  agatcctggctattccctcaggagacaccttgaagagggtggacaggaacactcggttgt 120
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 462 agatcctggctattccctcaggagacaccttgaagagggtggacaggaacactcagttgt 403

                                                                       
Query: 121 aagtcctcaggagaagtaagaccctgggaggagcagggtgttttggggtcaagac--gat 178
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||
Sbjct: 402 aagtcctcaggagaagtaagaccctgggaggagcagggtgttttggggtcaagacttgat 343

                                                                       
Query: 179 aaatgttcacatttctgtggtggcccccacgggccctgcatccatcttcatcctcctctc 238
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 342 aaatgttcacatttctgtggtggtccccacgggccctgcatccatcttcatcctcctctc 283

                                                                       
Query: 239 tcttcgtgcatttgaaagactgtcgcatgtcttaccattacgttctttggaaaccagtgt 298
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 282 tcttcgtgcatttgaaagactgtcgcatgtcttaccattacgttctttggaaaccagtgt 223

                                 
Query: 299 ctactgtctatctgctctttgg 320
           |||||||||||||| |||||||
Sbjct: 222 ctactgtctatctgttctttgg 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 321
Length of database: 723
Length adjustment: 9
Effective length of query: 312
Effective length of database: 714
Effective search space:   222768
Effective search space used:   222768
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information