MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-392I01
Chromosome	17 (Build37)
Map Location	32,537,354 - 32,537,613
singlet/doublet	singlet
Overlap gene	A430107D22Rik
Upstream gene	Pde9a, Wdr4, 1500032D16Rik, Pknox1, Cbs, LOC623242, U2af1, Cryaa, Snf1lk, Hsf2bp, Rrp1b, LOC435518, Notch3, Pdxk-ps, Abhd9, Brd4, LOC100043434, LOC100043433, Akap8, Akap8l, Wiz
Downstream gene	Pglyrp2, 4732474A20Rik, EG208285, Cyp4f16, LOC667178, LOC677156, EG631304, Cyp4f15, LOC623809, 9030612M13Rik, Zfp811, 6030490I01Rik, LOC631266, BC066107, Cyp4f14, Cyp4f13, 6030422M01Rik, Zfp472, C920016K16Rik, 1700065O13Rik, 4921501E09Rik, Zfp563, Morc2b, LOC100038859, LOC100038860, LOC100043474, Zfp422-rs1, Olfr63, LOC100043468, Zfp81, Zfp101
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pde9a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18585 MGI:1277179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57773 MGI:1889002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500032D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78330 MGI:1925580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pknox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18771 MGI:1201409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12411 MGI:88285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC623242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1398 ESTs, 8 Proteins pseudo : _no_value

name	U2af1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108121 MGI:98884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cryaa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12954 MGI:88515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snf1lk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17691 MGI:104754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsf2bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74377 MGI:1921627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 32 ESTs, 1 Protein

name	Rrp1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72462 MGI:1919712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435518 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Notch3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18131 MGI:99460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdxk-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140553 MGI:1933201
definition	note : pyridoxal (pyridoxine, vitamin B6) kinase, pseudogene pseudo : _no_value

name	Abhd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71932 MGI:1919182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57261 MGI:1888520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043434 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	LOC100043433 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Akap8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56399 MGI:1928488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akap8l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54194 MGI:1860606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wiz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22404 MGI:1332638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	A430107D22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320484 MGI:2444128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pglyrp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57757 MGI:1928099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732474A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320997 MGI:2445210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG208285 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208285 MGI:3646233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 24 Proteins

name	Cyp4f16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70101 MGI:1917351
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667178 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC677156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 41 Proteins

name	EG631304 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631304 MGI:3645508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	Cyp4f15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106648 MGI:2146921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623809 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	9030612M13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208292 MGI:1921793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp811 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240063 MGI:2682944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030490I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240064 MGI:2443934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631266 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 10 Proteins pseudo : _no_value

name	BC066107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240066 MGI:3029586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4f14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64385 MGI:1927669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp4f13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170716 MGI:2158641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030422M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77875 MGI:1925125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Zfp472 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224691 MGI:2385049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C920016K16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240067 MGI:2441928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700065O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73451 MGI:1920701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921501E09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74042 MGI:1921292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp563 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240068 MGI:2677168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morc2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240069 MGI:3045293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038860 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1110 Proteins

name	Zfp422-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77652 MGI:3028594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 108 ESTs

name	Olfr63 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258939 MGI:1335096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043468 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs

name	Zfp81 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224694 MGI:1890752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22643 MGI:107547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pde9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802966 GeneID:18585 MGI:1277179
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 9A transcript_id : NM_008804.3

name	Wdr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946627 GeneID:57773 MGI:1889002
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 4 transcript_id : NM_021322.1

name	1500032D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140972308 GeneID:78330 MGI:1925580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500032D16 gene transcript_id : NM_030087.2

name	1500032D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140969945 GeneID:78330 MGI:1925580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500032D16 gene transcript_id : NM_001083891.1

name	Pknox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34368579 GeneID:18771 MGI:1201409
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Pbx/knotted 1 homeobox transcript_id : NM_016670.2

name	Cbs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130062 GeneID:12411 MGI:88285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystathionine beta-synthase transcript_id : NM_144855.2

name	Cbs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130577 GeneID:12411 MGI:88285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystathionine beta-synthase transcript_id : NM_178224.2

name	U2af1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353372 GeneID:108121 MGI:98884
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 transcript_id : NM_024187.3

name	Cryaa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931666 GeneID:12954 MGI:88515
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, alpha A transcript_id : NM_013501.2

name	Snf1lk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815829 GeneID:17691 MGI:104754
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNF1-like kinase transcript_id : NM_010831.2

name	Hsf2bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268656 GeneID:74377 MGI:1921627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 32 ESTs, 1 Protein product : heat shock transcription factor 2 binding protein transcript_id : XM_484622.4

name	Rrp1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076996 GeneID:72462 MGI:1919712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal RNA processing 1 homolog B (S. cerevisiae) transcript_id : NM_028244.1

name	Notch3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130663 GeneID:18131 MGI:99460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Notch gene homolog 3 (Drosophila) transcript_id : NM_008716.2

name	Abhd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369966 GeneID:71932 MGI:1919182
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 9 transcript_id : NM_001033163.2

name	Brd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560787 GeneID:57261 MGI:1888520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 4 transcript_id : NM_020508.2

name	Brd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674286 GeneID:57261 MGI:1888520
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 4 transcript_id : NM_198094.1

name	LOC100043433 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268731 GeneID:100043433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043433 transcript_id : XM_001480478.1

name	Akap8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801979 GeneID:56399 MGI:1928488
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 8 transcript_id : NM_019774.3

name	Akap8l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70780372 GeneID:54194 MGI:1860606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 8-like transcript_id : NM_017476.2

name	Wiz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909564 GeneID:22404 MGI:1332638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : widely-interspaced zinc finger motifs transcript_id : NM_212438.1

name	Wiz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909562 GeneID:22404 MGI:1332638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : widely-interspaced zinc finger motifs transcript_id : NM_011717.2

name	A430107D22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130502227 GeneID:320484 MGI:2444128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430107D22 gene transcript_id : NM_178785.3

name	Pglyrp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476059 GeneID:57757 MGI:1928099
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 2 transcript_id : NM_021319.2

name	4732474A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361891 GeneID:320997 MGI:2445210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732474A20 gene transcript_id : NM_177307.3

name	EG208285 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268657 GeneID:208285 MGI:3646233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 24 Proteins product : predicted gene, EG208285 transcript_id : XM_139863.7

name	Cyp4f16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13277361 GeneID:70101 MGI:1917351
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 16 transcript_id : NM_024442.1

name	LOC677156 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268738 GeneID:677156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 41 Proteins product : similar to cytochrome P450, family 4, subfamily f, polypeptide 16 transcript_id : XM_001480532.1

name	EG631304 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401873 GeneID:631304 MGI:3645508
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : predicted gene, EG631304 transcript_id : XM_988992.1

name	Cyp4f15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373164 GeneID:106648 MGI:2146921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 15 transcript_id : NM_134127.1

name	9030612M13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140969611 GeneID:208292 MGI:1921793
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030612M13 gene transcript_id : NM_172458.3

name	Zfp811 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147227 GeneID:240063 MGI:2682944
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 811 transcript_id : NM_183177.1

name	6030490I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793417 GeneID:240064 MGI:2443934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030490I01 gene transcript_id : NM_177359.3

name	BC066107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402246 GeneID:240066 MGI:3029586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC066107 transcript_id : NM_207245.1

name	Cyp4f14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11967964 GeneID:64385 MGI:1927669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 14 transcript_id : NM_022434.1

name	Cyp4f13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20373154 GeneID:170716 MGI:2158641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 13 transcript_id : NM_130882.1

name	6030422M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401875 GeneID:77875 MGI:1925125
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 6030422M01 gene transcript_id : XM_128564.4

name	Zfp472 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377185 GeneID:224691 MGI:2385049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 472 transcript_id : NM_153063.2

name	C920016K16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930751 GeneID:240067 MGI:2441928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C920016K16 gene transcript_id : NM_001045559.1

name	1700065O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802452 GeneID:73451 MGI:1920701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700065O13 gene transcript_id : NM_028543.2

name	4921501E09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222273 GeneID:74042 MGI:1921292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921501E09 gene transcript_id : NM_001009544.1

name	Zfp563 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930757 GeneID:240068 MGI:2677168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 563 transcript_id : NM_001024950.2

name	Morc2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354229 GeneID:240069 MGI:3045293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microrchidia 2B transcript_id : NM_177719.3

name	LOC100038859 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268461 GeneID:100038859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038859 transcript_id : XM_001471659.1

name	LOC100038860 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268463 GeneID:100038860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038860 transcript_id : XM_001471916.1

name	LOC100043474 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268754 GeneID:100043474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1110 Proteins product : similar to olfactory receptor Olr1092 transcript_id : XM_001480594.1

name	Zfp422-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268744 GeneID:77652 MGI:3028594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 108 ESTs product : zinc finger protein 422, related sequence 1 transcript_id : XM_001480577.1

name	Olfr63 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128642 GeneID:258939 MGI:1335096
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 63 transcript_id : NM_146937.1

name	LOC100043468 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268748 GeneID:100043468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 175 ESTs product : similar to Zinc finger protein 422, related sequence 1 transcript_id : XM_001480580.1

name	Zfp81 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432559 GeneID:224694 MGI:1890752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 81 transcript_id : NM_207541.1

name	Zfp101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119120796 GeneID:22643 MGI:107547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 101 transcript_id : NM_009542.2

name	Pde9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982131 CCDS:CCDS28605.1 GeneID:18585 MGI:1277179
definition	GO_function : GO:0047555 - 3',5'-cyclic-GMP phosphodiesterase activity [Evidence IDA]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphodiesterase 9A protein_id : NP_032830.2

name	Wdr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946628 CCDS:CCDS28606.1 GeneID:57773 MGI:1889002
definition	GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation note : WD40 repeat protein 4 product : WD repeat domain 4 protein_id : NP_067297.1

name	1500032D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140972309 GeneID:78330 MGI:1925580
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; NADH-ubiquinone oxidoreductase flavoprotein 3 product : NADH-ubiquinone oxidoreductase flavoprotein 3 isoform 1 protein_id : NP_084363.2

name	1500032D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140969946 GeneID:78330 MGI:1925580
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; NADH-ubiquinone oxidoreductase flavoprotein 3 product : NADH-ubiquinone oxidoreductase flavoprotein 3 isoform 2 protein_id : NP_001077360.1

name	Pknox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34368580 CCDS:CCDS28608.1 GeneID:18771 MGI:1201409
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Pbx/knotted 1 homeobox protein_id : NP_057879.2

name	Cbs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089694 CCDS:CCDS28610.1 GeneID:12411 MGI:88285
definition	EC_number : 4.2.1.22 GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004122 - cystathionine beta-synthase activity [Evidence IEA] GO_process : GO:0019343 - cysteine biosynthesis via cystathione [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : cystathionine beta-synthase isoform 2 protein_id : NP_835742.1

name	Cbs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450071 CCDS:CCDS28609.1 GeneID:12411 MGI:88285
definition	EC_number : 4.2.1.22 GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004122 - cystathionine beta-synthase activity [Evidence IEA] GO_process : GO:0019343 - cysteine biosynthesis via cystathione [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cystathionine beta-synthase isoform 1 protein_id : NP_659104.1

name	U2af1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17530980 CCDS:CCDS28611.1 GeneID:108121 MGI:98884
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 exception : mismatches in translation note : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF),35 kDa product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1 protein_id : NP_077149.1

name	Cryaa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794510 GeneID:12954 MGI:88515
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005212 - structural constituent of eye lens [Evidence TAS] GO_process : GO:0001747 - eye development (sensu Mammalia) [Evidence IGI]; GO:0000072 - M phase specific microtubule process [Evidence IMP]; GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 note : lens opacity 18; crystallin, alpha 1; alpha-A-crystallin product : crystallin, alpha A protein_id : NP_038529.1

name	Snf1lk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815830 GeneID:17691 MGI:104754
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IDA] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0045595 - regulation of cell differentiation [Evidence IEP]; GO:0007346 - regulation of progression through mitotic cell cycle [Evidence IDA] codon_start : 1 note : SNF1-like kinase (MGD\|MGI:104754 GB\|NM_010831, evidence: BLASTN, 98%, match=4488); putative; myocardial SNF1-like kinase; salt inducible kinase product : SNF1-like kinase protein_id : NP_034961.2

name	Hsf2bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401867 GeneID:74377 MGI:1921627
definition	codon_start : 1 product : heat shock transcription factor 2 binding protein protein_id : XP_484622.3

name	Rrp1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076997 CCDS:CCDS28613.1 GeneID:72462 MGI:1919712
definition	GO_component : GO:0030688 - nucleolar preribosome, small subunit precursor [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0004784 - superoxide dismutase activity [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA]; GO:0006801 - superoxide metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ribosomal RNA processing 1 homolog B protein_id : NP_082520.1

name	Notch3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679096 CCDS:CCDS28614.1 GeneID:18131 MGI:99460
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IGI]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0045665 - negative regulation of neuron differentiation [Evidence IMP]; GO:0048663 - neuron fate commitment [Evidence IGI]; GO:0007219 - Notch signaling pathway [Evidence IEA] [Evidence IC]; GO:0050793 - regulation of development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Notch gene homolog 3 protein_id : NP_032742.1

name	Abhd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83716015 CCDS:CCDS28615.1 GeneID:71932 MGI:1919182
definition	codon_start : 1 product : abhydrolase domain containing 9 protein_id : NP_001028335.1

name	Brd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560788 GeneID:57261 MGI:1888520
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0043388 - positive regulation of DNA binding [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; bromodomain-containing 5; fsh-like protein product : bromodomain containing 4 isoform 1 protein_id : NP_065254.2

name	Brd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674287 GeneID:57261 MGI:1888520
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0043388 - positive regulation of DNA binding [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; bromodomain-containing 5; fsh-like protein product : bromodomain containing 4 isoform 2 protein_id : NP_932762.1

name	LOC100043433 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268732 GeneID:100043433
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480528.1

name	Akap8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560394 GeneID:56399 MGI:1928488
definition	GO_component : GO:0000793 - condensed chromosome [Evidence IDA] [Evidence ISS]; GO:0001939 - female pronucleus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0000790 - nuclear chromatin [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007076 - mitotic chromosome condensation [Evidence ISS] [Evidence IDA] codon_start : 1 note : A kinase anchor protein 95 product : A kinase anchor protein 8 protein_id : NP_062748.2

name	Akap8l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70780373 GeneID:54194 MGI:1860606
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : neighbor of A-kinase anchoring protein 95 product : A kinase (PRKA) anchor protein 8-like protein_id : NP_059504.2

name	Wiz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909563 CCDS:CCDS28616.1 GeneID:22404 MGI:1332638
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : widely-interspaced zinc finger motifs isoform 2 protein_id : NP_035847.2

name	Wiz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909565 CCDS:CCDS28617.1 GeneID:22404 MGI:1332638
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : widely-interspaced zinc finger motifs isoform 1 protein_id : NP_997603.1

name	A430107D22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130502228 GeneID:320484 MGI:2444128
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320484 protein_id : NP_848900.2

name	Pglyrp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946624 GeneID:57757 MGI:1928099
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0016020 - membrane [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0016019 - peptidoglycan receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0050830 - defense response to Gram-positive bacterium [Evidence ISS]; GO:0016045 - detection of bacterium [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence ISS]; GO:0009253 - peptidoglycan catabolism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : TAG-like; peptidoglycan recognition protein-like product : peptidoglycan recognition protein 2 protein_id : NP_067294.1

name	4732474A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893407 CCDS:CCDS28618.1 GeneID:320997 MGI:2445210
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0050051 - leukotriene-B4 20-monooxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 product : cytochrome P450, family 2, subfamily E, polypeptide 2 homolog protein_id : NP_796281.1

name	EG208285 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82992694 GeneID:208285 MGI:3646233
definition	codon_start : 1 product : similar to cytochrome P450 4F6 protein_id : XP_139863.4

name	Cyp4f16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277362 CCDS:CCDS28619.1 GeneID:70101 MGI:1917351
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : cytochrome P450, 4f16 product : cytochrome P450, family 4, subfamily f, polypeptide 16 protein_id : NP_077762.1

name	LOC677156 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268739 GeneID:677156
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480582.1

name	EG631304 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401874 GeneID:631304 MGI:3645508
definition	codon_start : 1 product : similar to Cyp4f15 protein protein_id : XP_994086.1

name	Cyp4f15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373165 CCDS:CCDS28620.1 GeneID:106648 MGI:2146921
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, 4f15 product : cytochrome P450 CYP4F15 protein_id : NP_598888.1

name	9030612M13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140969612 GeneID:208292 MGI:1921793
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208292 protein_id : NP_766046.3

name	Zfp811 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147228 GeneID:240063 MGI:2682944
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 811 protein_id : NP_899000.1

name	6030490I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66793418 GeneID:240064 MGI:2443934
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein protein_id : NP_796333.2

name	BC066107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402247 GeneID:240066 MGI:3029586
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240066 protein_id : NP_997128.1

name	Cyp4f14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967965 CCDS:CCDS28621.1 GeneID:64385 MGI:1927669
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0050051 - leukotriene-B4 20-monooxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : cytochrome P450, subfamily IVF, polypeptide 14 (leukotriene B4 omega hydroxylase) product : cytochrome P450, family 4, subfamily f, polypeptide 14 protein_id : NP_071879.1

name	Cyp4f13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20373155 CCDS:CCDS28622.1 GeneID:170716 MGI:2158641
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : cytochrome P450,subfamily IVF, polypeptide 13; cytochrome P450 CYP4F13; leukotriene B4 omega hydroxylase product : cytochrome P450, family 4, subfamily f, polypeptide 13 protein_id : NP_570952.1

name	6030422M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20899446 GeneID:77875 MGI:1925125
definition	codon_start : 1 product : hypothetical protein LOC77875 protein_id : XP_128564.1

name	Zfp472 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346459 GeneID:224691 MGI:2385049
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : KRAB box containing zinc finger protein; Krab box proteins interacting with myc 1; zin finger protein 472 product : zinc finger protein 472 protein_id : NP_694703.1

name	C920016K16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930752 GeneID:240067 MGI:2441928
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC240067 protein_id : NP_001039024.1

name	1700065O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037331 GeneID:73451 MGI:1920701
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : RIKEN cDNA 1700065O13 protein_id : NP_082819.1

name	4921501E09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222274 CCDS:CCDS28624.1 GeneID:74042 MGI:1921292
definition	codon_start : 1 note : KIAA1111-like protein product : PHD finger protein 8 protein_id : NP_001009544.1

name	Zfp563 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930758 GeneID:240068 MGI:2677168
definition	codon_start : 1 note : zinc finger protein NTfin7 product : zinc finger protein ZFP413 protein_id : NP_001020121.2

name	Morc2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244180 GeneID:240069 MGI:3045293
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Morc-like protein product : microrchidia 2B protein_id : NP_808387.1

name	LOC100038859 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268462 GeneID:100038859
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471709.1

name	LOC100038860 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268464 GeneID:100038860
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471966.1

name	LOC100043474 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268755 GeneID:100043474
definition	codon_start : 1 product : similar to olfactory receptor Olr1092 protein_id : XP_001480644.1

name	Zfp422-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268745 GeneID:77652 MGI:3028594
definition	codon_start : 1 product : zinc finger protein 422, related sequence 1 protein_id : XP_001480627.1

name	Olfr63 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128643 GeneID:258939 MGI:1335096
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NTC5-9778-8828 product : olfactory receptor 63 protein_id : NP_667148.1

name	LOC100043468 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268749 GeneID:100043468
definition	codon_start : 1 product : similar to Zinc finger protein 422, related sequence 1 protein_id : XP_001480630.1

name	Zfp81 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432560 GeneID:224694 MGI:1890752
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : ZFP-36 zinc finger protein product : zinc finger protein 81 protein_id : NP_997424.1

name	Zfp101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119120797 GeneID:22643 MGI:107547
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 101 protein_id : NP_033568.2

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 11 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 10 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 9 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 8 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 7 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 6 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 5 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 4 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 3 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 2 pseudo : _no_value

name	LOC435518 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435518
definition	number : 1 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 1 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 2 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 3 pseudo : _no_value

name	LOC667178 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667178
definition	number : 4 pseudo : _no_value

name	LOC623809 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623809
definition	number : 1 pseudo : _no_value

name	LOC623242 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268730 GeneID:623242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1398 ESTs, 8 Proteins product : similar to ribosomal protein S2 pseudo : _no_value transcript_id : XR_034688.1

name	LOC100043434 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268733 GeneID:100043434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to ribosomal protein L34 pseudo : _no_value transcript_id : XR_034714.1

name	LOC631266 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268752 GeneID:631266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 568 ESTs, 10 Proteins product : similar to ribosomal protein L7 pseudo : _no_value transcript_id : XR_034756.1

clone name	MSMg01-388D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-392I01.T7 (MSMg01no392_i01.b1)	MSMg01-392I01.TJ (MSMg01no392_i01.g1)
ACC	AG494022	AG494023
length	752	762
length of high quality (start - end)	442 (92 - 533)	---
definition	CHROMAT_FILE: MSMg01no392_i01.b1 PHD_FILE: MSMg01no392_i01.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:37:02 2005	CHROMAT_FILE: MSMg01no392_i01.g1 PHD_FILE: MSMg01no392_i01.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:37:03 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CCTCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGC GGAATTCAACTCCTGGAGCCCACATAAGGGTGGAAGAACAGAACATATTC TACAGTGCTATCCTCTGACGTCTCCATGCTGTGTTCTCTCTCTCTGTCTC TGTCTCTCTCTGTCTCTCTGTCTCTCTCTGTCTCTCTCTCTCTGTCTCTC TCTGTCTCTGTCTCTCTGTCTCTGTCTCTCTCTGTCTCTGTCTCTCTCTG TCTCTCTCTGTCTCTGTCTCTCTCTGTCTCTCTTTCTGTCTCTCTGTCTC TGTCTCTCTCTCTCTCTTTGTCTCTCTATCCTCTCTCTGTCTCTCTCTCC CTCTGTCTCTGTCTCTCTCTGTCTCTCTCTCTCTCTGTCTCTCTCTCCCT CTGTCTGTCTCTCTCTAAAATAATTTCCTTAAGGTGGAAAGGATTTATTT GACAATTTGAGAATGGTATAGACAAAGTTGTAAGTCCATGGAGTTTTCCT TCTTGGGGAGGTGGTGTTGGTGGAGAGTGCCTCCNCNCCCCACCTNCTCC TTCCCCCGCCNTTTGTCCTACCCTCTGNNCTCTNTNTTTCNTTCCCCCCC TTCCCCTCCACCGCCTNTTTTTTCCCTCCTTTTTTCCCCCTTCCCTTTTC TCCTTCTCCNCCTCCCGGCTCTCTCCCCTCTCTCCCTTTTGCCCCCCCTT CTCTTTTCTTTTTTCCTTCCCGCCCCCTTTCTTCCCTTTCCCCCCCCCTC CC	AGATGTACGAAGAGGCGGANNNNCCCACATGGTCATTGTCCGGGGNNNTN CAATAGNAACATTCGCCGGGNNNNCCGCGGGNNNNNNNNNNNNNGCCCCN NCTTTCCCCCCCCCAGCCCCCGCGGGTTCCCTCCCTCCCTCTTTTGGGGT GGGGGGGGGCGCCCCCCCTCCTCCCGTTCCCTGCCCTTCCCGCTCCTCGC CCGCGTGGCTCCGGCCCGTCGCGCCCCTTTTTTTCGGTCCGCCCCGCCCA CCTCGGGCGCGCGGCCCTTTTCCCCCCCCCCCCGGCGCCCATCTTTTTTT TTTTACACGCAAGACCAGCCGTCGACCCCACCCCTTTCTTTTCCCCCTCA CGGAGAGGGGGGGGGGCGCATCTGAGGCGCTGTTGCGCCGCGCCACCGGG CCCGCGAGCGAATTACGCGACCCGCCCACCGAGCAAGTCACGTAATCCAC TTTCCACTTCCTCGCGTTTTCACATCTCCCGCCGCCCCGCGACCTCACTG TCTCCCCTTTGGTACCAACCCCATCCGCTCGATCACCTATATTCCAGGGG CAACCCCCTCTTTACCTCCCTTCATACTTGGAGTATCCATCGGTCTACCC TCTATTTACCGGTTTTGTCTGCCGTCTACCCCAACCACACAAACCCTCTG AATCATACCCCTATCTAACAACGTCCTCCCCCCACATGCAAATATCGAAC GCCAACCTGCCATTTCCCCCAACCTCCTCCACCCCTTTCAACATACCGTT GTATTTCCGCAC
quality values	Open. Hide. 8 15 8 8 6 8 8 9 13 21 29 21 23 23 18 13 12 11 13 23 25 30 23 21 15 15 19 22 23 22 21 25 17 17 8 8 7 8 8 10 15 19 16 16 16 22 22 14 12 12 11 11 13 23 22 33 23 22 22 21 32 23 18 18 11 11 12 16 16 22 30 31 35 37 26 27 24 25 25 23 23 23 23 23 23 18 18 11 11 11 18 13 28 25 33 31 28 37 37 23 18 13 23 19 28 29 39 39 47 47 48 57 40 40 30 24 21 27 23 35 36 43 42 48 54 41 41 41 48 41 41 43 43 43 48 59 57 54 54 44 44 37 35 28 32 32 57 57 57 57 47 47 47 47 47 47 50 47 47 47 47 47 50 47 50 47 57 57 57 48 57 57 57 57 57 57 57 57 57 48 57 57 57 57 68 68 68 68 68 57 59 57 57 54 54 57 57 57 68 57 57 57 57 52 57 57 57 57 57 54 54 57 57 57 57 57 57 52 57 57 57 57 57 57 57 57 68 68 68 57 57 57 57 52 57 57 57 57 57 52 57 57 57 57 68 57 57 57 57 52 57 57 57 68 68 57 57 57 57 57 59 57 62 62 62 62 62 62 62 68 68 62 62 62 62 52 62 62 62 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 59 59 68 68 68 68 68 68 68 57 57 57 57 57 57 59 59 59 68 68 68 68 68 68 68 57 57 57 57 52 57 57 59 57 59 57 59 59 57 68 68 57 57 57 57 52 57 59 59 59 68 68 68 68 68 68 68 57 57 57 57 52 57 59 59 59 68 68 68 68 68 68 68 59 59 59 59 43 57 57 57 48 48 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 59 57 57 47 54 47 34 34 16 14 13 24 13 17 17 34 32 37 37 37 43 43 57 59 59 59 24 28 11 11 11 29 27 57 40 41 28 25 25 43 40 30 30 30 32 32 36 31 25 31 31 34 34 43 48 48 48 37 41 28 28 22 31 31 31 30 21 28 23 23 23 32 34 37 36 32 32 37 37 34 26 26 23 23 23 28 32 33 39 35 35 35 39 27 32 23 21 22 14 14 14 30 23 32 23 24 12 10 11 8 3 0 3 0 3 10 10 7 8 8 13 3 0 3 8 9 13 10 8 9 9 8 8 8 8 8 3 0 3 15 11 9 9 9 12 13 17 15 10 8 8 9 9 3 0 0 3 10 8 3 0 3 0 3 8 7 3 0 3 7 7 9 9 17 19 14 12 13 20 13 12 8 9 9 10 7 6 6 6 6 9 14 3 0 3 13 9 10 9 10 9 11 14 8 8 7 8 14 19 14 16 14 9 9 9 14 6 6 8 19 13 7 6 8 8 11 10 8 8 11 8 8 8 10 10 3 0 3 9 9 9 9 9 14 15 15 9 9 8 8 8 8 8 12 17 8 8 8 8 8 15 11 8 8 8 9 9 13 10 13 20 30 22 11 6 6 8 17 10 13 22 13 15 16 8 8 7 8 10 19 17 13 14 19 16 17 10 7 6 8 8 8 14 13 18 17 12 13 12 12 10 10 13 12 9 9 7 12 11 13 19 22 22 19 14 15 19 8 7	Open. Hide. 9 9 9 9 9 9 9 11 10 10 10 10 10 10 8 6 6 6 3 0 0 0 0 3 8 6 7 7 6 6 6 6 6 6 6 6 6 7 7 7 7 7 8 17 3 0 0 0 3 0 3 9 9 7 6 3 0 3 6 7 9 6 6 6 6 6 6 9 10 3 0 0 0 0 3 13 6 6 6 7 3 0 0 0 0 0 0 0 0 0 0 0 0 0 3 10 10 10 3 0 0 3 9 11 12 15 11 9 8 8 8 8 8 8 12 10 14 10 11 9 8 8 8 8 10 8 9 9 8 13 7 9 8 13 16 14 14 15 10 12 9 9 12 9 12 10 7 6 6 6 6 9 23 27 19 18 7 7 6 6 8 10 15 11 15 15 14 12 12 9 9 8 8 8 8 8 8 9 9 9 10 11 11 11 10 8 8 8 8 12 8 8 8 8 11 9 9 9 10 8 8 8 8 6 6 8 8 8 10 10 9 11 9 9 9 9 11 10 10 10 8 6 6 8 10 15 15 15 17 22 24 21 12 12 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 8 13 12 11 11 8 12 10 8 8 6 8 6 7 8 8 8 8 11 10 8 8 8 13 13 18 22 20 20 16 13 18 16 11 9 9 7 8 8 10 9 8 8 8 8 10 11 16 24 24 24 23 15 10 9 9 9 9 8 8 6 6 6 6 8 8 8 8 6 6 8 8 8 8 8 8 8 13 7 6 6 6 7 6 6 6 8 10 12 12 13 12 14 14 12 12 10 10 9 9 14 10 10 8 10 9 9 8 11 14 16 14 12 18 14 8 10 6 6 6 6 8 8 8 8 8 8 10 10 10 8 8 8 8 8 8 11 8 10 6 6 6 6 8 8 8 10 8 12 12 12 10 10 8 8 8 8 8 8 8 10 10 10 10 11 11 9 8 8 8 6 6 10 8 11 11 13 11 10 8 8 10 8 8 8 8 8 6 6 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 12 13 13 11 13 11 10 9 9 9 10 8 8 8 8 8 8 8 8 8 8 8 9 9 10 10 8 12 11 10 6 6 6 6 8 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 10 8 8 8 10 6 7 8 8 10 10 11 11 12 12 11 11 11 10 10 10 10 10 10 11 9 8 10 8 8 10 8 8 8 8 7 9 8 8 6 6 6 6 6 10 8 9 9 10 11 13 10 8 7 6 8 8 9 12 12 10 8 6 6 6 6 10 8 8 8 6 8 6 6 8 8 8 8 8 8 8 8 8 9 12 10 11 13 10 8 8 8 8 8 8 10 10 8 10 8 8 8 8 11 10 10 10 9 8 8 8 8 8 8 8 8 11 12 11 13 11 11 10 9 8 8 8 10 10 12 8 9 9 8 6 6 7 10 8 11 11 13 13 9 9 9 10 11 20 16 10 8 8 8 8 8 10 10 10 8 8 8 8 8 8 8 8 8 12 12 13 11 9 10 10 10 8 8 8 8 8 8 12 11 12 10 10 8 10 6 6 6 8 10 10 8 8 6 6 8 10 10 8 10 10 13 10 11 11 8 8 8 8 8 8 8 8 8 10 10 10 12 10 8 8 8 8 8 9 10 8 8 6 6 8 8 10 10 8 7 6 8 8 8 8 6 6 6 6 6 8 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no392_i01.b1 MSMg01no392_i01.b1 CHROMAT_FILE:
MSMg01no392_i01.b1 PHD_FILE: MSMg01no392_i01.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:37:02 2005
         (442 letters)



>mm_chr17_32536976_32537817
          Length = 842

 Score =  416 bits (215), Expect = e-120
 Identities = 256/281 (91%), Gaps = 23/281 (8%)
 Strand = Plus / Plus

                                                                       
Query: 160 tctctctctgtctctgtctctctctgtctctctttctgtctctctgtctctgtctctctc 219
           ||||||||||||||||||||||||||||||||  ||||||||    ||||||||||||||
Sbjct: 379 tctctctctgtctctgtctctctctgtctctc--tctgtctc----tctctgtctctctc 432

                                                                       
Query: 220 tctctctttgtctctctatcctctctctgtctctctctccctctgtctctgtctctctct 279
           ||      |||||||||   || |||||||||||      ||||||||||||||||||||
Sbjct: 433 tc------tgtctctct---ctgtctctgtctct------ctctgtctctgtctctctct 477

                                                                       
Query: 280 gtctc--tctctctctctgtctctctctccctctgtctgtctctctctaaaataatttcc 337
           |||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 478 gtctctgtctctctctctgtctctctctccctctgtctgtctctctctaaaataatttcc 537

                                                                       
Query: 338 ttaaggtggaaaggatttatttgacaatttgagaatggtatagacaaagttgtaagtcca 397
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 538 ttaaggtggaaaggatttatttgagaatttgagaatggtatagacaaagttgtaagtcca 597

                                                    
Query: 398 tggagttttccttcttggggaggtggtgttggtggagagtg 438
           |||||||||||||||||||||||||||||||||||||||||
Sbjct: 598 tggagttttccttcttggggaggtggtgttggtggagagtg 638



 Score =  114 bits (59), Expect = 1e-29
 Identities = 81/91 (89%), Gaps = 6/91 (6%)
 Strand = Plus / Plus

                                                                       
Query: 46  tctctctctgtctctgtctctctctgtctctctgtctctctctgtctct----ctctctc 101
           |||||||||||||||||||||||||||||||  ||||||||||||||||    |||||||
Sbjct: 437 tctctctctgtctctgtctctctctgtctct--gtctctctctgtctctgtctctctctc 494

                                          
Query: 102 tgtctctctctgtctctgtctctctgtctct 132
           |||||||||||  |||||||| ||| |||||
Sbjct: 495 tgtctctctctccctctgtctgtctctctct 525


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 157
Number of extensions: 18
Number of successful extensions: 18
Number of sequences better than 10.0: 1
Number of HSP's gapped: 17
Number of HSP's successfully gapped: 3
Length of query: 442
Length of database: 842
Length adjustment: 9
Effective length of query: 433
Effective length of database: 833
Effective search space:   360689
Effective search space used:   360689
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information