MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-545B12
Chromosome	17 (Build37)
Map Location	8,146,535 - 8,147,226
singlet/doublet	singlet
Overlap gene	Rshl2a
Upstream gene	Rshl2b, Tagap1, Rnaset2b, Gm1604, Rps6ka2, LOC625031, Tcp10b, LOC100038857, LOC667055, 5830477G23Rik, LOC625102, Fndc1, EG634588, LOC100040748, LOC100040760, LOC667102, Tagap
Downstream gene	LOC100040822, Rnaset2a, Fgfr1op, Ccr6, LOC667114, Brp44l, Sft2d1, LOC100038858, 9630019K15Rik, EG435502, LOC433063, T2, T, LOC100040817, Pde10a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rshl2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100037282 MGI:3630308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 74 ESTs, 3 Proteins

name	Tagap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380608 MGI:1919786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnaset2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68195 MGI:3702087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gm1604 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381059 MGI:2686450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps6ka2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20112 MGI:1342290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625031 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins pseudo : _no_value

name	Tcp10b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21461 MGI:98542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038857 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 4 Proteins

name	5830477G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76116 MGI:1923366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC625102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins pseudo : _no_value

name	Fndc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68655 MGI:1915905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG634588 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:634588 MGI:3645817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040748 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100040760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC667102 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Tagap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72536 MGI:3615484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rshl2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66832 MGI:1914082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 17 ESTs, 1 Protein

name	Rnaset2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100037283 MGI:1915445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 127 ESTs, 2 Proteins

name	Fgfr1op (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75296 MGI:1922546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12458 MGI:1333797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 3 Proteins pseudo : _no_value

name	Brp44l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55951 MGI:1915240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sft2d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106489 MGI:1918689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038858 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9630019K15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320111 MGI:2443403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG435502 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435502 MGI:3647869
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC433063 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:433063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 540 ESTs, 2 Proteins pseudo : _no_value

name	T2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21331 MGI:104658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	T (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20997 MGI:98472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Pde10a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23984 MGI:1345143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rshl2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268347 GeneID:100037282 MGI:3630308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 74 ESTs, 3 Proteins product : radial spokehead-like 2B transcript_id : XM_001475820.1

name	Tagap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165395 GeneID:380608 MGI:1919786
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell activation GTPase activating protein 1 transcript_id : NM_147155.1

name	Rnaset2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86439982 GeneID:68195 MGI:3702087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease T2B transcript_id : NM_026611.2

name	Gm1604 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384683 GeneID:381059 MGI:2686450
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1604, (NCBI) transcript_id : NM_001033442.2

name	Rps6ka2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68299760 GeneID:20112 MGI:1342290
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S6 kinase, polypeptide 2 transcript_id : NM_011299.4

name	Tcp10b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130122 GeneID:21461 MGI:98542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : t-complex protein 10b transcript_id : NM_011553.3

name	LOC100038857 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268266 GeneID:100038857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038857 transcript_id : XM_001471626.1

name	LOC667055 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94401558 GeneID:667055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 4 Proteins product : similar to UNC-93A protein transcript_id : XM_987981.1

name	5830477G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268352 GeneID:76116 MGI:1923366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 5830477G23 gene transcript_id : XM_001476159.1

name	Fndc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487224 GeneID:68655 MGI:1915905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibronectin type III domain containing 1 transcript_id : NM_001081416.1

name	LOC100040748 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268391 GeneID:100040748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001475177.1

name	LOC100040760 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268393 GeneID:100040760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Ubtf protein transcript_id : XM_001475200.1

name	Tagap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165373 GeneID:72536 MGI:3615484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell activation Rho GTPase-activating protein transcript_id : NM_145968.1

name	Rshl2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803214 GeneID:66832 MGI:1914082
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : radial spokehead-like 2A transcript_id : NM_025789.4

name	LOC100040822 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268396 GeneID:100040822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100040822, transcript variant 1 transcript_id : XM_001476254.1

name	LOC100040822 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268398 GeneID:100040822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : hypothetical protein LOC100040822, transcript variant 2 transcript_id : XM_001476269.1

name	LOC100040822 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268400 GeneID:100040822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein product : hypothetical protein LOC100040822, transcript variant 3 transcript_id : XM_001476289.1

name	Rnaset2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268402 GeneID:100037283 MGI:1915445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 126 ESTs, 2 Proteins product : ribonuclease T2A, transcript variant 1 transcript_id : XM_001476345.1

name	Rnaset2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149268404 GeneID:100037283 MGI:1915445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 113 ESTs, 1 Protein product : ribonuclease T2A, transcript variant 2 transcript_id : XM_001476365.1

name	Fgfr1op (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365869 GeneID:75296 MGI:1922546
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fgfr1 oncogene partner transcript_id : NM_201230.3

name	Ccr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803448 GeneID:12458 MGI:1333797
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 6 transcript_id : NM_009835.3

name	Brp44l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360084 GeneID:55951 MGI:1915240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain protein 44-like transcript_id : NM_018819.4

name	Sft2d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853574 GeneID:106489 MGI:1918689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SFT2 domain containing 1 transcript_id : NM_134114.2

name	LOC100038858 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149268388 GeneID:100038858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038858 transcript_id : XM_001471593.1

name	9630019K15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254340 GeneID:320111 MGI:2443403
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630019K15 gene transcript_id : NM_178774.3

name	T2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305536 GeneID:21331 MGI:104658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brachyury 2 transcript_id : NM_013682.1

name	T (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130357 GeneID:20997 MGI:98472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brachyury transcript_id : NM_009309.2

name	Pde10a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909346 GeneID:23984 MGI:1345143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 10A transcript_id : NM_011866.2

name	Rshl2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268348 GeneID:100037282 MGI:3630308
definition	codon_start : 1 product : radial spokehead-like 2B protein_id : XP_001475870.1

name	Tagap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165396 GeneID:380608 MGI:1919786
definition	codon_start : 1 exception : mismatches in translation product : T-cell activation GTPase activating protein 1 protein_id : NP_671511.1

name	Rnaset2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311883 GeneID:68195 MGI:3702087
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0004521 - endoribonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : ribonuclease T2 product : ribonuclease T2B protein_id : NP_080887.1

name	Gm1604 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701955 CCDS:CCDS28375.1 GeneID:381059 MGI:2686450
definition	codon_start : 1 product : hypothetical protein LOC381059 protein_id : NP_001028614.1

name	Rps6ka2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755374 CCDS:CCDS28376.1 GeneID:20112 MGI:1342290
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0000089 - mitotic metaphase [Evidence IDA]; GO:0001556 - oocyte maturation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : S6K-alpha 2; ribosomal protein S6 kinase alpha 2; p90-RSK 2; ribosomal protein S6 kinase, 90kD, polypeptide 2 product : ribosomal protein S6 kinase, polypeptide 2 protein_id : NP_035429.1

name	Tcp10b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098085 CCDS:CCDS28377.1 GeneID:21461 MGI:98542
definition	codon_start : 1 product : t-complex protein 10b protein_id : NP_035683.2

name	LOC100038857 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268267 GeneID:100038857
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471676.1

name	LOC667055 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94401559 GeneID:667055
definition	codon_start : 1 product : similar to UNC-93A protein protein_id : XP_993075.1

name	5830477G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268353 GeneID:76116 MGI:1923366
definition	codon_start : 1 product : hypothetical protein LOC76116 protein_id : XP_001476209.1

name	Fndc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487225 GeneID:68655 MGI:1915905
definition	codon_start : 1 product : fibronectin type III domain containing 1 protein_id : NP_001074885.1

name	LOC100040748 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268392 GeneID:100040748
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475227.1

name	LOC100040760 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268394 GeneID:100040760
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475250.1

name	Tagap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165374 CCDS:CCDS28379.1 GeneID:72536 MGI:3615484
definition	codon_start : 1 product : T-cell activation Rho GTPase-activating protein protein_id : NP_666080.1

name	Rshl2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55741725 GeneID:66832 MGI:1914082
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : radial spokehead-like 2 product : radial spokehead-like 2A protein_id : NP_080065.3

name	LOC100040822 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268397 GeneID:100040822
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476304.1

name	LOC100040822 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268399 GeneID:100040822
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476319.1

name	LOC100040822 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268401 GeneID:100040822
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001476339.1

name	Rnaset2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268405 GeneID:100037283 MGI:1915445
definition	codon_start : 1 product : ribonuclease T2A isoform 2 protein_id : XP_001476415.1

name	Rnaset2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149268403 GeneID:100037283 MGI:1915445
definition	codon_start : 1 product : ribonuclease T2A isoform 1 protein_id : XP_001476395.1

name	Fgfr1op (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47777353 CCDS:CCDS28380.1 GeneID:75296 MGI:1922546
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Fgfr1 oncogene partner protein_id : NP_957682.1

name	Ccr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753318 CCDS:CCDS28381.1 GeneID:12458 MGI:1333797
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004945 - angiotensin type II receptor activity [Evidence IEA]; GO:0016493 - C-C chemokine receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : chemokine (C-C motif) receptor 6 protein_id : NP_033965.1

name	Brp44l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055178 GeneID:55951 MGI:1915240
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : apoptosis-regulating basic protein product : brain protein 44-like protein_id : NP_061289.1

name	Sft2d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88853575 GeneID:106489 MGI:1918689
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : SFT2 domain containing 1 protein_id : NP_598875.2

name	LOC100038858 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149268389 GeneID:100038858
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471643.1

name	9630019K15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254341 CCDS:CCDS28382.1 GeneID:320111 MGI:2443403
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC320111 protein_id : NP_848889.2

name	T2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305537 GeneID:21331 MGI:104658
definition	codon_start : 1 exception : mismatches in translation product : brachyury 2 protein_id : NP_038710.1

name	T (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678203 CCDS:CCDS28383.1 GeneID:20997 MGI:98472
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001839 - neural plate morphogenesis [Evidence IMP]; GO:0030903 - notochord development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001756 - somitogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : brachyury-like 3; brachyury-like 2; low ratio; brachyury(T) product : brachyury protein_id : NP_033335.1

name	Pde10a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70909347 CCDS:CCDS28384.1 GeneID:23984 MGI:1345143
definition	GO_function : GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IDA] codon_start : 1 note : dual-substrate cAMP and cGMP, cyclic nucleotide phosphodiesterase product : phosphodiesterase 10A protein_id : NP_035996.2

name	EG634588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634588
definition	number : 1 pseudo : _no_value

name	EG634588 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:634588
definition	number : 2 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 6 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 5 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 4 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 3 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 2 pseudo : _no_value

name	LOC667102 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667102
definition	number : 1 pseudo : _no_value

name	EG435502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435502
definition	number : 1 pseudo : _no_value

name	LOC100040817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040817
definition	number : 2 pseudo : _no_value

name	LOC100040817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040817
definition	number : 1 pseudo : _no_value

name	LOC625031 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268351 GeneID:625031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins product : similar to G protein-coupled receptor 31, D17Leh66c region pseudo : _no_value transcript_id : XR_032539.1

name	LOC625102 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268354 GeneID:625102
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins product : similar to G protein-coupled receptor 31, D17Leh66c region pseudo : _no_value transcript_id : XR_032598.1

name	LOC667114 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268395 GeneID:667114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 49 ESTs, 3 Proteins product : similar to Phosphopantothenoylcysteine synthetase pseudo : _no_value transcript_id : XR_032140.1

name	LOC433063 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149268408 GeneID:433063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 540 ESTs, 2 Proteins product : similar to ribosomal protein L15 pseudo : _no_value transcript_id : XR_032837.1

clone name	MSMg01-201G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-176I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137O11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466F01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-375N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421H18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-421P16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-365B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542L20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-435G18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-438B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-080C19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-439G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-147A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098J02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-386H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450A10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532G01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-379K16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359O14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-520D23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-493C08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-130K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-213A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-125C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-394E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209C11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-517O12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-438B20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-085I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-442G01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329E19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-545B12.T7 (MSMg01no545_b12.b1)	MSMg01-545B12.TJ (MSMg01no545_b12.g1)
ACC	AG610238	AG610239
length	734	686
length of high quality (start - end)	690 (39 - 728)	91 (67 - 157)
definition	CHROMAT_FILE: MSMg01no545_b12.b1 PHD_FILE: MSMg01no545_b12.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:25:59 2005	CHROMAT_FILE: MSMg01no545_b12.g1 PHD_FILE: MSMg01no545_b12.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:25:59 2005
singlet/doublet	singlet	---
BLAST hit	plural	no hit data
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAATTCCA AGCCCATGGTCTTGCTCAAAGATGTTCTAGGACTGTTGGAGCACTGGCGG AAGGCTTTAGCTATGTCAGAATTCAATCTTAAAAGGCACTTATAATAGGA TAATACTAAAAGAGAGCACGTGGATCCATACACTAGACTAATGCGGGAAT GGAAAATTAATGTATGGGTTAGAGAGAACACCAGACTCCAGGAGTGAATT TCCGTGAAACTCTTCTGCCTCAGTGAATAGCTTCCAAGCCTCTCGGCTTG TCAAGCTGACTCAACCAGAGCACGTGGCAAATTACTTGAAGAGTGCATTT TTAAAAGACATAGAAGCTAGAGGTGTAGATCATGATAAAGCAGTTGCCTA ACATGTGCAAGGCCTTCAATTGAGTCCCCAACACTGCCCCCCAAGTATGT CTATATGTGTGTGAATATGTATGTGTGTGCATACGTGTGTATTATGTACA TATATAGTATGTATGTATGTGCATATGTATGCATTGCATAGGCATGTGTG TATATGCGTATGTATGTATGTACGTATGTATGCATGTGCATGTGTTTGTG GATCCAGTGGTACTTGCAGGAGTTACTGTTTGATGGGCCCAGAGTTTCGG TTACAGACGAGTGAACAGTATGAGGGTAAGTGGTACTGGTCACAGTGGTG TGGGCATGTTCTGCCATGGAGCTGTATACATAAG	NNTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXCATGTGTCAAATCCAGCGCTGACCTCGCTCCGTC CAGCGCTGAACTCCGTTTACAGTACACTGTCTCCTTGANTGGATGTTTGA AATANCANTGGCCTGGGGCCTTCCTTTCCTGACTTACCTTCAAGATTTTG AAATACCTGGTGTGTATAAAATAAAGATACAGGTTTAAAAATGTNNNNCC TCGGCCGTCGGAGTTTGACTATGCAGGGGNNNNNNNNCNTCNNCNGGGGG GGGGGGGGGGGGGGGGGGGCGGGGGNNNCTNNNNNNNNNNNNNNTTTTTG TTGTGTGGGGGGGGGGGGGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNTNTNNNNATNTNTTTTTTTTTTTG
quality values	Open. Hide. 20 20 34 34 27 27 15 15 15 27 17 20 19 18 20 28 37 43 23 22 17 14 14 13 20 11 11 11 12 23 27 43 59 29 29 30 30 30 32 47 57 57 36 35 35 37 37 37 34 34 29 29 33 37 37 37 42 42 54 48 48 48 48 54 42 42 42 47 50 50 50 41 50 50 50 47 48 57 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 54 50 50 50 50 50 50 52 57 52 57 57 57 57 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 51 51 51 51 51 57 68 68 57 57 59 59 68 68 68 68 68 68 59 59 59 59 59 57 57 57 57 57 57 52 52 59 59 57 57 57 57 57 57 52 57 57 57 57 57 57 57 59 59 57 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 52 62 62 62 62 62 52 62 62 62 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 68 62 62 62 62 62 52 52 62 52 62 52 62 62 68 68 68 68 68 68 68 68 68 68 68 68 62 62 68 68 68 68 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 68 68 68 68 59 59 59 57 57 57 48 54 47 59 47 48 48 57 57 57 57 57 59 59 59 68 59 59 59 59 59 59 59 68 59 59 57 57 57 59 59 59 59 57 57 57 59 59 59 59 59 59 59 54 54 54 57 57 57 59 54 48 48 59 59 59 43 32 30 30 43 43 48 48 48 43 43 39 43 43 43 43 40 41 41 41 37 32 30 29 29 32 39 39 39 40 39 39 41 41 37 37 41 41 38 34 36 39 36 31 35 32 32 30 32 24 34 32 23 20 22 34 24 32 20 23 23 34 28 30 30 37 34 22 14 14 17 27 25 20 20 24 32 28 31 31 31 35 31 31 39 39 41 41 44 41 59 43 36 29 30 30 30 28 34 28 37 31 28 35 36 37 32 31 30 37 41 41 37 31 31 32 37 32 25 25 30 31 30 27 32 37 37 37 37 39 37 19 13 8 8 8 15 10 8	Open. Hide. 0 0 3 6 6 6 7 21 21 27 3 0 3 27 23 39 39 39 19 19 11 12 8 6 6 6 6 3 0 3 13 13 25 19 25 3 0 3 27 21 30 30 33 33 33 27 27 3 0 3 13 13 21 23 30 33 33 23 19 9 9 9 9 19 29 29 30 31 31 31 59 37 24 19 9 9 9 9 19 28 29 30 31 47 59 41 41 47 47 34 32 36 47 47 47 47 50 48 31 23 23 10 10 23 33 59 24 9 9 9 9 24 24 39 41 42 50 50 50 48 48 48 57 57 57 48 50 50 50 50 50 50 42 41 39 25 25 3 0 3 16 15 14 23 21 30 33 37 37 32 32 23 23 3 0 3 3 0 3 21 21 22 10 9 9 9 9 9 26 41 43 44 41 41 41 39 37 37 31 19 19 22 18 17 12 30 29 22 17 17 28 16 30 14 10 8 8 8 7 10 12 21 9 8 8 11 8 8 10 8 8 8 9 8 13 11 13 12 15 14 8 9 8 10 6 6 6 6 6 6 6 6 8 8 9 8 8 8 15 15 14 10 10 3 0 0 0 0 3 6 8 8 10 8 15 8 8 8 6 8 8 8 8 8 11 10 8 8 7 9 9 8 8 8 8 8 7 7 3 0 0 0 0 0 0 0 0 3 0 3 3 0 0 3 0 3 11 8 12 13 13 13 12 8 8 8 14 14 12 12 12 19 14 12 12 12 14 10 9 12 12 12 10 9 3 0 0 0 3 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 15 8 8 8 8 6 8 8 8 8 10 10 10 10 10 8 8 8 9 9 11 12 9 9 8 8 8 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 3 0 0 0 0 3 3 0 3 0 3 9 10 10 10 12 8 8 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no545_b12.b1 MSMg01no545_b12.b1 CHROMAT_FILE:
MSMg01no545_b12.b1 PHD_FILE: MSMg01no545_b12.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 21:25:59 2005
         (690 letters)



>mm_chr17_8146338_8147427
          Length = 1090

 Score = 1214 bits (628), Expect = 0.0
 Identities = 673/692 (97%), Gaps = 7/692 (1%)
 Strand = Plus / Plus

                                                                       
Query: 5   gaattccaagcccatggtcttgctcaaagatgttctaggactgttggagcactggcggaa 64
           ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 198 gaattccaagcccatggtcttgctcaaggacgttctaggactgttggagcactggcggaa 257

                                                                       
Query: 65  ggctttagctatgtcagaattcaatcttaaaaggcacttataataggataatactaaaag 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 258 ggctttagctatgtcagaattcaatcttaaaaggcacttataataggataatactaaaag 317

                                                                       
Query: 125 agagcacgtggatccatacactagactaatgcgggaatggaaaattaatgtatgggttag 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318 agagcacgtggatccatacactagactaatgcgggaatggaaaattaatgtatgggttag 377

                                                                       
Query: 185 agagaacaccagactccaggagtgaatttccgtgaaactcttctgcctcagtgaatagct 244
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 378 agagaacaccagactccaggagtgaatttccgtgaaactcttctgcctcagtgagtagct 437

                                                                       
Query: 245 tccaagcctctcggcttgtcaagctgactcaaccagagcacgtggcaaattacttgaaga 304
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 438 tccaagcctctcggcttgtcaagctgactcgaccagagcacgtggcaaattacttgaaga 497

                                                                       
Query: 305 gtgcatttttaaaagacatagaagctagaggtgtagatcatgataaagcagttgcctaac 364
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 498 gtgcatttttaaaagacatagaagctagaggtgtagatcatgataaagcagttgcctaac 557

                                                                       
Query: 365 atgtgcaaggccttcaattgagtccccaacactgccccccaagtatgtctatatgtgtgt 424
           ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||
Sbjct: 558 atgtgcaaggccttcaattgagtccccaacattgccccccaagtatatctatatgtgtgt 617

                                                                       
Query: 425 gaatatgtatgtgtgtgcatacgtgtgtat-------tatgtacatatatagtatgtatg 477
           ||||||||||||||||||||||||||||||       |||||||||||||||||||||||
Sbjct: 618 gaatatgtatgtgtgtgcatacgtgtgtatcatgtattatgtacatatatagtatgtatg 677

                                                                       
Query: 478 tatgtgcatatgtatgcattgcataggcatgtgtgtatatgcgtatgtatgtatgtacgt 537
           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
Sbjct: 678 tatgtgcatatgtatgcattgcataggcaagtgtgtatatgcgtatgtatgtatgtacat 737

                                                                       
Query: 538 atgtatgcatgtgcatgtgtttgtggatccagtggtacttgcaggagttactgtttgatg 597
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 738 atgtatgcatgtgcatgtgtttgtggatccagtggtacttgcaggagttactgtttgatg 797

                                                                       
Query: 598 ggcccagagtttcggttacagacgagtgaacagtatgagggtaagtggtactggtcacag 657
           |||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 798 ggcccagagtttgggttacagacgagtgaacagtctgagggtaagtggtgctggtcacag 857

                                           
Query: 658 tggtgtgggcatgttctgccatggagctgtat 689
           |||||||||| |||||||||||||||||||||
Sbjct: 858 tggtgtgggcgtgttctgccatggagctgtat 889


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 37
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 690
Length of database: 1090
Length adjustment: 10
Effective length of query: 680
Effective length of database: 1080
Effective search space:   734400
Effective search space used:   734400
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information