MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-456H09
Chromosome	17 (Build37)
Map Location	20,322,272 - 20,322,719
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC665344, LOC627466, LOC627476, EG665371, EG665376, EG627537, EG627576, EG224572, EG627618, EG627636, LOC100042273, LOC210465, LOC670534, EG627664, V2r7, LOC100041856, EG545190, Fpr-rs7, Fpr-rs6
Downstream gene	EG627743, EG224576, V2r6, EG637720, EG665525, EG627805, V1re5, EG627814, EG381065, EG224582, Fpr-rs3, EG433073, V1re2, V1re6, LOC100041976, V1re3, V1re1, V1re8, V1re7, V1re4, LOC627884, Ppp2r1a, V1rf5, Zfp160, LOC627912, LOC435509, EG627924, 4933430A09, EG665654, EG665662, LOC665666
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC665344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC627466 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC627476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	EG665371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665371 MGI:3644541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG665376 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665376 MGI:3644540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG627537 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627537 MGI:3648026
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	EG627576 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627576 MGI:3648468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG224572 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224572 MGI:3647786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	EG627618 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627618 MGI:3643811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	EG627636 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627636 MGI:3644032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins

name	LOC100042273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 2 Proteins

name	LOC210465 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:210465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC670534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG627664 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627664 MGI:3647665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	V2r7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22313 MGI:1316665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100041856 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG545190 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545190 MGI:3646847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs

name	Fpr-rs7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321021 MGI:2448177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 Proteins

name	Fpr-rs6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321020 MGI:2448176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627743 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627743 MGI:3646973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins

name	EG224576 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224576 MGI:3647787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	V2r6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22312 MGI:1316664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 Proteins

name	EG637720 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637720 MGI:3648146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG665525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665525 MGI:3645524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins

name	EG627805 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627805 MGI:3643822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	V1re5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171228 MGI:2159626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627814 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627814 MGI:3646711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	EG381065 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381065 MGI:3645482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 8 Proteins

name	EG224582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224582 MGI:3644602
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	Fpr-rs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14290 MGI:1278318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 Proteins

name	EG433073 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433073 MGI:3644513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins

name	V1re2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171225 MGI:2159616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171229 MGI:2159627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	V1re3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171226 MGI:2159624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171224 MGI:2159615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171231 MGI:2159629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171230 MGI:2159628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1re4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171227 MGI:2159625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627884 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	Ppp2r1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51792 MGI:1926334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171236 MGI:2159639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp160 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:224585 MGI:108187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs

name	LOC435509 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	EG627924 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627924 MGI:3648804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins

name	4933430A09 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG665654 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665654 MGI:3643625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins

name	EG665662 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665662 MGI:3647086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	LOC665666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 Proteins pseudo : _no_value

name	EG665376 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401676 GeneID:665376 MGI:3644540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG665376 transcript_id : XM_976485.1

name	EG627576 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268535 GeneID:627576 MGI:3648468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG627576 transcript_id : XM_892246.3

name	EG224572 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268538 GeneID:224572 MGI:3647786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG224572 transcript_id : XM_139786.7

name	EG627618 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268540 GeneID:627618 MGI:3643811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG627618 transcript_id : XM_892296.2

name	EG627636 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268542 GeneID:627636 MGI:3644032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : predicted gene, EG627636 transcript_id : XM_892318.2

name	LOC100042273 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268588 GeneID:100042273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 2 Proteins product : similar to Crx opposite strand transcript 1 transcript_id : XM_001478305.1

name	EG627664 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268544 GeneID:627664 MGI:3647665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG627664 transcript_id : XM_892353.3

name	V2r7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268546 GeneID:22313 MGI:1316665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : vomeronasal 2, receptor, 7 transcript_id : XM_139789.9

name	EG545190 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268549 GeneID:545190 MGI:3646847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs product : predicted gene, EG545190, transcript variant 1 transcript_id : XM_619437.4

name	Fpr-rs6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930700 GeneID:321020 MGI:2448176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formyl peptide receptor, related sequence 6 transcript_id : NM_177316.2

name	EG627743 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268551 GeneID:627743 MGI:3646973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins product : predicted gene, EG627743 transcript_id : XM_001477149.1

name	EG224576 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401692 GeneID:224576 MGI:3647787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG224576 transcript_id : XM_621454.3

name	V2r6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268554 GeneID:22312 MGI:1316664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 Proteins product : vomeronasal 2, receptor, 6 transcript_id : XM_977458.2

name	EG665525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268556 GeneID:665525 MGI:3645524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins product : predicted gene, EG665525 transcript_id : XM_977557.2

name	EG627805 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268558 GeneID:627805 MGI:3643822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG627805 transcript_id : XM_892506.2

name	V1re5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717710 GeneID:171228 MGI:2159626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E5 transcript_id : NM_134194.1

name	EG627814 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94401706 GeneID:627814 MGI:3646711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : predicted gene, EG627814 transcript_id : XM_892515.2

name	EG381065 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268560 GeneID:381065 MGI:3645482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 8 Proteins product : predicted gene, EG381065 transcript_id : XM_354985.6

name	EG433073 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268561 GeneID:433073 MGI:3644513
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 5 Proteins product : predicted gene, EG433073 transcript_id : XM_484599.5

name	V1re2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717696 GeneID:171225 MGI:2159616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E2 transcript_id : NM_134191.1

name	V1re6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168260 GeneID:171229 MGI:2159627
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E6 transcript_id : NM_134195.2

name	LOC100041976 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268564 GeneID:100041976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001477310.1

name	V1re3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982572 GeneID:171226 MGI:2159624
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E3 transcript_id : NM_134192.2

name	V1re1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717702 GeneID:171224 MGI:2159615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E1 transcript_id : NM_134190.1

name	V1re8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717708 GeneID:171231 MGI:2159629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E8 transcript_id : NM_134197.1

name	V1re7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717714 GeneID:171230 MGI:2159628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E7 transcript_id : NM_134196.1

name	V1re4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717700 GeneID:171227 MGI:2159625
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E4 transcript_id : NM_134193.1

name	Ppp2r1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131166 GeneID:51792 MGI:1926334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform transcript_id : NM_016891.3

name	V1rf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717726 GeneID:171236 MGI:2159639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, F5 transcript_id : NM_134202.1

name	Zfp160 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703953 GeneID:224585 MGI:108187
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 160 transcript_id : NM_145483.1

name	LOC627912 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94401717 GeneID:627912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs product : similar to l-Afadin transcript_id : XM_892614.2

name	EG627924 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82986763 GeneID:627924 MGI:3648804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins product : predicted gene, EG627924 transcript_id : XM_892630.1

name	4933430A09 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268566 GeneID:328766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein 4933430A09 transcript_id : XM_001477465.1

name	EG665654 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268601 GeneID:665654 MGI:3643625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : predicted gene, EG665654 transcript_id : XM_978485.2

name	EG665662 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268604 GeneID:665662 MGI:3647086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : predicted gene, EG665662 transcript_id : XM_978514.2

name	EG665376 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401677 GeneID:665376 MGI:3644540
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_981579.1

name	EG627576 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268536 GeneID:627576 MGI:3648468
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897339.3

name	EG224572 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268539 GeneID:224572 MGI:3647786
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_139786.7

name	EG627618 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268541 GeneID:627618 MGI:3643811
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897389.2

name	EG627636 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268543 GeneID:627636 MGI:3644032
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897411.2

name	LOC100042273 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268589 GeneID:100042273
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478355.1

name	EG627664 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268545 GeneID:627664 MGI:3647665
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897446.3

name	V2r7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268547 GeneID:22313 MGI:1316665
definition	codon_start : 1 product : vomeronasal 2, receptor, 7 protein_id : XP_139789.9

name	EG545190 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268550 GeneID:545190 MGI:3646847
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_619437.3

name	Fpr-rs6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930701 CCDS:CCDS28423.1 GeneID:321020 MGI:2448176
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004943 - C3a anaphylatoxin receptor activity [Evidence IEA]; GO:0004982 - N-formyl peptide receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : formyl peptide receptor, related sequence 6 protein_id : NP_796290.2

name	EG627743 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268552 GeneID:627743 MGI:3646973
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001477199.1

name	EG224576 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401693 GeneID:224576 MGI:3647787
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_621454.3

name	V2r6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268555 GeneID:22312 MGI:1316664
definition	codon_start : 1 product : vomeronasal 2, receptor, 6 protein_id : XP_982552.2

name	EG665525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268557 GeneID:665525 MGI:3645524
definition	codon_start : 1 product : similar to vomeronasal V1r-type receptor V1re25 protein_id : XP_982651.2

name	EG627805 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268559 GeneID:627805 MGI:3643822
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897599.2

name	V1re5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717711 CCDS:CCDS28424.1 GeneID:171228 MGI:2159626
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E5 protein_id : NP_598955.1

name	EG627814 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94401707 GeneID:627814 MGI:3646711
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_897608.2

name	EG381065 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986751 GeneID:381065 MGI:3645482
definition	codon_start : 1 product : similar to small nuclear RNA protein_id : XP_354985.4

name	EG433073 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268562 GeneID:433073 MGI:3644513
definition	codon_start : 1 product : hypothetical protein protein_id : XP_484599.2

name	V1re2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717697 CCDS:CCDS28426.1 GeneID:171225 MGI:2159616
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E2 protein_id : NP_598952.1

name	V1re6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168261 GeneID:171229 MGI:2159627
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : vomeronasal 1 receptor, E6 protein_id : NP_598956.2

name	LOC100041976 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268565 GeneID:100041976
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001477360.1

name	V1re3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717707 CCDS:CCDS28427.1 GeneID:171226 MGI:2159624
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal receptor 1 D1 product : vomeronasal 1 receptor, E3 protein_id : NP_598953.1

name	V1re1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717703 CCDS:CCDS28428.1 GeneID:171224 MGI:2159615
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E1 protein_id : NP_598951.1

name	V1re8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717709 CCDS:CCDS28429.1 GeneID:171231 MGI:2159629
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E8 protein_id : NP_598958.1

name	V1re7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717715 CCDS:CCDS28430.1 GeneID:171230 MGI:2159628
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 note : vomeronasal receptor 1 E5 product : vomeronasal 1 receptor, E7 protein_id : NP_598957.1

name	V1re4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717701 CCDS:CCDS28431.1 GeneID:171227 MGI:2159625
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, E4 protein_id : NP_598954.1

name	Ppp2r1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394027 CCDS:CCDS28432.1 GeneID:51792 MGI:1926334
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : serine/threonine protein phosphatase A subunit type 2A; protein phosphatase PP2A product : alpha isoform of regulatory subunit A, protein phosphatase 2 protein_id : NP_058587.1

name	V1rf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717727 CCDS:CCDS28433.1 GeneID:171236 MGI:2159639
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, F5 protein_id : NP_598963.1

name	Zfp160 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703954 CCDS:CCDS28434.1 GeneID:224585 MGI:108187
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 160 protein_id : NP_663458.1

name	LOC627912 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82986760 GeneID:627912
definition	codon_start : 1 product : similar to l-Afadin protein_id : XP_897707.1

name	EG627924 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82986764 GeneID:627924 MGI:3648804
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_897723.1

name	4933430A09 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268567 GeneID:328766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477515.1

name	EG665654 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268602 GeneID:665654 MGI:3643625
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_983579.2

name	EG665662 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268605 GeneID:665662 MGI:3647086
definition	codon_start : 1 product : similar to EG635895 protein protein_id : XP_983608.2

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 7 pseudo : _no_value

name	LOC665344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665344
definition	number : 8 pseudo : _no_value

name	LOC627466 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627466
definition	number : 1 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 1 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 2 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 3 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 4 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 5 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 6 pseudo : _no_value

name	LOC627476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627476
definition	number : 7 pseudo : _no_value

name	EG665371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665371
definition	number : 1 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 1 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 2 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 3 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 4 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 5 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 6 pseudo : _no_value

name	EG627537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627537
definition	number : 7 pseudo : _no_value

name	LOC210465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:210465
definition	number : 1 pseudo : _no_value

name	LOC210465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:210465
definition	number : 2 pseudo : _no_value

name	LOC210465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:210465
definition	number : 3 pseudo : _no_value

name	LOC210465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:210465
definition	number : 4 pseudo : _no_value

name	LOC210465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:210465
definition	number : 5 pseudo : _no_value

name	LOC210465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:210465
definition	number : 6 pseudo : _no_value

name	LOC670534 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670534
definition	number : 1 pseudo : _no_value

name	LOC100041856 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041856
definition	number : 1 pseudo : _no_value

name	LOC100041856 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041856
definition	number : 2 pseudo : _no_value

name	LOC100041856 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041856
definition	number : 3 pseudo : _no_value

name	EG637720 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637720
definition	number : 1 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 8 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 7 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 6 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 5 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 4 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 3 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 2 pseudo : _no_value

name	EG224582 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:224582
definition	number : 1 pseudo : _no_value

name	LOC627884 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627884
definition	number : 1 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 4 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 3 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 2 pseudo : _no_value

name	LOC435509 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435509
definition	number : 1 pseudo : _no_value

name	LOC665666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665666
definition	number : 1 pseudo : _no_value

name	Fpr-rs7 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268595 GeneID:321021 MGI:2448177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 Proteins product : formyl peptide receptor, related sequence 7 transcript_id : XR_035358.1

name	Fpr-rs3 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149268596 GeneID:14290 MGI:1278318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 Proteins product : formyl peptide receptor, related sequence 3 transcript_id : XR_035364.1

clone name	MSMg01-309A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-120L13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-438I08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-178B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-443H23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-308B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-402N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330O10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-540D16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-134M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-350H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079N17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-173G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-342M09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-118H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-261O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067D01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-066G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072M07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-456H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538F01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-178A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D16
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-456H09.T7 (MSMg01no456_h09.b1)	MSMg01-456H09.TJ (MSMg01no456_h09.g1)
ACC	AG542758	AG542759
length	735	1,517
length of high quality (start - end)	488 (66 - 553)	---
definition	CHROMAT_FILE: MSMg01no456_h09.b1 PHD_FILE: MSMg01no456_h09.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:28:17 2005	CHROMAT_FILE: MSMg01no456_h09.g1 PHD_FILE: MSMg01no456_h09.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:28:17 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	ATCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCG GAATTCATATTTGCTCACCCCTAGGAGTAGAGAAAGTTCAAAGATATTTT CTCTGGATAAAAGATCAGTTTGGTTAGTACAGAGCATCAGTTAAACAGGT GTGAAAGATGCAGTTTAAGTGTGGTAGAGGAAGAACTCAGAGGACAAAAC AACTTGATTTAAAGCAGATTCTATATTATTATTCAAATAACCTTCTCTAG GTTTGACAACCACTCAAAACATTAGTTTCTTCTTATAATAAAAAATAATA AAATCTTGTATGCTATTTAACATAAACATATATATCTGTGTAGATTACAT AAGGTATGCAGGTAAAGGGGAGGTCCAAGACCTCTACCAAAACTCATTAG ATCACACTGTATCCAAGAAAACATTAACTAAATAATCATGCTCACTCTTA TTATAAAAATCAAAAAGAATTTCATCTCACTATGTAATAAGTCAAAACAC TTTTTTGAAGATAGAGATGGTAACCACCCCTCACTGACTTCCTGCCATTG TGGACCCACNAGGAGTCACACATTATCAAACAGCAGTTATAACTTTTCAA CCTTCTCATCAAATCTAGATTCAAACCAGTGCTATATATTAACAAATATC CAAATGCGGGTCTTCCATTCCCTCCTCTATTTGGGAGTGGGCAACTCTGC CCGGCAGAACAAAAAGGAGGGCCTACGGGTGGATT	TTCTATCATTACGATGTGTAGAGCCAGCGGNTCGAGAGAGACATTAAATC TATTCTCACACATCCACAAGAGGTGTCGNCGCGCTGTCGGCTTGTGCGGT GTTCCTCTCTCTCNCNATCGTGATNATGTCGCCTACCGCTGCTCNCTAGT ATACTAGTATATACCGCGCCGCACTGATAACAGTAATGAGATCATACCAG CATACCGATACACACTCTCNTCTTCCTCTCTCNTATCTAGCTACATANTC TGCGCACTTGTCGATCTGTCTATGACGATTGACATCGCACACGCGACTGT ATCGCGCAGCTGTGCCTCAGACATTGTGTCGTACTATGATCAGACGCTGC GCCGCGGCGCGCCTGTTATCGCGTGTGTATGCACACCGTTGCGCAGAGCG CGCTGTCTATGCGCTGCTCTGTATGCGTCTCCGTATCTTCTTACATTACA TCATCCCAGTACAGAGAGTGGATGACAGCGTAGCGTCTAAGTCCTGAGTA CCACGATATACATANTAAATACATACAACATCATCATTACATACTTATGC TTTACATATTCTAATACATTACTATTATAATACAACATATATGCGTATCT CTAGCTCGCGCTGTGTATGCTATCGACATCACTATAACTTCTATGNCGAT GTGACACAATAGTAATCACCAACGCAACACACGATGTGGATGCACAAGTA TATGTATACAACATATCGCATGGAAATGTATGGAAATCGATGATATAGCG CATGNTGATGTGAGATGTAGAGATCAATACAGAATTATGAGAATATAACG AAACGGTTATTACTCACGGAGATGCGTATATGTTTATCGCTGCGGCGTCT CGACGTTANCTCGNTACATCTGTGTGACGTGTATGCTNCGATCATGCACG TGATGCGCCACTGTTTGTAGTGACTTCACAGCATGTGCTTACAATTATAC TCTCTTACCTCATATCTNATGTAAACCTACTCTCTATCATGTTATAATAC ACCTCTGTACCGAACCGNCTAGCATGAATATCGCGTGCGCTGCGCGCTGT GTTTTCACGCACCATGCATAGTCTGTCATTGACCATATATAAACTTATCA CACGCACGTTCCAATTTATATGTTTACGTCGCGCTTAGTACATCACAGTG TTCGCACNTGATATATGTCGCAGGCATCGGAGATATGTGTATTCGCGACG AGCTCGTGTGCTATTGTGCGACGATGCTCCTGCTTTTATTCTTGTTCTGT TATATATATCTCGAACAGCAGTCTGCCGCAGTCATGTTCCGCAATGGCTA CACTGCGGTTCGAGTATGATCAGAGCGTCATGATGTGCGCGTGTTCGTCT TCTCACAGCTATTGACGCTATGACTGTGTGATTGTCTATATAACGTCGCG CACCTAGTGCGACGACTGGTGTGTTCGCGTATCTCATAGGTGATATAGTA CGATGTGCTCACGCCTTGTTGTATATACGCGACACGATCTCGACGCCGAT GATGTGCAGATAATATA
quality values	Open. Hide. 7 7 8 8 10 11 6 9 9 9 18 28 25 25 24 20 22 28 23 21 10 10 10 25 25 43 25 19 15 8 7 6 6 6 6 6 8 11 11 16 16 18 18 24 25 25 29 36 47 39 29 23 23 29 32 21 23 11 12 12 17 9 9 9 9 9 19 21 37 47 59 59 47 48 48 53 53 53 57 57 59 59 59 57 57 57 57 57 57 57 57 50 53 53 68 68 68 68 68 57 57 57 57 57 53 53 68 68 68 68 68 68 43 43 42 39 39 44 44 48 57 57 57 57 57 68 59 57 57 57 57 57 57 68 57 57 57 57 57 57 57 68 57 57 57 57 57 57 68 68 68 68 68 68 68 48 48 30 35 30 35 43 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 52 52 57 57 57 57 57 57 57 57 59 59 59 59 59 59 59 57 68 68 68 57 57 59 59 59 68 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 62 62 52 45 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 62 62 62 62 62 62 62 62 44 44 32 43 16 16 14 12 13 12 12 20 32 44 59 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 57 57 59 59 59 59 59 68 68 68 68 68 68 59 59 57 57 57 59 57 57 57 57 57 57 57 57 57 57 52 52 57 57 57 57 52 54 54 44 44 59 59 59 57 52 54 57 57 57 57 68 57 57 57 57 47 47 50 57 59 59 57 48 48 48 57 57 68 68 68 68 68 68 68 68 57 57 48 48 48 57 59 59 47 43 43 57 57 57 57 59 59 68 68 68 68 68 57 57 59 59 57 48 48 48 57 57 57 48 48 54 48 48 48 43 43 46 59 57 54 54 48 48 48 48 48 48 48 59 59 59 59 43 43 36 36 36 43 43 48 48 48 46 59 59 59 59 59 43 37 30 34 25 32 28 39 59 59 41 37 32 29 34 37 32 27 28 32 28 34 43 37 37 30 30 32 39 39 41 34 34 23 20 17 30 18 17 17 30 28 34 23 23 9 12 8 7 7 7 11 3 0 3 17 17 22 12 12 13 14 13 26 15 15 15 22 18 13 10 10 9 9 8 8 8 15 19 21 15 14 16 15 14 14 21 22 30 27 20 17 17 15 15 13 14 18 19 19 12 11 17 11 11 11 18 23 28 22 16 11 11 15 15 11 11 16 10 8 8 10 8 10 11 14 13 19 8 8 8 8 9 14 9 9 12 9 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 12 12 13 13 28 20 14 13 18 12 9 10 13 10 8 8 8 10 12 10 14 11 13 25 16 12 12 11 10 9 12 10 10 10 10 10 9 9 9 10 10 10 13 10 10 9 9 8 6 6 6 6 8 8 13 13 14 13 13 10 8 10 8 8 10 8 8 6 6 7 7 7 6 10 9 9	Open. Hide. 10 10 10 10 9 10 10 8 8 8 8 8 8 8 6 11 8 10 10 10 11 17 10 8 7 8 9 9 6 3 0 3 6 6 10 6 8 6 9 9 9 9 10 13 10 13 12 10 10 10 11 10 8 8 8 8 8 8 8 8 8 8 8 8 6 6 6 6 6 6 6 6 6 8 8 8 10 3 0 3 6 6 6 8 8 8 8 8 8 6 6 6 6 8 8 7 7 7 7 7 8 6 6 6 6 6 6 6 7 8 9 10 3 0 3 0 3 8 8 9 9 11 12 3 0 3 11 11 7 7 6 8 8 8 9 8 6 6 6 6 6 8 8 3 0 3 8 8 8 8 8 8 8 8 8 10 8 9 8 8 8 10 9 6 6 6 6 8 8 8 8 9 9 8 8 8 8 8 8 6 6 6 7 7 6 6 6 6 6 10 11 8 8 6 6 6 6 7 6 6 8 8 8 8 8 6 6 7 7 10 10 16 12 12 10 13 11 11 3 0 3 8 8 12 10 9 9 9 9 10 10 3 0 3 11 6 6 6 6 6 6 6 8 8 8 8 3 0 3 10 10 12 9 10 10 10 11 11 11 11 8 8 8 6 6 8 6 10 10 9 9 6 6 6 6 6 8 8 8 8 7 7 7 6 8 6 6 6 6 10 12 9 11 6 8 6 7 8 6 8 8 6 6 6 6 6 6 7 8 7 8 8 8 9 9 9 9 9 9 9 6 6 6 6 7 10 10 8 8 8 10 8 8 8 10 11 11 11 12 12 12 11 11 11 9 9 8 8 10 13 14 11 8 8 6 6 8 8 8 9 9 9 9 8 8 8 8 8 8 8 8 8 9 8 8 10 8 8 8 8 8 8 8 6 6 8 6 7 8 7 11 9 9 10 11 16 10 10 10 9 9 10 10 8 8 8 8 9 10 8 8 8 8 8 8 8 8 8 8 6 6 6 6 6 8 8 8 8 10 10 17 12 10 10 8 8 8 8 8 8 10 11 11 12 13 15 21 17 17 11 9 7 6 8 6 6 6 6 6 6 8 8 8 6 6 6 6 8 8 10 10 12 10 10 10 8 6 10 6 7 8 8 8 8 8 8 8 6 6 6 6 6 6 6 8 8 8 8 6 6 6 8 6 6 6 6 8 6 9 9 14 20 11 3 0 3 8 8 8 8 10 12 10 8 8 6 6 6 6 6 12 20 20 11 11 11 14 14 17 10 8 8 8 8 8 8 6 6 6 6 8 8 9 9 9 8 10 8 8 8 8 9 9 9 17 10 6 6 6 8 10 9 9 9 10 10 10 6 6 8 9 9 9 8 6 6 6 6 6 8 16 12 12 9 11 8 8 8 10 14 14 12 9 9 9 10 10 6 6 6 6 6 6 8 8 8 10 8 6 6 6 8 8 8 8 6 6 6 6 8 8 10 7 7 6 6 6 6 7 8 8 8 6 6 3 0 3 9 8 7 6 6 8 6 6 6 7 7 9 12 6 6 8 8 8 8 8 9 8 8 6 6 6 6 6 6 6 7 8 10 8 8 8 8 8 8 8 10 12 15 19 18 15 11 10 10 9 9 8 6 6 6 7 7 10 9 8 10 8 8 8 8 8 8 8 9 8 7 6 8 10 10 6 6 6 6 8 8 8 10 8 8 6 7 6 8 8 8 10 9 10 10 10 8 8 8 6 6 7 10 11 11 11 3 0 3 10 9 9 8 8 6 6 8 6 9 6 8 6 6 8 6 8 9 9 9 9 9 6 6 7 7 8 6 8 6 6 6 7 7 10 8 10 9 9 10 8 8 8 6 6 7 6 6 6 8 8 8 9 9 11 11 11 11 9 8 8 8 8 8 10 10 16 13 10 11 10 6 6 7 7 9 9 12 11 11 8 6 6 6 8 8 11 9 9 10 8 8 6 6 8 8 10 8 8 6 8 3 0 3 6 6 3 0 3 8 8 8 9 10 10 16 15 15 8 8 7 7 6 8 6 6 7 8 8 8 3 0 3 8 8 6 6 8 8 10 8 7 7 7 7 8 8 9 8 8 6 6 8 6 8 8 8 18 13 11 10 8 8 8 6 6 6 6 10 10 6 6 8 8 8 8 8 8 8 8 8 6 6 6 8 8 9 9 15 10 8 6 6 8 6 8 8 8 8 6 6 6 8 8 8 8 8 8 6 6 3 0 3 7 8 6 6 6 6 6 6 8 8 8 7 7 7 8 8 8 8 8 8 6 6 6 7 7 10 17 10 10 8 8 6 6 8 10 8 6 6 8 8 8 9 9 8 8 8 8 3 0 3 10 10 10 8 6 8 6 6 8 6 8 8 8 8 10 10 10 8 6 6 8 8 8 6 6 8 8 10 11 13 8 8 8 8 10 8 9 9 11 11 8 8 8 8 8 6 6 8 8 8 8 6 6 8 6 10 10 10 11 12 15 13 10 10 10 11 13 13 10 10 9 8 8 9 9 13 15 15 8 6 6 8 10 10 8 6 6 6 6 6 8 8 6 6 6 6 11 6 6 6 6 6 6 6 7 7 10 9 9 9 9 8 8 8 6 6 6 6 8 8 8 8 8 8 8 10 11 11 11 10 10 11 9 8 8 6 8 3 0 3 9 9 10 10 11 10 10 10 10 8 6 6 6 6 8 6 6 6 6 8 8 10 8 8 12 10 8 8 10 10 8 8 8 8 8 10 8 6 6 8 8 8 8 8 8 8 8 8 8 8 6 7 7 8 8 8 8 6 6 6 6 8 6 9 9 8 6 7 9 7 7 7 7 12 10 9 9 9 9 9 10 10 8 6 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 11 8 8 8 8 8 8 7 9 7 8 8 8 8 9 10 10 10 10 10 9 10 8 8 8 8 8 8 8 8 8 8 8 8 8 11 11 10 9 8 7 7 10 8 8 8 8 8 8 10 15 15 9 8 8 8 6 6 8 8 11 6 6 6 6 8 8 10 10 11 8 8 8 8 10 8 9 9 11 9 15 10 8 8 8 8 6 6 6 6 6 6 9 11 9 9 6 6 6 6 8 8 6 6 6 6 8 8 8 8 8 8 8 10 10 8 8 8 8 8 8 6 6 6 6 10 12 17 11 11 10 12 10 8 8 8 6 6 6 6 8 8 8 8 8 8 11 8 8 8 8 8 6 6 6 6 6 6 8 8 10 8 7 9 9 15 11 11 12 11 13 10 8 8 11 8 6 6 6 8 8 8 8 8 8 8 10 10 8 6 6 6 8 8 8 8 8 8 8 8 8 10 10 10 8 8 9 9 9 9 9 9 9 9 9 9 8 8 8 8 6 6 6 6 8 6 6 7 10 13 10 8 8 6 6 6 7 8 6 8 10 8 7 8 6 6 6 6 10 8 10 8 8 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no456_h09.b1 MSMg01no456_h09.b1 CHROMAT_FILE:
MSMg01no456_h09.b1 PHD_FILE: MSMg01no456_h09.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:28:17 2005
         (488 letters)



>mm_chr17_20321832_20322719
          Length = 888

 Score =  789 bits (408), Expect = 0.0
 Identities = 438/448 (97%)
 Strand = Plus / Minus

                                                                       
Query: 41  gataaaagatcagtttggttagtacagagcatcagttaaacaggtgtgaaagatgcagtt 100
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 888 gataaaagctcagtttggttagtacagagcatcagttaaacaggtgtgaaagatgcagtt 829

                                                                       
Query: 101 taagtgtggtagaggaagaactcagaggacaaaacaacttgatttaaagcagattctata 160
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 828 taagtgtggtagaggaagaactcagaggacaaaacaacttgatttaaagcagattctata 769

                                                                       
Query: 161 ttattattcaaataaccttctctaggtttgacaaccactcaaaacattagtttcttctta 220
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 768 ttattattcaaataaccttctctaggtttgacaactactcaaaacattagtttattctta 709

                                                                       
Query: 221 taataaaaaataataaaatcttgtatgctatttaacataaacatatatatctgtgtagat 280
           ||||||||||||||||||| ||||||||||  ||||||||||||||||||||||||||||
Sbjct: 708 taataaaaaataataaaattttgtatgctaactaacataaacatatatatctgtgtagat 649

                                                                       
Query: 281 tacataaggtatgcaggtaaaggggaggtccaagacctctaccaaaactcattagatcac 340
           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 648 tacataaggtatgcagataaaggggaggtccaagacctctaccaaaactcattagatcac 589

                                                                       
Query: 341 actgtatccaagaaaacattaactaaataatcatgctcactcttattataaaaatcaaaa 400
           ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 588 actgtatccaagataacattaattaaataatcatgctcactcttattataaaaatcaaaa 529

                                                                       
Query: 401 agaatttcatctcactatgtaataagtcaaaacacttttttgaagatagagatggtaacc 460
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 528 agaatttcatctcactatgtaataagtcaaaacacttttttgaagatagagatggtaacc 469

                                       
Query: 461 acccctcactgacttcctgccattgtgg 488
           ||||||||||||||||||||| ||||||
Sbjct: 468 acccctcactgacttcctgcctttgtgg 441


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 16
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 488
Length of database: 888
Length adjustment: 10
Effective length of query: 478
Effective length of database: 878
Effective search space:   419684
Effective search space used:   419684
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information