MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-024H04
Chromosome	18 (Build37)
Map Location	37,558,419 - 37,559,445
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Pfdn1, Hbegf, Slc4a9, LOC624979, Eif4ebp3, Sra1, Apbb3, Slc35a4, E230025N22Rik, Cd14, Tmco6, Ndufa2, Ik, Wdr55, Dnd1, Hars, Hars2, Zmat2, EG627427, Pcdha1, Pcdha@, Pcdha2, Pcdha3, Pcdha4, Pcdha5, Pcdha6, Pcdha7, Pcdha8, Pcdha9, Pcdha10, Pcdha11, Pcdha12, Pcdhac1, Pcdhac2, Pcdhb1, Pcdhb2, Pcdhb3, Pcdhb4, Pcdhb5, Pcdhb6, Pcdhb7, Pcdhb8
Downstream gene	Pcdhb9, Pcdhb10, Pcdhb11, Pcdhb12, Pcdhb13, Pcdhb14, Pcdhb15, Pcdhb16, Pcdhb17, Pcdhb18, Pcdhb19, Pcdhb20, Pcdhb21, Pcdhb22, Slc25a2, Taf7, EG666693, Pcdhg@, Pcdhga1, Pcdhga2, Pcdhga3, Pcdhgb1, Pcdhga4, Pcdhgb2, Pcdhga5, Pcdhga6, Pcdhga7, Pcdhgb4, Pcdhga8, Pcdhgb5, Pcdhga9, Pcdhgb6, Pcdhga10, Pcdhgb7, Pcdhga11, Pcdhgb8, Pcdhga12, Pcdhgc3, Pcdhgc4, Pcdhgc5, Diap1, Hdac3, 4631403P03Rik, Fchsd1, Centd3, Pcdh1, LOC100042583, 1700086O06Rik, 0610009O20Rik, Pcdh12, Rnf14, Gnpda1, LOC240219
Link	Open Mouse BAC browser

Click to get alignment info.

name	Pfdn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67199 MGI:1914449
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hbegf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15200 MGI:96070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc4a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240215 MGI:2443384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624979 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 299 ESTs, 9 Proteins pseudo : _no_value

name	Eif4ebp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108112 MGI:1270847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24068 MGI:1344414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apbb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225372 MGI:108404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67843 MGI:1915093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	E230025N22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:240216 MGI:3687212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12475 MGI:88318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmco6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71983 MGI:1919233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17991 MGI:1343103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24010 MGI:1345142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67936 MGI:1915186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213236 MGI:2447763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15115 MGI:108087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70791 MGI:1918041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66492 MGI:1913742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627427 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627427 MGI:3647509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 175 ESTs, 5 Proteins

name	Pcdha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116731 MGI:2150982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha@ (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 14 mRNAs

name	Pcdha2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353234 MGI:2681880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192163 MGI:2447313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12936 MGI:1298406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12941 MGI:1298371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12937 MGI:1298367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12939 MGI:1298369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353235 MGI:2681879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192161 MGI:2447322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12943 MGI:1298408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12942 MGI:1298372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdha12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192164 MGI:1298370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353236 MGI:1891442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhac2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353237 MGI:1891443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93872 MGI:2136730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93873 MGI:2136735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93874 MGI:2136737
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93875 MGI:2136738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93876 MGI:2136739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93877 MGI:2136740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93878 MGI:2136741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93879 MGI:2136742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93880 MGI:2136744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93881 MGI:2136745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93882 MGI:2136746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93883 MGI:2136747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93884 MGI:2136748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93885 MGI:2136749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93886 MGI:2136750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93887 MGI:2136752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93888 MGI:2136754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93889 MGI:2136756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93890 MGI:2136757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93891 MGI:2136758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93892 MGI:2136759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhb22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93893 MGI:2136760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83885 MGI:2137907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 9 Proteins

name	Taf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24074 MGI:1346348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG666693 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666693 MGI:3647216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins pseudo : _no_value

name	Pcdhg@ (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 22 mRNAs

name	Pcdhga1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93709 MGI:1935212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93710 MGI:1935214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93711 MGI:1935215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93699 MGI:1935169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93712 MGI:1935216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93700 MGI:1935170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93713 MGI:1935217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93714 MGI:1935218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93715 MGI:1935219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93701 MGI:1935173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93716 MGI:1935221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93702 MGI:1935196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93717 MGI:1935226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93703 MGI:1935197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93722 MGI:1935227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93704 MGI:1935199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93723 MGI:1935228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93705 MGI:1935200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhga12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93724 MGI:1935229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93706 MGI:1935201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93707 MGI:1935203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdhgc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93708 MGI:1935205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Diap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13367 MGI:1194490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15183 MGI:1343091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4631403P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225392 MGI:1918044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fchsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319262 MGI:2441771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106952 MGI:2147274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75599 MGI:104692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042583 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 914 ESTs, 9 Proteins

name	1700086O06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73516 MGI:1920766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	0610009O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66839 MGI:1914089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcdh12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53601 MGI:1855700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56736 MGI:1929668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnpda1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26384 MGI:1347054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC240219 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:240219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins

name	Pfdn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802614 GeneID:67199 MGI:1914449
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prefoldin 1 transcript_id : NM_026027.2

name	Hbegf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754177 GeneID:15200 MGI:96070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparin-binding EGF-like growth factor transcript_id : NM_010415.1

name	Slc4a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129949 GeneID:240215 MGI:2443384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4, sodium bicarbonate cotransporter, member 9 transcript_id : NM_172830.2

name	Eif4ebp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892449 GeneID:108112 MGI:1270847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E binding protein 3 transcript_id : NM_201256.3

name	Sra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801852 GeneID:24068 MGI:1344414
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : steroid receptor RNA activator 1 transcript_id : NM_025291.2

name	Apbb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122588 GeneID:225372 MGI:108404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family B, member 3 transcript_id : NM_146085.1

name	Slc35a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031965 GeneID:67843 MGI:1915093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member A4 transcript_id : NM_026404.2

name	Slc35a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031967 GeneID:67843 MGI:1915093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member A4 transcript_id : NM_001083317.1

name	E230025N22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89257349 GeneID:240216 MGI:3687212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Riken cDNA E230025N22 gene transcript_id : NM_172831.2

name	Cd14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129882 GeneID:12475 MGI:88318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD14 antigen transcript_id : NM_009841.3

name	Tmco6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181163 GeneID:71983 MGI:1919233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and coiled-coil domains 6 transcript_id : NM_028036.3

name	Ndufa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372167 GeneID:17991 MGI:1343103
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 transcript_id : NM_010885.3

name	Ik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33468954 GeneID:24010 MGI:1345142
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IK cytokine transcript_id : NM_011879.1

name	Wdr55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980932 GeneID:67936 MGI:1915186
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 55 transcript_id : NM_026464.2

name	Dnd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27734199 GeneID:213236 MGI:2447763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dead end homolog 1 (zebrafish) transcript_id : NM_173383.1

name	Hars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388902 GeneID:15115 MGI:108087
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidyl-tRNA synthetase transcript_id : NM_008214.3

name	Hars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18079342 GeneID:70791 MGI:1918041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histidyl-tRNA synthetase 2, mitochondrial (putative) transcript_id : NM_080636.1

name	Zmat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130302 GeneID:66492 MGI:1913742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, matrin type 2 transcript_id : NM_025594.3

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:16905102 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_054072.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092276 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_198117.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21426880 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_138662.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:133892408 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_007766.2

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:20137001 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009959.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142352474 GeneID:192162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_007767.2

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:23956045 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009957.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092278 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_201243.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21426884 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_138661.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:21426848 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009961.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:23956047 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_009960.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:31077090 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_138663.2

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092280 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_001003671.1

name	Pcdha@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:51092282 GeneID:192162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin alpha cluster transcript_id : NM_001003672.1

name	Pcdhb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716424 GeneID:93872 MGI:2136730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 1 transcript_id : NM_053126.1

name	Pcdhb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866012 GeneID:93873 MGI:2136735
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 2 transcript_id : NM_053127.2

name	Pcdhb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866016 GeneID:93874 MGI:2136737
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 3 transcript_id : NM_053128.2

name	Pcdhb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866008 GeneID:93875 MGI:2136738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 4 transcript_id : NM_053129.3

name	Pcdhb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866013 GeneID:93876 MGI:2136739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 5 transcript_id : NM_053130.3

name	Pcdhb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18087780 GeneID:93877 MGI:2136740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 6 transcript_id : NM_053131.1

name	Pcdhb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189406 GeneID:93878 MGI:2136741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 7 transcript_id : NM_053132.2

name	Pcdhb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716432 GeneID:93879 MGI:2136742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 8 transcript_id : NM_053133.1

name	Pcdhb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866010 GeneID:93880 MGI:2136744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 9 transcript_id : NM_053134.3

name	Pcdhb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866005 GeneID:93881 MGI:2136745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 10 transcript_id : NM_053135.2

name	Pcdhb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189402 GeneID:93882 MGI:2136746
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 11 transcript_id : NM_053136.2

name	Pcdhb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18087786 GeneID:93883 MGI:2136747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 12 transcript_id : NM_053137.1

name	Pcdhb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18087788 GeneID:93884 MGI:2136748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 13 transcript_id : NM_053138.1

name	Pcdhb14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189404 GeneID:93885 MGI:2136749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 14 transcript_id : NM_053139.2

name	Pcdhb15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189399 GeneID:93886 MGI:2136750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 15 transcript_id : NM_053140.2

name	Pcdhb16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189410 GeneID:93887 MGI:2136752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 16 transcript_id : NM_053141.2

name	Pcdhb17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32308224 GeneID:93888 MGI:2136754
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 17 transcript_id : NM_053142.2

name	Pcdhb18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872171 GeneID:93889 MGI:2136756
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 18 transcript_id : NM_053143.2

name	Pcdhb19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89363033 GeneID:93890 MGI:2136757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 19 transcript_id : NM_053144.2

name	Pcdhb20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89994746 GeneID:93891 MGI:2136758
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 20 transcript_id : NM_053145.2

name	Pcdhb21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872174 GeneID:93892 MGI:2136759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 21 transcript_id : NM_053146.2

name	Pcdhb22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189395 GeneID:93893 MGI:2136760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin beta 22 transcript_id : NM_053147.2

name	Slc25a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269721 GeneID:83885 MGI:2137907
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 9 Proteins product : solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 2 transcript_id : XM_111757.7

name	Taf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348602 GeneID:24074 MGI:1346348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_175770.3

name	Taf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755711 GeneID:24074 MGI:1346348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_011901.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087752 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033584.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087754 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033585.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:40254132 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033586.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:34328336 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033574.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:31982597 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033587.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142380298 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033575.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:142378127 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033588.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087762 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033589.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130765 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033590.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087736 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033576.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130786 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033591.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087738 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033577.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130792 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033592.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130767 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033578.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:31982599 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033593.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087742 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033579.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:40538828 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033594.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:18087744 GeneID:192682
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033580.1

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130793 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033595.4

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130764 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033581.3

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:40789290 GeneID:192682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033582.2

name	Pcdhg@ (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:118130787 GeneID:192682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin gamma cluster transcript_id : NM_033583.3

name	Diap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131108 GeneID:13367 MGI:1194490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diaphanous homolog 1 (Drosophila) transcript_id : NM_007858.2

name	Hdac3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89257351 GeneID:15183 MGI:1343091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 3 transcript_id : NM_010411.2

name	4631403P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418898 GeneID:225392 MGI:1918044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4631403P03 gene transcript_id : NM_153793.1

name	Fchsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130311 GeneID:319262 MGI:2441771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FCH and double SH3 domains 1 transcript_id : NM_175684.4

name	Centd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27885014 GeneID:106952 MGI:2147274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 3 transcript_id : NM_139206.1

name	Pcdh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130604 GeneID:75599 MGI:104692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin 1 transcript_id : NM_029357.3

name	LOC100042583 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269776 GeneID:100042583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 914 ESTs, 9 Proteins product : similar to Rpl17 protein transcript_id : XM_001478844.1

name	1700086O06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269778 GeneID:73516 MGI:1920766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 1700086O06 gene transcript_id : XM_001478852.1

name	0610009O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383028 GeneID:66839 MGI:1914089
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610009O20 gene transcript_id : NM_024179.4

name	Pcdh12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444907 GeneID:53601 MGI:1855700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin 12 transcript_id : NM_017378.2

name	Rnf14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910591 GeneID:56736 MGI:1929668
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 14 transcript_id : NM_020012.1

name	Gnpda1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754029 GeneID:26384 MGI:1347054
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosamine-6-phosphate deaminase 1 transcript_id : NM_011937.1

name	LOC240219 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269781 GeneID:240219
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins product : similar to glutamine synthetase transcript_id : XM_001478918.1

name	Pfdn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385532 CCDS:CCDS29152.1 GeneID:67199 MGI:1914449
definition	GO_function : GO:0051082 - unfolded protein binding [Evidence IEA] codon_start : 1 product : prefoldin 1 protein_id : NP_080303.1

name	Hbegf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754178 CCDS:CCDS29153.1 GeneID:15200 MGI:96070
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005154 - epidermal growth factor receptor binding [Evidence IDA]; GO:0008083 - growth factor activity [Evidence IEA] [Evidence IDA]; GO:0008201 - heparin binding [Evidence IDA] [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence NAS]; GO:0001832 - blastocyst growth [Evidence TAS]; GO:0007173 - epidermal growth factor receptor signaling pathway [Evidence IDA]; GO:0051549 - positive regulation of keratinocyte migration [Evidence IMP]; GO:0048661 - positive regulation of smooth muscle cell proliferation [Evidence IDA]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0035313 - wound healing, spreading of epidermal cells [Evidence IMP] codon_start : 1 note : heparin binding epidermal growth factor-like growth factor; diphtheria toxin receptor product : heparin-binding EGF-like growth factor protein_id : NP_034545.1

name	Slc4a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370244 CCDS:CCDS29154.1 GeneID:240215 MGI:2443384
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : solute carrier family 4, sodium bicarbonate cotransporter, member 9 protein_id : NP_766418.1

name	Eif4ebp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054842 CCDS:CCDS29155.1 GeneID:108112 MGI:1270847
definition	GO_function : GO:0008190 - eukaryotic initiation factor 4E binding [Evidence IEA] GO_process : GO:0017148 - negative regulation of protein biosynthesis [Evidence IEA]; GO:0045947 - negative regulation of translational initiation [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 4E binding protein 3 protein_id : NP_957708.1

name	Sra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384640 CCDS:CCDS29156.1 GeneID:24068 MGI:1344414
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] [Evidence ISS]; GO:0005831 - steroid hormone aporeceptor complex [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0030374 - ligand-dependent nuclear receptor transcription coactivator activity [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003712 - transcription cofactor activity [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA] [Evidence ISS]; GO:0030154 - cell differentiation [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : steroid receptor RNA activator 1 protein_id : NP_079567.1

name	Apbb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122589 CCDS:CCDS29157.1 GeneID:225372 MGI:108404
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0043066 - negative regulation of apoptosis [Evidence TAS] codon_start : 1 product : amyloid beta (A4) precursor protein-binding, family B, member 3 protein_id : NP_666197.1

name	Slc35a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031968 GeneID:67843 MGI:1915093
definition	codon_start : 1 product : solute carrier family 35, member A4 protein_id : NP_001076786.1

name	Slc35a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031966 CCDS:CCDS29158.1 GeneID:67843 MGI:1915093
definition	codon_start : 1 product : solute carrier family 35, member A4 protein_id : NP_080680.2

name	E230025N22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89257350 GeneID:240216 MGI:3687212
definition	codon_start : 1 product : hypothetical protein LOC240216 protein_id : NP_766419.2

name	Cd14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753332 CCDS:CCDS29159.1 GeneID:12475 MGI:88318
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 product : CD14 antigen protein_id : NP_033971.1

name	Tmco6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181164 GeneID:71983 MGI:1919233
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : transmembrane and coiled-coil domains 6 protein_id : NP_082312.3

name	Ndufa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981600 CCDS:CCDS29161.1 GeneID:17991 MGI:1343103
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005747 - respiratory chain complex I (sensu Eukaryota) [Evidence TAS] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence TAS]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 note : NADH-ubiquinone oxidoreductase B8 subunit; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 2 (8 kDa) product : NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 protein_id : NP_035015.2

name	Ik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468955 GeneID:24010 MGI:1345142
definition	codon_start : 1 note : arginine/glutamic acid/aspartic acid repeat containing protein product : IK cytokine protein_id : NP_036009.1

name	Wdr55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229061 CCDS:CCDS29162.1 GeneID:67936 MGI:1915186
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WD repeat domain 55 protein_id : NP_080740.2

name	Dnd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734200 CCDS:CCDS29163.1 GeneID:213236 MGI:2447763
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007281 - germ cell development [Evidence IMP] codon_start : 1 note : teratoma product : dead end protein_id : NP_775559.1

name	Hars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982302 CCDS:CCDS29164.1 GeneID:15115 MGI:108087
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0004821 - histidine-tRNA ligase activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006427 - histidyl-tRNA aminoacylation [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : histidyl tRNA synthetase product : histidyl-tRNA synthetase protein_id : NP_032240.2

name	Hars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079343 CCDS:CCDS29165.1 GeneID:70791 MGI:1918041
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : histidyl-tRNA synthetase-like protein_id : NP_542367.1

name	Zmat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385046 GeneID:66492 MGI:1913742
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, matrin type 2 protein_id : NP_079870.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:16905103 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin alpha 1 protein_id : NP_473413.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092277 GeneID:192162
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin alpha 2 protein_id : NP_932785.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426881 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin alpha 3 protein_id : NP_619603.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:6681021 GeneID:192162
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 1 product : protocadherin alpha 4 protein_id : NP_031792.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:20137002 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 6 product : protocadherin alpha 5 protein_id : NP_034089.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:6681023 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cadherin-related neuronal receptor 2 product : protocadherin alpha 6 protein_id : NP_031793.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:23956046 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 4 product : protocadherin alpha 7 protein_id : NP_034087.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092279 GeneID:192162
definition	GO_component : GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin alpha 8 protein_id : NP_957695.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426885 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin alpha 9 protein_id : NP_619602.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426849 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 3; protocadherin alpha 14 product : protocadherin alpha 10 protein_id : NP_034091.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:23956048 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 7 product : protocadherin alpha 11 protein_id : NP_034090.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:21426883 CCDS:CCDS29166.1 GeneID:192162
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : cadherin-related neuronal receptor 5; protocadherin alpha 13 product : protocadherin alpha 12 protein_id : NP_619604.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092281 CCDS:CCDS29167.1 GeneID:192162
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : protocadherin alpha C1 product : protocadherin alpha subfamily C, 1 protein_id : NP_001003671.1

name	Pcdha@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51092283 CCDS:CCDS29168.1 GeneID:192162
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : protocadherin alpha C2 product : protocadherin alpha subfamily C, 2 protein_id : NP_001003672.1

name	Pcdhb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716425 CCDS:CCDS29169.1 GeneID:93872 MGI:2136730
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 1 protein_id : NP_444356.1

name	Pcdhb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716427 CCDS:CCDS29170.1 GeneID:93873 MGI:2136735
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 2 protein_id : NP_444357.1

name	Pcdhb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866017 CCDS:CCDS29171.1 GeneID:93874 MGI:2136737
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 3 protein_id : NP_444358.2

name	Pcdhb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866009 CCDS:CCDS29172.1 GeneID:93875 MGI:2136738
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 4 protein_id : NP_444359.3

name	Pcdhb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716429 CCDS:CCDS29173.1 GeneID:93876 MGI:2136739
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : Protocadherin-betaE; cell-cell adhesion molecule product : protocadherin beta 5 protein_id : NP_444360.1

name	Pcdhb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087781 CCDS:CCDS29174.1 GeneID:93877 MGI:2136740
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin beta 6 protein_id : NP_444361.1

name	Pcdhb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189407 GeneID:93878 MGI:2136741
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin beta 7 protein_id : NP_444362.2

name	Pcdhb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716433 CCDS:CCDS29175.1 GeneID:93879 MGI:2136742
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 8 protein_id : NP_444363.1

name	Pcdhb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866011 GeneID:93880 MGI:2136744
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 9 protein_id : NP_444364.3

name	Pcdhb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087783 CCDS:CCDS29177.1 GeneID:93881 MGI:2136745
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 10 protein_id : NP_444365.1

name	Pcdhb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189403 CCDS:CCDS29178.1 GeneID:93882 MGI:2136746
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin beta 11 protein_id : NP_444366.2

name	Pcdhb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087787 GeneID:93883 MGI:2136747
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 12 protein_id : NP_444367.1

name	Pcdhb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087789 CCDS:CCDS29179.1 GeneID:93884 MGI:2136748
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 13 protein_id : NP_444368.1

name	Pcdhb14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189405 CCDS:CCDS29180.1 GeneID:93885 MGI:2136749
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Protocadherin-betaN; cell-cell adhesion molecule product : protocadherin beta 14 protein_id : NP_444369.2

name	Pcdhb15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087793 CCDS:CCDS29181.1 GeneID:93886 MGI:2136750
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 15 protein_id : NP_444370.1

name	Pcdhb16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189411 CCDS:CCDS29182.1 GeneID:93887 MGI:2136752
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Protocadherin-betaP; cell-cell adhesion molecule product : protocadherin beta 16 protein_id : NP_444371.2

name	Pcdhb17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32308225 CCDS:CCDS29183.1 GeneID:93888 MGI:2136754
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 17 protein_id : NP_444372.2

name	Pcdhb18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087797 CCDS:CCDS29184.1 GeneID:93889 MGI:2136756
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 18 protein_id : NP_444373.1

name	Pcdhb19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89363034 CCDS:CCDS29185.1 GeneID:93890 MGI:2136757
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 19 protein_id : NP_444374.2

name	Pcdhb20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89994747 GeneID:93891 MGI:2136758
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 20 protein_id : NP_444375.2

name	Pcdhb21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087803 CCDS:CCDS29186.1 GeneID:93892 MGI:2136759
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : protocadherin beta 21 protein_id : NP_444376.1

name	Pcdhb22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189396 CCDS:CCDS29187.1 GeneID:93893 MGI:2136760
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin beta 22 protein_id : NP_444377.2

name	Slc25a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269722 GeneID:83885 MGI:2137907
definition	codon_start : 1 product : mutant ornithine transporter 2 protein_id : XP_111757.4

name	Taf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755712 CCDS:CCDS29189.1 GeneID:24074 MGI:1346348
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : TATA box binding protein (TBP) associated factor, RNA polymerase II, F, 55 kDa; TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55 kDa product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_036031.1

name	Taf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28461141 CCDS:CCDS29189.1 GeneID:24074 MGI:1346348
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : TATA box binding protein (TBP) associated factor, RNA polymerase II, F, 55 kDa; TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 55 kDa product : TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_786964.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087753 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 1 protein_id : NP_291062.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087755 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 2 protein_id : NP_291063.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087757 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 3 protein_id : NP_291064.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:34328337 GeneID:192682
definition	GO_component : GO:0030426 - growth cone [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin gamma subfamily B, 1 protein_id : NP_291052.2

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:31982598 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin gamma subfamily A, 4 protein_id : NP_291065.2

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087735 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : 3' RACE product; protocadherin gamma B2 product : protocadherin gamma subfamily B, 2 protein_id : NP_291053.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087761 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 5 protein_id : NP_291066.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087763 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 6 protein_id : NP_291067.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:50878294 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 7 protein_id : NP_291068.2

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087737 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : protocadherin gamma C-VI product : protocadherin gamma subfamily B, 4 protein_id : NP_291054.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087767 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 8 protein_id : NP_291069.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087739 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily B, 5 protein_id : NP_291055.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087769 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 9 protein_id : NP_291070.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087741 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily B, 6 protein_id : NP_291056.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087771 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 10 protein_id : NP_291071.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087743 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily B, 7 protein_id : NP_291057.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087773 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily A, 11 protein_id : NP_291072.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087745 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : protocadherin gamma subfamily B, 8 protein_id : NP_291058.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087775 CCDS:CCDS29191.1 GeneID:192682
definition	GO_component : GO:0005911 - intercellular junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence ISS]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : protocadherin 13; protocadherin gamma A12; protocadherin gamma B6 product : protocadherin gamma subfamily A, 12 protein_id : NP_291073.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087747 CCDS:CCDS29192.1 GeneID:192682
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0005911 - intercellular junction [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence TAS] codon_start : 1 note : protocadherin 2 product : protocadherin gamma subfamily C, 3 protein_id : NP_291059.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087749 CCDS:CCDS29193.1 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily C, 4 protein_id : NP_291060.1

name	Pcdhg@ (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:18087751 CCDS:CCDS29194.1 GeneID:192682
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : protocadherin gamma subfamily C, 5 protein_id : NP_291061.1

name	Diap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681183 GeneID:13367 MGI:1194490
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0030041 - actin filament polymerization [Evidence IDA]; GO:0016043 - cell organization and biogenesis [Evidence IEA] codon_start : 1 product : diaphanous homolog 1 protein_id : NP_031884.1

name	Hdac3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89257352 GeneID:15183 MGI:1343091
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004407 - histone deacetylase activity [Evidence TAS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence TAS] [Evidence IEA]; GO:0016575 - histone deacetylation [Evidence IEA]; GO:0007346 - regulation of progression through mitotic cell cycle [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone deacetylase 3 protein_id : NP_034541.2

name	4631403P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418899 CCDS:CCDS29195.1 GeneID:225392 MGI:1918044
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC225392 protein_id : NP_722488.1

name	Fchsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254312 GeneID:319262 MGI:2441771
definition	GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : FCH and double SH3 domains 1 protein_id : NP_783615.2

name	Centd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27885015 CCDS:CCDS29196.1 GeneID:106952 MGI:2147274
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0008060 - ARF GTPase activator activity [Evidence IDA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0030675 - Rac GTPase activator activity [Evidence IDA]; GO:0005100 - Rho GTPase activator activity [Evidence IDA] GO_process : GO:0030336 - negative regulation of cell migration [Evidence IDA]; GO:0035021 - negative regulation of Rac protein signal transduction [Evidence IDA]; GO:0035024 - negative regulation of Rho protein signal transduction [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dual-specificity Rho- and Arf-GTPase activating protein 1; ARF-GAP, RHO-GAP, ankyrin repeat and plekstrin homology domains-containing protein 3 product : ARF-GAP, RHO-GAP, ankyrin repeat and pleckstrin homology domains-containing protein 3 protein_id : NP_631945.1

name	Pcdh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328319 CCDS:CCDS29197.1 GeneID:75599 MGI:104692
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0005911 - intercellular junction [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence TAS]; GO:0007156 - homophilic cell adhesion [Evidence TAS] codon_start : 1 product : protocadherin 1 protein_id : NP_083633.2

name	1700086O06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269779 GeneID:73516 MGI:1920766
definition	codon_start : 1 product : hypothetical protein LOC73516 protein_id : XP_001478902.1

name	LOC100042583 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269777 GeneID:100042583
definition	codon_start : 1 product : similar to Rpl17 protein protein_id : XP_001478894.1

name	0610009O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560224 GeneID:66839 MGI:1914089
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66839 protein_id : NP_077141.2

name	Pcdh12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444908 CCDS:CCDS29199.1 GeneID:53601 MGI:1855700
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005911 - intercellular junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0016339 - calcium-dependent cell-cell adhesion [Evidence IDA]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IDA] codon_start : 1 note : protocadherin 14; VE-cadherin-2; vascular endothelial cadherin-2 product : protocadherin 12 protein_id : NP_059074.2

name	Rnf14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910592 CCDS:CCDS29200.1 GeneID:56736 MGI:1929668
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0019787 - small conjugating protein ligase activity [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007165 - signal transduction [Evidence ISS]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TRIAD2 type I product : ring finger protein 14 protein_id : NP_064396.1

name	Gnpda1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754030 CCDS:CCDS29201.1 GeneID:26384 MGI:1347054
definition	GO_function : GO:0004342 - glucosamine-6-phosphate deaminase activity [Evidence IEA] [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007340 - acrosome reaction [Evidence TAS]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006002 - fructose 6-phosphate metabolism [Evidence ISS]; GO:0046370 - fructose biosynthesis [Evidence ISS]; GO:0006041 - glucosamine metabolism [Evidence ISS]; GO:0006044 - N-acetylglucosamine metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glucose-6-phosphate isomerase product : glucosamine-6-phosphate deaminase 1 protein_id : NP_036067.1

name	LOC240219 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269782 GeneID:240219
definition	codon_start : 1 product : similar to glutamine synthetase protein_id : XP_001478968.1

name	LOC624979 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149269757 GeneID:624979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 299 ESTs, 9 Proteins product : similar to Proteasome subunit alpha type 4 (Proteasome component C9) (Macropain subunit C9) (Multicatalytic endopeptidase complex subunit C9) (Proteasome subunit L) pseudo : _no_value transcript_id : XR_033566.1

name	EG627427 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149269720 GeneID:627427 MGI:3647509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 175 ESTs, 5 Proteins product : predicted gene, EG627427 transcript_id : XR_032902.1

name	EG666693 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94404394 GeneID:666693 MGI:3647216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : predicted gene, EG666693 pseudo : _no_value transcript_id : XR_001910.1

clone name	MSMg01-405L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192B09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-320B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-405H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-446E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-186O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440B13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-092J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-191G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-024H04.b	B6Ng01-024H04.g
ACC	DH856079	DH856080
length	1,021	949
definition	DH856079\|Mus musculus domesticus DNA, BAC clone: B6Ng01-024H04, 5' end.	DH856080\|Mus musculus domesticus DNA, BAC clone: B6Ng01-024H04, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccattaacttgtaaactagtttgagggttatctctaatatccagt cttcaagtagacacacacttcgtccttagataggtctcctataatttcct tcagtgttgcctagtgatctgtatgaaatttgtctacacacttgtttgct tcctttctaaacatcctgctcctttagattccaagggacttttccctcat gtccactttgtccaatgctaacatgcagaggtgattaatctttggataat gatcttctattgtatgcacttgctgaatttgttcattaatgttaacattt ttgcagattatttagaattttatacatgcaaggccacaccatctatacat agagaagtctataaaagtatagttttccacttctaattatcagattatct gaaatgcttttctgcattgtgacatttatccataaggcatatttaattat ttatcattgtatgttgagccagtatgttcccaggtaaatcctttacagct ttggaatgtaatctcatttttttcactgatatatggcttatttataattg tgcctcaaagattttaaaatacatgaatctttccagttatcttttttaaa ttaggtatttatttcatttacatttccaatgctatcccaaaggtccccca accatcccccccactcccctacccacccactcccactttttggccctggc gttcccctgtactggagtatataaagtttgcctgtcaaataggcctctct ttccagtgatggccaactaggccatcttttgatacatatgcaactagagt caagagctctggggtactggttagttcataatgttgtccacctatagggt tgcagatccctttagctccttgggtactttctctagctcctccactgggg gccctgtgatccatccaatactgactatgagcatccactctgtgtttgca aggcccggcatatctcacagagacagctatatctgggtcctttcagcaaa atcttgctagtgatgcaatgt	gaattcttaaaagaggaaactcaaatggccgaaaaacaaagaaatgttca acatcctcagccatcagggaaatggaaatcaaaactactctcagatttca tctcacacctgtcagaattactaagataaacaaactaagtgacagctcat gctggtaagaatgtgaagtcaagagaacactcatccattgctgtgggggt accaccttgtacagccgccatggaagtcaaatggcagtccctaagaaggt tgggaatcaatctatctcaagatccagctatacccctcttgggtaaattc ccaaagcatgttttatcctaccataaggacttgctcaaccatgttcattg ctgctttattcttaatagccagaaattgaacagccaagatgttcttcaaa gaagaatggataagtaaaatgtggtacaattaacacaatggagtatgaaa tttgcaggtaagtgggtggaactagaaaaaaaaatcatctcgaatgaggc attccagacacagaaagagaaatattgtatgtatttacttatttgtggct attatttgctatgtcaatgataaccaaggtacaatcagtagaatcacaga ggttaggcatagagtaagggactagggcaagtggttcttagctttccttg tgctgcaaccctttaacacagttctgcatattgtggtgacctctagccat caaattatttcgttgctacttcataactataactttgctgctgttgtgaa ttgtaatataaatatctgatgtgtaagaaatttgatatgtgaccctcaaa gaagtctcaacccacaggttgagaactgatggactagggattacatacat acagatctcactaggaaaggaaaatgcaatagagatttattgatggatgg gtcagccagaataggagaataaactggtgaggggatgggagagagggac
quality values	Open. Hide. 47 42 23 24 22 14 17 7 15 24 61 47 61 61 61 35 55 55 61 61 61 61 49 49 61 61 41 40 23 28 44 23 30 59 61 59 59 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 44 59 61 61 61 61 61 61 59 61 59 59 59 59 59 59 59 61 59 59 55 55 55 59 59 61 59 61 59 59 28 55 59 59 43 41 49 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 61 59 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 55 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 47 37 61 52 61 61 61 47 61 61 61 53 38 61 61 52 61 52 61 61 61 61 53 52 61 61 61 61 61 50 61 61 61 53 61 61 50 47 61 27 39 61 61 61 61 61 53 61 61 61 61 53 61 53 53 50 61 53 50 61 61 50 47 47 47 53 47 47 45 43 45 43 50 47 50 50 46 42 42 45 45 46 61 61 61 61 53 61 50 28 42 33 45 43 36 36 47 47 46 45 20 14 15 8 22 17 35 45 53 53 52 57 45 53 53 40 50 52 45 24 19 16 10 16 9 10 31 28 39 53 36 36 27 53 45 42 45 10 18 28 47 53 50 38 38 34 45 38 32 32 24 27 50 53 40 45 52 14 8 53 36 37 42 33 47 10 26 26 30 23 32 32 24 47 57 19 29 40 42 33 50 24 42 38 37 28 30 14 15 24 39 41 29 32 14 33 30 30 30 14 52 27 40 50 52 47 50 57 57 53 23 34 30 38 39 41 40 25 47 30 37 39 30 32 36 23 43 22 50 18 38 24 34 23 36 21 24 37 28 31 36 40 22 57 11 11 35 33 19 35 14 14 17 17 22 20 16 28 33 24 19 22 23 34 30 39 18 25 33 30 11 27 15 9 45 53 35 30 53 33 31 28 22 37 11 37 37 36 28 27 21 31 24 33 39 39 27 13 48 31 30 36 18 20 24 23 9 47 22 30 21 14 17 30 18 24 9 9 11 38 18 14 12 29 27 29 15 25 18 14 23 15 10 8 34 9 10 7 7 7 10 46 25 28 13 7 10 15 18 40 36 30 13 20 5 5 12 15 20 20 13 26 29 14 37 7 36 7 31 14 24 21 21 7 10 14 8 14 11 5 36 46 28 20 24 29 28 51 21 18 16 6 17 10 29 29 29 29 24 29 25 27 14 15 27 23 17 16 15 11 14 16 17 32 8 17 6	Open. Hide. 43 23 52 59 59 43 43 43 36 36 27 27 21 36 29 52 59 59 59 59 61 59 44 49 59 59 61 61 59 61 59 61 59 61 61 61 59 59 59 61 45 59 59 59 59 59 59 59 59 44 55 59 59 59 59 59 55 55 52 59 59 61 59 59 59 59 49 55 34 34 59 61 61 59 61 61 61 61 61 59 59 59 59 61 61 61 61 61 59 61 61 61 59 59 59 61 61 61 61 59 59 61 61 61 59 61 59 61 61 61 61 59 59 59 52 61 59 61 61 59 61 61 59 59 52 59 61 59 61 61 61 59 61 61 61 61 59 59 59 59 61 61 61 59 59 59 61 59 59 59 61 55 44 55 61 59 59 59 59 59 59 61 61 59 59 61 61 61 61 61 59 61 61 59 59 59 59 59 59 59 55 61 59 59 59 59 59 59 59 59 59 59 61 59 59 59 61 61 61 61 61 61 61 59 59 59 55 59 59 59 59 59 59 59 59 61 59 61 61 59 61 61 59 59 61 59 61 61 59 59 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 55 55 55 55 55 55 52 55 61 61 55 61 61 61 61 61 61 55 55 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 43 61 61 61 61 53 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 57 57 50 57 57 46 57 50 53 53 57 53 57 57 57 53 57 53 57 57 57 47 47 57 57 57 57 53 53 53 53 47 38 53 53 57 57 53 57 37 47 57 57 53 46 53 53 50 57 53 47 57 52 57 34 30 47 23 43 38 57 53 53 53 53 45 52 50 45 47 47 53 57 53 47 57 52 50 37 53 53 53 57 57 47 47 57 53 45 52 53 50 57 53 45 38 33 33 52 57 57 53 50 57 50 50 53 45 53 52 52 52 37 47 30 53 57 34 33 46 38 39 53 47 38 52 50 27 38 57 53 50 50 52 33 52 42 47 57 57 40 52 41 38 52 50 30 57 50 53 50 52 27 50 50 33 52 42 22 41 38 29 40 42 50 57 52 53 21 20 34 47 37 40 32 47 53 52 40 33 40 37 53 40 44 52 37 53 52 40 40 57 57 53 42 41 41 33 42 53 36 52 48 30 41 39 30 36 46 34 19 37 47 37 40 37 29 57 57 37 40 33 53 44 36 44 22 47 32 37 35 26 37 30 53 57 40 34 51 31 32 39 29 32 32 30 32 26 30 29 46 51 32 29 21 45 40 24 39 44 20 29 38 41 32 29 12 14 51 25 13 29 37 29 33 28 39 29 31 23 29 30 24 29 31 25 20 30 23 29 28 29 29 9 46 29 23 21 48 28 29 25 29 25 29 21 36 23 41 22 29 26 27 38 38 33 23 29 35 17 9 17 43 51 30 28 29 19 51 51 29 25 29 27 23 26 31 34 16 46 14 28 20 46 38 16 23 33 29 28 30 33 39 19 22 33 51 33 21 28 11 10 7 29 28 14 39 23 29 12 22 13 33 15 43 29 28 22 51 18 21 27 33 32 28 24 29 29 51 41 41 25 22 31 41 19 13 14 29 6 30 10 24 18 7 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr18_37558419_37559445
seq2: B6Ng01-024H04.b_31_1050 (reverse)

seq1  CATTGCATACACTAGCAAGATTTTGCTGAAAGGACCCAGATATAGCTGTC  50
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  CATTGCAT-CACTAGCAAGATTTTGCTGAAAGGACCCAGATATAGCTGTC  49

seq1  TCTTGTGAGACTATGCCGGGGCCTAGCAAACACAGAAGTGGATGCTCATA  100
      || ||||||| |||||| |||||| |||||||||| ||||||||||||||
seq2  TC-TGTGAGA-TATGCC-GGGCCTTGCAAACACAG-AGTGGATGCTCATA  95

seq1  GTCAGCTATTGGATGGATCACAGGGCCCCCAGTGGAGGAGCTAGAGAAAG  150
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAG-TATTGGATGGATCACAGGGCCCCCAGTGGAGGAGCTAGAGAAAG  144

seq1  TACCCAAGGAGCTAAAGGGATCTGCAACCCTATAGGTGGAACAACATTAT  200
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  TACCCAAGGAGCTAAAGGGATCTGCAACCCTATAGGTGG-ACAACATTAT  193

seq1  GAACTAACCAGTACCCCAGAGCTCTTGACTCTAGTTGCATATGTATCAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTAACCAGTACCCCAGAGCTCTTGACTCTAGTTGCATATGTATCAAA  243

seq1  AGATGGCCTAGTTGGCCATCACTGGAAAGAGAGGCCTATTTGACAGGCAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGGCCTAGTTGGCCATCACTGGAAAGAGAGGCCTATTTGACAGGCAA  293

seq1  ACTTTATATACTCCAGTACAGGGGAACGCCAGGGCCAAAAAGTGGGAGTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTATATACTCCAGTACAGGGGAACGCCAGGGCCAAAAAGTGGGAGTG  343

seq1  GGTGGGTAGGGGAGTGGGGGGGATGGTTGGGGGACCTTTGGGATAGCATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGGTAGGGGAGTGGGGGGGATGGTTGGGGGACCTTTGGGATAGCATT  393

seq1  GGAAATGTAAATGAAATAAATACCTAATTTAAAAAAGATAACTGGAAAGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAATGTAAATGAAATAAATACCTAATTTAAAAAAGATAACTGGAAAGA  443

seq1  TTCATGTATTTTAAAATCTTTGAGGCACAATTATAAATAAGCCATATATC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATGTATTTTAAAATCTTTGAGGCACAATTATAAATAAGCCATATATC  493

seq1  AGTGAAAAAAATGAGATTACATTCCAAAGCTGTAAAGGATTTACCTGGGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAAAAAAATGAGATTACATTCCAAAGCTGTAAAGGATTTACCTGGGA  543

seq1  ACATACTGGCTCAACATACAATGATAAATAATTAAATATGCCTTATGGAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATACTGGCTCAACATACAATGATAAATAATTAAATATGCCTTATGGAT  593

seq1  AAATGTCACAATGCAGAAAAGCATTTCAGATAATCTGATAATTAGAAGTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTCACAATGCAGAAAAGCATTTCAGATAATCTGATAATTAGAAGTG  643

seq1  GAAAACTATACTTTTATAGACTTCTCTATGTATAGATGGTGTGGCCTTGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAACTATACTTTTATAGACTTCTCTATGTATAGATGGTGTGGCCTTGC  693

seq1  ATGTATAAAATTCTAAATAATCTGCAAAAATGTTAACATTAATGAACAAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTATAAAATTCTAAATAATCTGCAAAAATGTTAACATTAATGAACAAA  743

seq1  TTCAGCAAGTGCATACAATAGAAGATCATTATCCAAAGATTAATCACCTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGCAAGTGCATACAATAGAAGATCATTATCCAAAGATTAATCACCTC  793

seq1  TGCATGTTAGCATTGGACAAAGTGGACATGAGGGAAAAGTCCCTTGGAAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATGTTAGCATTGGACAAAGTGGACATGAGGGAAAAGTCCCTTGGAAT  843

seq1  CTAAAGGAGCAGGATGTTTAGAAAGGAAGCAAACAAGTGTGTAGACAAAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAAGGAGCAGGATGTTTAGAAAGGAAGCAAACAAGTGTGTAGACAAAT  893

seq1  TTCATACAGATCACTAGGCAACACTGAAGGAAATTATAGGAGACCTATCT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATACAGATCACTAGGCAACACTGAAGGAAATTATAGGAGACCTATCT  943

seq1  AAGGACGAAGTGTGTGTCTACTTGAAGACTGGATATTAGAGATAACCCTC  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGACGAAGTGTGTGTCTACTTGAAGACTGGATATTAGAGATAACCCTC  993

seq1  AAACTAGTTTACAAGTTAATGGAATTC  1027
      |||||||||||||||||||||||||||
seq2  AAACTAGTTTACAAGTTAATGGAATTC  1020

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information