MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-093D09
Chromosome	10 (Build37)	18 (Build37)
Map Location	80,099,415 - 80,100,521	41,472,848 - 41,473,512
singlet/doublet	singlet	singlet
Overlap gene	Csnk1g2
Upstream gene	Shc2, Gm1157, Madcam1, Gtrgeo22, Cdc34, Gzmm, Bsg, Hcn2, Polrmt, Fgf22, Rnf126, Fstl3, Prssl1, Palm, 9130017N09Rik, Ptbp1, BC005764, Prtn3, Ela2, Cfd, Thrap5, C030046I01Rik, Kiss1r, Arid3a, Wdr18, Grin3b, ORF61, Cnn2, Abca7, Hmha1, Polr2e, Gpx4, Sbno2, Stk11, Dos, Atp5d, Midn, Cirbp, 1600002K03Rik, Efna2, Mum1, Ndufs7, Gamt, Dazap1, Rps15, Apc2, 2310011J03Rik, Pcsk4, Reep6, Adamtsl5, 6330514A18Rik, Rkhd1, Mbd3, Uqcr, Tcfe2a, Onecut3, Atp8b3, Rexo1, Klf16, D10Bwg1364e, Scamp4
Downstream gene	Btbd2, Mknk2, Mobkl2a, 9030607L17Rik, Ap3d1, Dot1l, Plekhj1, Sf3a2, Amh, Jsrp1, Oaz1, BC072620, Lsm7, 3110056O03Rik, Tmprss9, Timm13, Lmnb2, Gadd45b, Gng7, LOC100042403, Diras1, Slc39a3, Sgta, Thop1, Creb3l3, Map2k2, Zbtb7a, Pias4, Eef2, Dapk3, Itgb1bp3, Atcay, 9130206N08Rik, Matk, Mrpl54, Apba3, Tjp3, Pip5k1c, 2510012J08Rik, Tbxa2r, Gipc3, Hmg20b, F630110N24Rik, 4930404N11Rik, Fzr1, Dohh, 2210404O07Rik, Nfic, Brunol5, Ncln, Edg6, Gna15, Gna11, Aes, Tle2, Tle6, BC025920, Sirt6, Ankrd24
Link	Open Mouse BAC browser

Click to get alignment info.

name	Shc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216148 MGI:106180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 57 ESTs, 12 Proteins

name	Gm1157 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382384 MGI:2686003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Madcam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17123 MGI:103579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtrgeo22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110012 MGI:106618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216150 MGI:102657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gzmm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16904 MGI:99549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bsg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12215 MGI:88208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15166 MGI:1298210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polrmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216151 MGI:1915843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgf22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67112 MGI:1914362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf126 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70294 MGI:1917544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fstl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83554 MGI:1890391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prssl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73106 MGI:1920356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Palm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18483 MGI:1261814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130017N09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78906 MGI:1926156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19205 MGI:97791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC005764 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216152 MGI:2388640
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prtn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19152 MGI:893580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ela2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50701 MGI:2679229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cfd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11537 MGI:87931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thrap5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216154 MGI:2158394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030046I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109284 MGI:1924814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kiss1r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114229 MGI:2148793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arid3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13496 MGI:1328360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216156 MGI:2158400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grin3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170483 MGI:2150393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ORF61 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216157 MGI:2177957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12798 MGI:105093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abca7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27403 MGI:1351646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70719 MGI:1917969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66420 MGI:1913670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625249 MGI:104767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sbno2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216161 MGI:2448490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stk11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20869 MGI:1341870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dos (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216164 MGI:1354170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66043 MGI:1913293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Midn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59090 MGI:1890222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cirbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12696 MGI:893588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1600002K03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69770 MGI:1917020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efna2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13637 MGI:102707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mum1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68114 MGI:1915364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufs7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75406 MGI:1922656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gamt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14431 MGI:1098221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dazap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70248 MGI:1917498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20054 MGI:98117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23805 MGI:1346052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310011J03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66374 MGI:1913624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcsk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18551 MGI:97514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Reep6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70335 MGI:1917585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamtsl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66548 MGI:1913798
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6330514A18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216166 MGI:3026984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rkhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237400 MGI:2681847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mbd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17192 MGI:1333812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uqcr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66594 MGI:1913844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcfe2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21423 MGI:98510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Onecut3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246086 MGI:1891409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp8b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67331 MGI:1914581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rexo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66932 MGI:1914182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klf16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:118445 MGI:2153049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D10Bwg1364e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216169 MGI:106388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scamp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56214 MGI:1928947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csnk1g2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103236 MGI:1920014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208198 MGI:1933831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 124 ESTs, 22 Proteins

name	Mknk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17347 MGI:894279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mobkl2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208228 MGI:3050117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030607L17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71564 MGI:1918814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap3d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11776 MGI:107734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dot1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208266 MGI:2143886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhj1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78670 MGI:1925920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf3a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20222 MGI:104912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11705 MGI:88006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jsrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71912 MGI:1916700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oaz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18245 MGI:109433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC072620 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237403 MGI:3609246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66094 MGI:1913344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110056O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73218 MGI:1920468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432478 MGI:3612246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30055 MGI:1353432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lmnb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16907 MGI:96796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gadd45b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17873 MGI:107776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gng7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14708 MGI:95787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042403 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Diras1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208666 MGI:2183442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc39a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106947 MGI:2147269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52551 MGI:1098703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thop1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50492 MGI:1354165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Creb3l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208677 MGI:2384786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map2k2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26396 MGI:1346867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zbtb7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16969 MGI:1335091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pias4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59004 MGI:2136940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eef2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13629 MGI:95288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dapk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13144 MGI:1203520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb1bp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69564 MGI:1916814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atcay (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16467 MGI:2448730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130206N08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103406 MGI:2143792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17179 MGI:99259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66047 MGI:1913297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apba3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57267 MGI:1888527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tjp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27375 MGI:1351650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip5k1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18717 MGI:1298224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2510012J08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70312 MGI:1917562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbxa2r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21390 MGI:98496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gipc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209047 MGI:2387006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmg20b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15353 MGI:1341190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F630110N24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73822 MGI:3604804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930404N11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432479 MGI:1921072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fzr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56371 MGI:1926790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dohh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102115 MGI:1915964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210404O07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72273 MGI:1919523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 41 ESTs, 1 Protein

name	Nfic (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18029 MGI:109591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Brunol5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319586 MGI:2442333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins

name	Ncln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103425 MGI:1926081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edg6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13611 MGI:1333809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gna15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14676 MGI:95770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gna11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14672 MGI:95766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aes (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14797 MGI:95806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tle2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21886 MGI:104635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tle6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114606 MGI:2149593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025920 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268319 MGI:2670983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50721 MGI:1354161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70615 MGI:1890394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261011 GeneID:216148 MGI:106180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 57 ESTs, 12 Proteins product : src homology 2 domain-containing transforming protein C2 transcript_id : XM_001478431.1

name	Gm1157 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378777 GeneID:382384 MGI:2686003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1157, (NCBI) transcript_id : NM_001033473.2

name	Madcam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305250 GeneID:17123 MGI:103579
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucosal vascular addressin cell adhesion molecule 1 transcript_id : NM_013591.1

name	Gtrgeo22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114051828 GeneID:110012 MGI:106618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene trap ROSA b-geo 22 transcript_id : NM_148934.2

name	Cdc34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341237 GeneID:216150 MGI:102657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 34 homolog (S. cerevisiae) transcript_id : NM_177613.2

name	Gzmm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982834 GeneID:16904 MGI:99549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granzyme M (lymphocyte met-ase 1) transcript_id : NM_008504.2

name	Bsg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116014344 GeneID:12215 MGI:88208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basigin transcript_id : NM_009768.2

name	Bsg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116014341 GeneID:12215 MGI:88208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basigin transcript_id : NM_001077184.1

name	Hcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88014633 GeneID:15166 MGI:1298210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyperpolarization-activated, cyclic nucleotide-gated K+ 2 transcript_id : NM_008226.2

name	Polrmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362326 GeneID:216151 MGI:1915843
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) mitochondrial (DNA directed) transcript_id : NM_172551.2

name	Fgf22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963626 GeneID:67112 MGI:1914362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 22 transcript_id : NM_023304.1

name	Rnf126 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362320 GeneID:70294 MGI:1917544
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 126 transcript_id : NM_144528.1

name	Fstl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878202 GeneID:83554 MGI:1890391
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : follistatin-like 3 transcript_id : NM_031380.1

name	Prssl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607468 GeneID:73106 MGI:1920356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine-like 1 transcript_id : NM_001042710.1

name	Palm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801708 GeneID:18483 MGI:1261814
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paralemmin transcript_id : NM_023128.3

name	9130017N09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892954 GeneID:78906 MGI:1926156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130017N09 gene transcript_id : NM_030218.2

name	Ptbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517300 GeneID:19205 MGI:97791
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polypyrimidine tract binding protein 1 transcript_id : NM_001077363.1

name	Ptbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517302 GeneID:19205 MGI:97791
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polypyrimidine tract binding protein 1 transcript_id : NM_008956.2

name	BC005764 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129206 GeneID:216152 MGI:2388640
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC005764 transcript_id : NM_181681.1

name	Prtn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981541 GeneID:19152 MGI:893580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteinase 3 transcript_id : NM_011178.2

name	Ela2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052443 GeneID:50701 MGI:2679229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elastase 2, neutrophil transcript_id : NM_015779.2

name	Cfd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304866 GeneID:11537 MGI:87931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : complement factor D (adipsin) transcript_id : NM_013459.1

name	Thrap5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674219 GeneID:216154 MGI:2158394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor associated protein 5 transcript_id : NM_198107.1

name	C030046I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109627659 GeneID:109284 MGI:1924814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030046I01 gene transcript_id : NM_177994.4

name	Kiss1r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803379 GeneID:114229 MGI:2148793
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : KISS1 receptor transcript_id : NM_053244.3

name	Arid3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801949 GeneID:13496 MGI:1328360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 3A (Bright like) transcript_id : NM_007880.3

name	Wdr18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801725 GeneID:216156 MGI:2158400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 18 transcript_id : NM_175450.4

name	Grin3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53759069 GeneID:170483 MGI:2150393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, NMDA3B transcript_id : NM_130455.2

name	ORF61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114051543 GeneID:216157 MGI:2177957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 61 transcript_id : NM_001003949.3

name	Cnn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116268119 GeneID:12798 MGI:105093
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calponin 2 transcript_id : NM_007725.2

name	Abca7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15451839 GeneID:27403 MGI:1351646
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family A (ABC1), member 7 transcript_id : NM_013850.1

name	Hmha1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328299 GeneID:70719 MGI:1917969
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histocompatibility (minor) HA-1 transcript_id : NM_027521.2

name	Polr2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249076 GeneID:66420 MGI:1913670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide E transcript_id : NM_025554.2

name	Gpx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90903234 GeneID:625249 MGI:104767
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione peroxidase 4 transcript_id : NM_008162.2

name	Gpx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90903232 GeneID:625249 MGI:104767
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione peroxidase 4 transcript_id : NM_001037741.2

name	Sbno2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34556192 GeneID:216161 MGI:2448490
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : strawberry notch homolog 2 (Drosophila) transcript_id : NM_183426.1

name	Stk11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354976 GeneID:20869 MGI:1341870
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 11 transcript_id : NM_011492.2

name	Dos (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71895066 GeneID:216164 MGI:1354170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : downstream of Stk11 transcript_id : NM_015761.1

name	Atp5d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21536219 GeneID:66043 MGI:1913293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit transcript_id : NM_025313.1

name	Midn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10947007 GeneID:59090 MGI:1890222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : midnolin transcript_id : NM_021565.1

name	Cirbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893062 GeneID:12696 MGI:893588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cold inducible RNA binding protein transcript_id : NM_007705.2

name	1600002K03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367692 GeneID:69770 MGI:1917020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600002K03 gene transcript_id : NM_027207.2

name	Efna2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677399 GeneID:13637 MGI:102707
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ephrin A2 transcript_id : NM_007909.2

name	Mum1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625677 GeneID:68114 MGI:1915364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma associated antigen (mutated) 1 transcript_id : NM_023431.5

name	Ndufs7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367271 GeneID:75406 MGI:1922656
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) Fe-S protein 7 transcript_id : NM_029272.2

name	Gamt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753943 GeneID:14431 MGI:1098221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanidinoacetate methyltransferase transcript_id : NM_010255.1

name	Dazap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875323 GeneID:70248 MGI:1917498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DAZ associated protein 1 transcript_id : NM_133188.1

name	Rps15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677798 GeneID:20054 MGI:98117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S15 transcript_id : NM_009091.1

name	Apc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938321 GeneID:23805 MGI:1346052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenomatosis polyposis coli 2 transcript_id : NM_011789.2

name	2310011J03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114051827 GeneID:66374 MGI:1913624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310011J03 gene transcript_id : NM_025521.3

name	Pcsk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469094 GeneID:18551 MGI:97514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proprotein convertase subtilisin/kexin type 4 transcript_id : NM_008793.1

name	Reep6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21314829 GeneID:70335 MGI:1917585
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 6 transcript_id : NM_139292.1

name	Adamtsl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374574 GeneID:66548 MGI:1913798
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADAMTS-like 5 transcript_id : NM_025629.2

name	6330514A18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65508356 GeneID:216166 MGI:3026984
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330514A18 gene transcript_id : NM_183152.2

name	Rkhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348475 GeneID:237400 MGI:2681847
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger (C3HC4 type) and KH domain containing 1 transcript_id : NM_198615.1

name	Mbd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129898 GeneID:17192 MGI:1333812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyl-CpG binding domain protein 3 transcript_id : NM_013595.2

name	Uqcr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114051413 GeneID:66594 MGI:1913844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquinol-cytochrome c reductase (6.4kD) subunit transcript_id : NM_025650.2

name	Tcfe2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402510 GeneID:21423 MGI:98510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor E2a transcript_id : NM_011548.3

name	Onecut3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538835 GeneID:246086 MGI:1891409
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : one cut domain, family member 3 transcript_id : NM_139226.3

name	Atp8b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46391100 GeneID:67331 MGI:1914581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Class I, type 8B, member 3 transcript_id : NM_026094.3

name	Rexo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118150646 GeneID:66932 MGI:1914182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : REX1, RNA exonuclease 1 homolog (S. cerevisiae) transcript_id : NM_025852.3

name	Klf16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922689 GeneID:118445 MGI:2153049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 16 transcript_id : NM_078477.2

name	D10Bwg1364e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703839 GeneID:216169 MGI:106388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 10, Brigham & Women's Genetics 1364 expressed transcript_id : NM_145421.1

name	Scamp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46593030 GeneID:56214 MGI:1928947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretory carrier membrane protein 4 transcript_id : NM_019575.4

name	Csnk1g2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527223 GeneID:103236 MGI:1920014
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 1, gamma 2 transcript_id : NM_134002.1

name	Btbd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388451 GeneID:208198 MGI:1933831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 124 ESTs, 22 Proteins product : BTB (POZ) domain containing 2, transcript variant 3 transcript_id : XM_001000710.1

name	Mknk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892866 GeneID:17347 MGI:894279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP kinase-interacting serine/threonine kinase 2 transcript_id : NM_021462.3

name	Mobkl2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249074 GeneID:208228 MGI:3050117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MOB1, Mps One Binder kinase activator-like 2A (yeast) transcript_id : NM_172457.2

name	9030607L17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886472 GeneID:71564 MGI:1918814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030607L17 gene transcript_id : NM_027829.3

name	Ap3d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671564 GeneID:11776 MGI:107734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 3, delta 1 subunit transcript_id : NM_007460.1

name	Dot1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556380 GeneID:208266 MGI:2143886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DOT1-like, histone H3 methyltransferase (S. cerevisiae) transcript_id : NM_199322.1

name	Plekhj1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469026 GeneID:78670 MGI:1925920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family J member 1 transcript_id : NM_023900.1

name	Sf3a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22296887 GeneID:20222 MGI:104912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 3a, subunit 2 transcript_id : NM_013651.3

name	Amh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861193 GeneID:11705 MGI:88006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anti-Mullerian hormone transcript_id : NM_007445.2

name	Jsrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363261 GeneID:71912 MGI:1916700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junctional sarcoplasmic reticulum protein 1 transcript_id : NM_028001.2

name	Oaz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93141218 GeneID:18245 MGI:109433
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine decarboxylase antizyme transcript_id : NM_008753.4

name	BC072620 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701455 GeneID:237403 MGI:3609246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC072620 transcript_id : NM_001013758.1

name	Lsm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73808095 GeneID:66094 MGI:1913344
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM7 homolog, U6 small nuclear RNA associated (S. cerevisiae) transcript_id : NM_025349.2

name	3110056O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116805337 GeneID:73218 MGI:1920468
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110056O03 gene transcript_id : NM_175195.3

name	Tmprss9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157516 GeneID:432478 MGI:3612246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 9 transcript_id : NM_001081688.1

name	Timm13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386021 GeneID:30055 MGI:1353432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 13 homolog (yeast) transcript_id : NM_013895.3

name	Lmnb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195685 GeneID:16907 MGI:96796
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lamin B2 transcript_id : NM_010722.5

name	Gadd45b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678979 GeneID:17873 MGI:107776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest and DNA-damage-inducible 45 beta transcript_id : NM_008655.1

name	Gng7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579918 GeneID:14708 MGI:95787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 7 subunit transcript_id : NM_010319.3

name	Gng7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579914 GeneID:14708 MGI:95787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 7 subunit transcript_id : NM_001038655.1

name	Diras1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254099 GeneID:208666 MGI:2183442
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DIRAS family, GTP-binding RAS-like 1 transcript_id : NM_145217.2

name	Slc39a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527367 GeneID:106947 MGI:2147269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 39 (zinc transporter), member 3 transcript_id : NM_134135.1

name	Sgta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313587 GeneID:52551 MGI:1098703
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small glutamine-rich tetratricopeptide repeat (TPR)-containing, alpha transcript_id : NM_024499.1

name	Thop1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801686 GeneID:50492 MGI:1354165
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thimet oligopeptidase 1 transcript_id : NM_022653.3

name	Creb3l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802442 GeneID:208677 MGI:2384786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cAMP responsive element binding protein 3-like 3 transcript_id : NM_145365.3

name	Map2k2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581583 GeneID:26396 MGI:1346867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 2 transcript_id : NM_023138.3

name	Zbtb7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647237 GeneID:16969 MGI:1335091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 7a transcript_id : NM_010731.3

name	Pias4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378150 GeneID:59004 MGI:2136940
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein inhibitor of activated STAT 4 transcript_id : NM_021501.3

name	Eef2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859481 GeneID:13629 MGI:95288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation elongation factor 2 transcript_id : NM_007907.1

name	Dapk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681132 GeneID:13144 MGI:1203520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death-associated kinase 3 transcript_id : NM_007828.1

name	Itgb1bp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803550 GeneID:69564 MGI:1916814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 1 binding protein 3 transcript_id : NM_027120.2

name	Atcay (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372103 GeneID:16467 MGI:2448730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ataxia, cerebellar, Cayman type homolog (human) transcript_id : NM_178662.3

name	9130206N08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802279 GeneID:103406 MGI:2143792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130206N08 gene transcript_id : NM_001034895.2

name	Matk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754645 GeneID:17179 MGI:99259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : megakaryocyte-associated tyrosine kinase transcript_id : NM_010768.1

name	Mrpl54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385694 GeneID:66047 MGI:1913297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L54 transcript_id : NM_025317.2

name	Apba3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055381 GeneID:57267 MGI:1888527
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta (A4) precursor protein-binding, family A, member 3 transcript_id : NM_018758.1

name	Tjp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052810 GeneID:27375 MGI:1351650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tight junction protein 3 transcript_id : NM_013769.2

name	Pip5k1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679322 GeneID:18717 MGI:1298224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma transcript_id : NM_008844.1

name	2510012J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583672 GeneID:70312 MGI:1917562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510012J08 gene transcript_id : NM_027381.1

name	Tbxa2r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378599 GeneID:21390 MGI:98496
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thromboxane A2 receptor transcript_id : NM_009325.3

name	Gipc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507362 GeneID:209047 MGI:2387006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GIPC PDZ domain containing family, member 3 transcript_id : NM_148951.1

name	Hmg20b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365672 GeneID:15353 MGI:1341190
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : high mobility group 20 B transcript_id : NM_010440.2

name	F630110N24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378800 GeneID:73822 MGI:3604804
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F630110N24 gene transcript_id : NM_028657.2

name	4930404N11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347338 GeneID:432479 MGI:1921072
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930404N11 gene transcript_id : NM_001014836.2

name	Fzr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789958 GeneID:56371 MGI:1926790
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fizzy/cell division cycle 20 related 1 (Drosophila) transcript_id : NM_019757.1

name	Dohh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527181 GeneID:102115 MGI:1915964
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyhypusine hydroxylase/monooxygenase transcript_id : NM_133964.1

name	2210404O07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94388495 GeneID:72273 MGI:1919523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 41 ESTs, 1 Protein product : RIKEN cDNA 2210404O07 gene, transcript variant 1 transcript_id : XM_125703.7

name	Nfic (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370350 GeneID:18029 MGI:109591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/C transcript_id : NM_026756.2

name	Nfic (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370341 GeneID:18029 MGI:109591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/C transcript_id : NM_008688.3

name	Brunol5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260950 GeneID:319586 MGI:2442333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins product : bruno-like 5, RNA binding protein (Drosophila), transcript variant 1 transcript_id : XM_618789.4

name	Ncln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351942 GeneID:103425 MGI:1926081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nicalin homolog (zebrafish) transcript_id : NM_134009.2

name	Edg6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753717 GeneID:13611 MGI:1333809
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endothelial differentiation, G-protein-coupled receptor 6 transcript_id : NM_010102.1

name	Gna15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328487 GeneID:14676 MGI:95770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha 15 transcript_id : NM_010304.3

name	Gna11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384965 GeneID:14672 MGI:95766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha 11 transcript_id : NM_010301.3

name	Aes (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370816 GeneID:14797 MGI:95806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amino-terminal enhancer of split transcript_id : NM_010347.3

name	Tle2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789970 GeneID:21886 MGI:104635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin-like enhancer of split 2, homolog of Drosophila E(spl) transcript_id : NM_019725.1

name	Tle6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131148 GeneID:114606 MGI:2149593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin-like enhancer of split 6, homolog of Drosophila E(spl) transcript_id : NM_053254.2

name	Sirt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31795585 GeneID:50721 MGI:1354161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sirtuin 6 (silent mating type information regulation 2, homolog) 6 (S. cerevisiae) transcript_id : NM_181586.2

name	Ankrd24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68264923 GeneID:70615 MGI:1890394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 24 transcript_id : NM_027480.2

name	Shc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261012 GeneID:216148 MGI:106180
definition	codon_start : 1 product : src homology 2 domain-containing transforming protein C2 protein_id : XP_001478481.1

name	Gm1157 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701995 CCDS:CCDS23980.1 GeneID:382384 MGI:2686003
definition	codon_start : 1 product : hypothetical protein LOC382384 protein_id : NP_001028645.1

name	Madcam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305251 CCDS:CCDS23981.1 GeneID:17123 MGI:103579
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0030216 - keratinocyte differentiation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : mucosal vascular addressin cell adhesion molecule 1 protein_id : NP_038619.1

name	Gtrgeo22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507341 CCDS:CCDS23982.1 GeneID:110012 MGI:106618
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0019861 - flagellum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030534 - adult behavior [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007288 - sperm axoneme assembly [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC110012 protein_id : NP_683736.1

name	Cdc34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243988 CCDS:CCDS23983.1 GeneID:216150 MGI:102657
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : cell division cycle 34 homolog protein_id : NP_808281.1

name	Gzmm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678700 CCDS:CCDS23984.1 GeneID:16904 MGI:99549
definition	GO_function : GO:0004175 - endopeptidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0019835 - cytolysis [Evidence IDA] codon_start : 1 note : lymphoctye Met-ase 1 product : granzyme M (lymphocyte met-ase 1) protein_id : NP_032530.1

name	Bsg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34915988 CCDS:CCDS23985.1 GeneID:12215 MGI:88208
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005537 - mannose binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; neurothelin; 5A11/Basigin; gp 42 product : basigin isoform 1 protein_id : NP_033898.1

name	Bsg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116014342 GeneID:12215 MGI:88208
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005537 - mannose binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; neurothelin; 5A11/Basigin; gp 42 product : basigin isoform 2 protein_id : NP_001070652.1

name	Hcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680189 CCDS:CCDS23986.1 GeneID:15166 MGI:1298210
definition	GO_function : GO:0030552 - cAMP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hyperpolarization-activated, cyclic nucleotide-gated K+ 2 protein_id : NP_032252.1

name	Polrmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369780 CCDS:CCDS23987.1 GeneID:216151 MGI:1915843
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial DNA-directed RNA polymerase protein_id : NP_766139.1

name	Fgf22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963627 CCDS:CCDS23988.1 GeneID:67112 MGI:1914362
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0005576 - extracellular region [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : fibroblast growth factor 22 protein_id : NP_075793.1

name	Rnf126 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362321 CCDS:CCDS23989.1 GeneID:70294 MGI:1917544
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 126 protein_id : NP_653111.1

name	Fstl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878203 CCDS:CCDS23990.1 GeneID:83554 MGI:1890391
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0048185 - activin binding [Evidence IDA]; GO:0017106 - activin inhibitor activity [Evidence IDA] GO_process : GO:0030514 - negative regulation of BMP signaling pathway [Evidence IDA] codon_start : 1 product : follistatin-like 3 protein_id : NP_113557.1

name	Prssl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607469 GeneID:73106 MGI:1920356
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : protease, serine-like 1 protein_id : NP_001036175.1

name	Palm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560273 CCDS:CCDS23991.1 GeneID:18483 MGI:1261814
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IDA] codon_start : 1 exception : mismatches in translation product : paralemmin protein_id : NP_075617.2

name	9130017N09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313526 CCDS:CCDS23992.1 GeneID:78906 MGI:1926156
definition	codon_start : 1 product : hypothetical protein LOC78906 protein_id : NP_084494.1

name	Ptbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517301 GeneID:19205 MGI:97791
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; hnRNP I product : polypyrimidine tract binding protein 1 isoform 1 protein_id : NP_001070831.1

name	Ptbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517303 GeneID:19205 MGI:97791
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; hnRNP I product : polypyrimidine tract binding protein 1 isoform 2 protein_id : NP_032982.2

name	BC005764 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32129207 GeneID:216152 MGI:2388640
definition	codon_start : 1 exception : mismatches in translation note : plasticity related gene 2 product : plasticity-related protein 2 protein_id : NP_859009.1

name	Prtn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981542 CCDS:CCDS23993.1 GeneID:19152 MGI:893580
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence IEA] codon_start : 1 note : myeloblastin product : proteinase 3 protein_id : NP_035308.2

name	Ela2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052444 CCDS:CCDS23994.1 GeneID:50701 MGI:2679229
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0050900 - leukocyte migration [Evidence IMP]; GO:0006909 - phagocytosis [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : neutrophil elastase protein_id : NP_056594.2

name	Cfd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304867 CCDS:CCDS23995.1 GeneID:11537 MGI:87931
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0003817 - complement factor D activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006957 - complement activation, alternative pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : D component (adipsin) of complement product : adipsin protein_id : NP_038487.1

name	Thrap5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674220 CCDS:CCDS23996.1 GeneID:216154 MGI:2158394
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence ISS] [Evidence IEA]; GO:0016455 - RNA polymerase II transcription mediator activity [Evidence ISS]; GO:0046966 - thyroid hormone receptor binding [Evidence ISS]; GO:0030375 - thyroid hormone receptor coactivator activity [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0042809 - vitamin D receptor binding [Evidence ISS] GO_process : GO:0030521 - androgen receptor signaling pathway [Evidence ISS]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence ISS] codon_start : 1 exception : mismatches in translation note : thyroid hormone receptor-associated protein, 95-kD subunit; thyroid hormone receptor-associated protein 95 product : thyroid hormone receptor associated protein 5 protein_id : NP_932775.1

name	C030046I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66392583 CCDS:CCDS23997.1 GeneID:109284 MGI:1924814
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC109284 protein_id : NP_818775.2

name	Kiss1r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716571 CCDS:CCDS23998.1 GeneID:114229 MGI:2148793
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence ISS]; GO:0008528 - peptide receptor activity, G-protein coupled [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0030336 - negative regulation of cell migration [Evidence IPI]; GO:0008285 - negative regulation of cell proliferation [Evidence IPI]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : KiSS-1 receptor product : G protein-coupled receptor 54 protein_id : NP_444474.1

name	Arid3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681227 CCDS:CCDS23999.1 GeneID:13496 MGI:1328360
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : dead ringer homolog 1 protein_id : NP_031906.1

name	Wdr18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649741 CCDS:CCDS24000.1 GeneID:216156 MGI:2158400
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : WD repeat domain 18 protein_id : NP_780659.2

name	Grin3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20127397 CCDS:CCDS24001.1 GeneID:170483 MGI:2150393
definition	GO_component : GO:0043025 - cell soma [Evidence IMP] [Evidence IDA]; GO:0017146 - N-methyl-D-aspartate selective glutamate receptor complex [Evidence IMP]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IMP]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0051205 - protein insertion into membrane [Evidence IMP]; GO:0051924 - regulation of calcium ion transport [Evidence IMP] codon_start : 1 product : glutamate receptor, ionotropic, NMDA3B protein_id : NP_569722.1

name	ORF61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53759066 CCDS:CCDS24002.1 GeneID:216157 MGI:2177957
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : membralin protein_id : NP_001003949.2

name	Cnn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680952 CCDS:CCDS24003.1 GeneID:12798 MGI:105093
definition	GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA] GO_process : GO:0031032 - actomyosin structure organization and biogenesis [Evidence IEA] codon_start : 1 note : h2-calponin product : calponin 2 protein_id : NP_031751.1

name	Abca7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15451840 CCDS:CCDS24004.1 GeneID:27403 MGI:1351646
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA] codon_start : 1 product : ATP-binding cassette, sub-family A, member 7 protein_id : NP_038878.1

name	Hmha1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789203 CCDS:CCDS24005.1 GeneID:70719 MGI:1917969
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] codon_start : 1 product : minor histocompatibility antigen HA-1 protein_id : NP_081797.1

name	Polr2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249077 GeneID:66420 MGI:1913670
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : polymerase (RNA) II (DNA directed) polypeptide E protein_id : NP_079830.2

name	Gpx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90903235 GeneID:625249 MGI:104767
definition	EC_number : 1.11.1.12 GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004602 - glutathione peroxidase activity [Evidence ISS] [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA]; GO:0047066 - phospholipid-hydroperoxide glutathione peroxidase activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006325 - establishment and/or maintenance of chromatin architecture [Evidence IDA]; GO:0006979 - response to oxidative stress [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IDA] codon_start : 1 note : isoform 2 precursor is encoded by transcript variant 2; phospholipid hydroperoxide glutathione peroxidase; sperm nuclei glutathione peroxidase product : glutathione peroxidase 4 isoform 2 precursor protein_id : NP_032188.3 transl_except : (pos:79517482..79517484,aa:Sec)

name	Gpx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:90903233 CCDS:CCDS24007.1 GeneID:625249 MGI:104767
definition	EC_number : 1.11.1.12 GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004602 - glutathione peroxidase activity [Evidence ISS] [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA]; GO:0047066 - phospholipid-hydroperoxide glutathione peroxidase activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006325 - establishment and/or maintenance of chromatin architecture [Evidence IDA]; GO:0006979 - response to oxidative stress [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IDA] codon_start : 1 note : isoform 1 precursor is encoded by transcript variant 1; phospholipid hydroperoxide glutathione peroxidase; sperm nuclei glutathione peroxidase product : glutathione peroxidase 4 isoform 1 precursor protein_id : NP_001032830.2 transl_except : (pos:79517482..79517484,aa:Sec)

name	Sbno2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34556193 CCDS:CCDS24008.1 GeneID:216161 MGI:2448490
definition	codon_start : 1 product : strawberry notch homolog protein_id : NP_906271.1

name	Stk11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106425 GeneID:20869 MGI:1341870
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 function : tumor suppressor product : serine/threonine kinase 11 protein_id : NP_035622.1

name	Dos (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71895067 CCDS:CCDS24009.1 GeneID:216164 MGI:1354170
definition	codon_start : 1 product : downstream of Stk11 protein_id : NP_056576.1

name	Atp5d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536220 CCDS:CCDS24010.1 GeneID:66043 MGI:1913293
definition	GO_component : GO:0005740 - mitochondrial envelope [Evidence ISS]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0045259 - proton-transporting ATP synthase complex [Evidence ISS]; GO:0045261 - proton-transporting ATP synthase complex, catalytic core F(1) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence ISS]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence ISS] [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit precursor protein_id : NP_079589.1

name	Midn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10947008 CCDS:CCDS24011.1 GeneID:59090 MGI:1890222
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : midnolin protein_id : NP_067540.1

name	Cirbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680946 GeneID:12696 MGI:893588
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : cold inducible RNA-binding protein product : cold inducible RNA binding protein protein_id : NP_031731.1

name	1600002K03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037177 CCDS:CCDS24012.1 GeneID:69770 MGI:1917020
definition	codon_start : 1 product : hypothetical protein LOC69770 protein_id : NP_081483.1

name	Efna2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677400 CCDS:CCDS24013.1 GeneID:13637 MGI:102707
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation note : ephrin A6 product : ephrin A2 protein_id : NP_031935.2

name	Mum1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50054188 CCDS:CCDS24014.1 GeneID:68114 MGI:1915364
definition	codon_start : 1 product : UBE-1C2 protein protein_id : NP_075920.4

name	Ndufs7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312950 CCDS:CCDS24015.1 GeneID:75406 MGI:1922656
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0051539 - 4 iron, 4 sulfur cluster binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006120 - mitochondrial electron transport, NADH to ubiquinone [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) Fe-S protein 7 protein_id : NP_083548.1

name	Gamt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753944 GeneID:14431 MGI:1098221
definition	GO_function : GO:0030731 - guanidinoacetate N-methyltransferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006601 - creatine biosynthesis [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0040014 - regulation of body size [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 product : guanidinoacetate methyltransferase protein_id : NP_034385.1

name	Dazap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875324 GeneID:70248 MGI:1917498
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : DAZ associated protein 1 protein_id : NP_573451.1

name	Rps15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677799 GeneID:20054 MGI:98117
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : rat insulinoma product : ribosomal protein S15 protein_id : NP_033117.1

name	Apc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938322 CCDS:CCDS24016.1 GeneID:23805 MGI:1346052
definition	GO_component : GO:0016342 - catenin complex [Evidence ISS] GO_function : GO:0008013 - beta-catenin binding [Evidence ISS]; GO:0008017 - microtubule binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : adenomatosis polyposis coli 2 protein_id : NP_035919.2

name	2310011J03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313500 CCDS:CCDS24017.1 GeneID:66374 MGI:1913624
definition	codon_start : 1 product : hypothetical protein LOC66374 protein_id : NP_079797.1

name	Pcsk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469095 CCDS:CCDS24018.1 GeneID:18551 MGI:97514
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004289 - subtilase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : proprotein convertase subtilisin/kexin type 4 protein_id : NP_032819.1

name	Reep6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21314830 GeneID:70335 MGI:1917585
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : TB2 protein-like 1; receptor expression enhancing protein 6; deleted in polyposis 1-like 1 product : polyposis locus protein 1-like 1 protein_id : NP_647453.1

name	Adamtsl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385092 CCDS:CCDS24019.1 GeneID:66548 MGI:1913798
definition	codon_start : 1 product : thrombospondin, type I domain containing 6 protein_id : NP_079905.1

name	6330514A18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65508357 GeneID:216166 MGI:3026984
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : hypothetical protein LOC216166 protein_id : NP_898975.2

name	Rkhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348476 GeneID:237400 MGI:2681847
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003730 - mRNA 3'-UTR binding [Evidence ISS]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006402 - mRNA catabolism [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0050779 - RNA destabilization [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ring finger (C3HC4 type) and KH domain containing 1 protein_id : NP_941017.1

name	Mbd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305261 CCDS:CCDS24020.1 GeneID:17192 MGI:1333812
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0016581 - NuRD complex [Evidence IPI] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016573 - histone acetylation [Evidence IMP]; GO:0006346 - methylation-dependent chromatin silencing [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : methyl-CpG binding domain protein 3 protein_id : NP_038623.1

name	Uqcr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385112 GeneID:66594 MGI:1913844
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ubiquinol-cytochrome c reductase subunit protein_id : NP_079926.1

name	Tcfe2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402511 CCDS:CCDS24022.1 GeneID:21423 MGI:98510
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence TAS]; GO:0030528 - transcription regulator activity [Evidence IDA] GO_process : GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : transcription factor E2a protein_id : NP_035678.2

name	Onecut3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538836 CCDS:CCDS24023.1 GeneID:246086 MGI:1891409
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : one cut domain, family member 3 protein_id : NP_631972.2

name	Atp8b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358405 CCDS:CCDS24024.1 GeneID:67331 MGI:1914581
definition	GO_component : GO:0001669 - acrosome [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0000299 - integral to membrane of membrane fraction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IMP] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IMP]; GO:0006812 - cation transport [Evidence IEA]; GO:0045332 - phospholipid translocation [Evidence IMP] codon_start : 1 product : spermatozoan aminophospholipid translocase protein_id : NP_080370.2

name	Rexo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328282 CCDS:CCDS24025.1 GeneID:66932 MGI:1914182
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; elongin A binding protein 1; transcription elongation factor B polypeptide 3 binding protein 1 product : transcription elongation factor B polypeptide 3 binding protein 1 isoform 1 protein_id : NP_080128.2

name	Klf16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922690 CCDS:CCDS24026.1 GeneID:118445 MGI:2153049
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007212 - dopamine receptor signaling pathway [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : dopamine receptor regulating factor product : Kruppel-like factor 16 protein_id : NP_510962.2

name	D10Bwg1364e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703840 CCDS:CCDS24027.1 GeneID:216169 MGI:106388
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : mFLJ00358 protein product : hypothetical protein LOC216169 protein_id : NP_663396.1

name	Scamp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9625033 CCDS:CCDS24028.1 GeneID:56214 MGI:1928947
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : secretory carrier membrane protein 4 protein_id : NP_062521.1

name	Csnk1g2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527224 CCDS:CCDS24029.1 GeneID:103236 MGI:1920014
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : casein kinase 1, gamma 2 protein_id : NP_598763.1

name	Btbd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261030 GeneID:208198 MGI:1933831
definition	codon_start : 1 product : BTB (POZ) domain containing 2 isoform 3 protein_id : XP_001000710.2

name	Mknk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946852 CCDS:CCDS24030.1 GeneID:17347 MGI:894279
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA] [Evidence ISS]; GO:0006950 - response to stress [Evidence ISS] codon_start : 1 note : G protein-coupled receptor kinase 7 product : MAP kinase-interacting serine/threonine kinase 2 protein_id : NP_067437.1

name	Mobkl2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249075 GeneID:208228 MGI:3050117
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : MOB1, Mps One Binder kinase activator-like 2A protein_id : NP_766045.2

name	9030607L17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89886473 GeneID:71564 MGI:1918814
definition	codon_start : 1 product : hypothetical protein LOC71564 protein_id : NP_082105.3

name	Ap3d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671565 GeneID:11776 MGI:107734
definition	GO_component : GO:0005802 - Golgi trans face [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IMP]; GO:0048007 - antigen processing and presentation, exogenous lipid antigen via MHC class Ib [Evidence IMP]; GO:0006886 - intracellular protein transport [Evidence IMP] [Evidence TAS]; GO:0051138 - positive regulation of NK T cell differentiation [Evidence IMP]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : adaptor-related protein complex AP-3, delta subunit; adaptor-related protein complex 3, delta subunit product : adaptor-related protein complex 3, delta 1 subunit protein_id : NP_031486.1

name	Dot1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556381 GeneID:208266 MGI:2143886
definition	GO_function : GO:0042054 - histone methyltransferase activity [Evidence IDA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0045735 - nutrient reservoir activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : histone methyltransferase DOT1L product : histone H3 methyltransferase DOT1 protein_id : NP_955354.1

name	Plekhj1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469027 GeneID:78670 MGI:1925920
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy product : guanine nucleotide releasing protein x protein_id : NP_076389.1

name	Sf3a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10800150 GeneID:20222 MGI:104912
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0031202 - RNA splicing factor activity, transesterification mechanism [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence TAS] codon_start : 1 exception : mismatches in translation note : spliceosomal protein gene 62; splicing factor 3a, subunit 2, 66kD product : splicing factor 3a, subunit 2 protein_id : NP_038679.2

name	Amh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861194 CCDS:CCDS24033.1 GeneID:11705 MGI:88006
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005615 - extracellular space [Evidence ISS] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005160 - transforming growth factor beta receptor binding [Evidence ISS] GO_process : GO:0008406 - gonad development [Evidence IEA]; GO:0007506 - gonadal mesoderm development [Evidence IEA]; GO:0001655 - urogenital system development [Evidence ISS] codon_start : 1 note : Mullerian inhibiting substance; anti-Muellerian hormone product : anti-Mullerian hormone protein_id : NP_031471.2

name	Jsrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312578 CCDS:CCDS24034.1 GeneID:71912 MGI:1916700
definition	GO_component : GO:0016529 - sarcoplasmic reticulum [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006941 - striated muscle contraction [Evidence ISS] codon_start : 1 product : JP-45 protein protein_id : NP_082277.1

name	Oaz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110677 GeneID:18245 MGI:109433
definition	GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0008073 - ornithine decarboxylase inhibitor activity [Evidence TAS] GO_process : GO:0006595 - polyamine metabolism [Evidence TAS] codon_start : 1 note : protein translation is dependent on +1 polyamine-induced ribosomal frameshift; antizyme 1 product : ornithine decarboxylase antizyme 1 protein_id : NP_032779.1 ribosomal_slippage : _no_value

name	BC072620 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701456 CCDS:CCDS24035.1 GeneID:237403 MGI:3609246
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC237403 protein_id : NP_001013780.1

name	Lsm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384714 GeneID:66094 MGI:1913344
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006402 - mRNA catabolism [Evidence ISS]; GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : LSM7 homolog, U6 small nuclear RNA associated protein_id : NP_079625.1

name	3110056O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116805338 GeneID:73218 MGI:1920468
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : protein SPP-like 2B product : signal peptide peptidase-like 2B protein_id : NP_780404.2

name	Tmprss9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157517 GeneID:432478 MGI:3612246
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : polyserase-1; polyserine protease-1; polyserase-I product : transmembrane protease, serine 9 protein_id : NP_001075157.1

name	Timm13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305581 GeneID:30055 MGI:1353432
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : translocase of inner mitochondrial membrane 9 homolog protein_id : NP_038923.1

name	Lmnb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195686 CCDS:CCDS24037.1 GeneID:16907 MGI:96796
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0005638 - lamin filament [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : lamin B2 protein_id : NP_034852.2

name	Gadd45b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678980 CCDS:CCDS24038.1 GeneID:17873 MGI:107776
definition	GO_component : GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0000186 - activation of MAPKK activity [Evidence IDA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006469 - negative regulation of protein kinase activity [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA] codon_start : 1 note : myeloid differentiation primary response gene 118 product : growth arrest and DNA-damage-inducible 45 beta protein_id : NP_032681.1

name	Gng7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579915 CCDS:CCDS24039.1 GeneID:14708 MGI:95787
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IMP] [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0001662 - behavioral fear response [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007168 - receptor guanylyl cyclase signaling pathway [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 7 subunit protein_id : NP_001033744.1

name	Gng7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579919 CCDS:CCDS24039.1 GeneID:14708 MGI:95787
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IMP] [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA] GO_process : GO:0001662 - behavioral fear response [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0007168 - receptor guanylyl cyclase signaling pathway [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 7 subunit protein_id : NP_034449.2

name	Diras1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644583 CCDS:CCDS24040.1 GeneID:208666 MGI:2183442
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : small GTP-binding tumor suppressor 1 product : DIRAS family, GTP-binding RAS-like 1 protein_id : NP_660252.1

name	Slc39a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527368 CCDS:CCDS24041.1 GeneID:106947 MGI:2147269
definition	GO_function : GO:0005385 - zinc ion transporter activity [Evidence IDA] GO_process : GO:0006829 - zinc ion transport [Evidence IDA] codon_start : 1 product : solute carrier family 39 (zinc transporter), member 3 protein_id : NP_598896.1

name	Sgta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313588 GeneID:52551 MGI:1098703
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : small glutamine-rich tetratricopeptide repeat (TPR) containing protein protein_id : NP_078775.1

name	Thop1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981237 CCDS:CCDS24042.1 GeneID:50492 MGI:1354165
definition	EC_number : 3.4.24.15 GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006518 - peptide metabolism [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA] codon_start : 1 exception : mismatches in translation note : endopeptidase 24.15 product : thimet oligopeptidase 1 protein_id : NP_073144.2

name	Creb3l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703728 CCDS:CCDS24043.1 GeneID:208677 MGI:2384786
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : cAMP responsive element binding protein 3-like 3 protein_id : NP_663340.1

name	Map2k2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560267 CCDS:CCDS24044.1 GeneID:26396 MGI:1346867
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : protein kinase, mitogen activated, kinase 2, p45; MAP kinase kinase 2; MAP kinase/Erk kinase product : mitogen activated protein kinase kinase 2 protein_id : NP_075627.2

name	Zbtb7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647238 GeneID:16969 MGI:1335091
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence NAS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0035035 - histone acetyltransferase binding [Evidence IPI]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016564 - transcriptional repressor activity [Evidence IDA] [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0051216 - cartilage development [Evidence NAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : POK erythroid myeloid ontogenic factor; leukemia/lymphoma related factor product : zinc finger and BTB domain containing 7 protein_id : NP_034861.3

name	Pias4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249349 GeneID:59004 MGI:2136940
definition	GO_component : GO:0016363 - nuclear matrix [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019789 - SUMO ligase activity [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IDA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence NAS] GO_process : GO:0007275 - development [Evidence NAS]; GO:0007259 - JAK-STAT cascade [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0016925 - protein sumoylation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : protein inhibitor of activated STAT PIASy product : protein inhibitor of activated STAT, 4 protein_id : NP_067476.2

name	Eef2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859482 GeneID:13629 MGI:95288
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : eukaryotic translation elongation factor 2 protein_id : NP_031933.1

name	Dapk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681133 CCDS:CCDS24045.1 GeneID:13144 MGI:1203520
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA] codon_start : 1 note : ZIP kinase product : death-associated kinase 3 protein_id : NP_031854.1

name	Itgb1bp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625739 CCDS:CCDS24046.1 GeneID:69564 MGI:1916814
definition	GO_component : GO:0005622 - intracellular [Evidence IPI] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045662 - negative regulation of myoblast differentiation [Evidence IDA]; GO:0019363 - pyridine nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : muscle-specific beta 1 integrin binding protein protein_id : NP_081396.1

name	Atcay (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520029 CCDS:CCDS24047.1 GeneID:16467 MGI:2448730
definition	GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : hesitant; jittery product : ataxia, cerebellar, Cayman type homolog protein_id : NP_848777.1

name	9130206N08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702252 GeneID:103406 MGI:2143792
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : hypothetical protein LOC103406 protein_id : NP_001030067.1

name	Matk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754646 CCDS:CCDS24048.1 GeneID:17179 MGI:99259
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Csk homologous kinase product : megakaryocyte-associated tyrosine kinase protein_id : NP_034898.1

name	Mrpl54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384682 CCDS:CCDS24049.1 GeneID:66047 MGI:1913297
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : mitochondrial ribosomal protein L54 protein_id : NP_079593.1

name	Apba3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055382 CCDS:CCDS24050.1 GeneID:57267 MGI:1888527
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : adapter protein X11gamma; neuron-specific X11L2 protein; neuronal munc18-1-interacting protein 3; Mint 3 product : amyloid beta (A4) precursor protein-binding, family A, member 3 protein_id : NP_061228.1

name	Tjp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052811 CCDS:CCDS24051.1 GeneID:27375 MGI:1351650
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] codon_start : 1 product : tight junction protein 3 protein_id : NP_038797.2

name	Pip5k1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679323 GeneID:18717 MGI:1298224
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016308 - 1-phosphatidylinositol-4-phosphate 5-kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0046488 - phosphatidylinositol metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation product : phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma protein_id : NP_032870.1

name	2510012J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583673 GeneID:70312 MGI:1917562
definition	codon_start : 1 product : hypothetical protein LOC70312 protein_id : NP_081657.1

name	Tbxa2r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678233 CCDS:CCDS24053.1 GeneID:21390 MGI:98496
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0045987 - positive regulation of smooth muscle contraction [Evidence IDA]; GO:0019229 - regulation of vasoconstriction [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Tp receptor product : thromboxane A2 receptor protein_id : NP_033351.1

name	Gipc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507363 CCDS:CCDS24054.1 GeneID:209047 MGI:2387006
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] codon_start : 1 note : regulator of G-protein signaling 19 interacting protein 3; PDZ-domain protein Gipc3 product : GIPC PDZ domain containing family, member 3 protein_id : NP_683753.1

name	Hmg20b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528488 CCDS:CCDS24055.1 GeneID:15353 MGI:1341190
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence NAS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence NAS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006338 - chromatin remodeling [Evidence TAS]; GO:0006323 - DNA packaging [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence NAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : high mobility group protein 20 B; BRCA2-associated factor 35 product : high mobility group 20 B protein_id : NP_034570.1

name	F630110N24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89111937 GeneID:73822 MGI:3604804
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73822 protein_id : NP_082933.1

name	4930404N11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62460384 CCDS:CCDS24056.1 GeneID:432479 MGI:1921072
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC432479 protein_id : NP_001014836.1

name	Fzr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789959 CCDS:CCDS24057.1 GeneID:56371 MGI:1926790
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 function : cell cycle regulator note : fizzy-related protein; frizzy-related protein 1 product : Fzr1 protein protein_id : NP_062731.1

name	Dohh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527182 GeneID:102115 MGI:1915964
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0019135 - deoxyhypusine monooxygenase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008612 - hypusine biosynthesis from peptidyl-lysine [Evidence IEA] codon_start : 1 exception : mismatches in translation product : HEAT-like (PBS lyase) repeat containing 1 protein_id : NP_598725.1

name	2210404O07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20862791 GeneID:72273 MGI:1919523
definition	codon_start : 1 product : hypothetical protein LOC72273 isoform 1 protein_id : XP_125703.1

name	Nfic (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370351 GeneID:18029 MGI:109591
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; nuclear factor 1-C2 product : nuclear factor I/C isoform b protein_id : NP_081032.2

name	Nfic (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679042 CCDS:CCDS24058.1 GeneID:18029 MGI:109591
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; nuclear factor 1-C2 product : nuclear factor I/C isoform a protein_id : NP_032714.1

name	Brunol5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94388455 GeneID:319586 MGI:2442333
definition	codon_start : 1 product : bruno-like 5, RNA binding protein isoform 1 protein_id : XP_618789.3

name	Ncln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469043 GeneID:103425 MGI:1926081
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : nicalin homolog protein_id : NP_598770.1

name	Edg6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753718 CCDS:CCDS24059.1 GeneID:13611 MGI:1333809
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : endothelial differentiation, G-protein-coupled receptor 6 protein_id : NP_034232.1

name	Gna15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754010 CCDS:CCDS24060.1 GeneID:14676 MGI:95770
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence TAS] [Evidence NAS] GO_function : GO:0005525 - GTP binding [Evidence IEA] [Evidence NAS]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IGI] [Evidence IEA] GO_process : GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IMP]; GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein, alpha 15 protein_id : NP_034434.1

name	Gna11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754004 CCDS:CCDS24061.1 GeneID:14672 MGI:95766
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence TAS] [Evidence ISS] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IMP]; GO:0007215 - glutamate signaling pathway [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0048066 - pigmentation during development [Evidence IMP]; GO:0001508 - regulation of action potential [Evidence IDA]; GO:0045634 - regulation of melanocyte differentiation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 product : guanine nucleotide binding protein, alpha 11 protein_id : NP_034431.1

name	Aes (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754072 CCDS:CCDS24062.1 GeneID:14797 MGI:95806
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IGI] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0040008 - regulation of growth [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : related to Drosophila groucho product : amino-terminal enhancer of split protein_id : NP_034477.1

name	Tle2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789971 CCDS:CCDS24063.1 GeneID:21886 MGI:104635
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007222 - frizzled signaling pathway [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : groucho-related protein; transducin-like enhancer of split 2 product : transducin-like enhancer protein 2 protein_id : NP_062699.1

name	Tle6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716583 CCDS:CCDS24064.1 GeneID:114606 MGI:2149593
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : Groucho-related protein 6; transducin-like enhancer of split 6 product : transducin-like enhancer protein 6 protein_id : NP_444484.1

name	Sirt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712018 CCDS:CCDS24066.1 GeneID:50721 MGI:1354161
definition	codon_start : 1 note : silent mating type information regulation 2, homolog 6 product : sirtuin 6 protein_id : NP_853617.1

name	Ankrd24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181301 GeneID:70615 MGI:1890394
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : ankyrin repeat domain 24 protein_id : NP_081756.3

name	LOC100042403 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042403
definition	number : 1 pseudo : _no_value

name	BC025920 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260887 GeneID:268319 MGI:2670983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025920 transcript_id : XR_035082.1

clone name	MSMg01-072N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-093D09.b	B6Ng01-093D09.g
ACC	DH904760	DH904761
length	1,103	854
definition	DH904760\|Mus musculus domesticus DNA, BAC clone: B6Ng01-093D09, 5' end.	DH904761\|Mus musculus domesticus DNA, BAC clone: B6Ng01-093D09, 3' end.
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(80,099,415 - 80,100,521)	(41,472,848 - 41,473,512)
sequence	gaattccctcatgtcagctgttagagtgcttttggccacaaacgccaact gcctaggcatcccaggcactacaccctctccacttgcatgcagtcatggg gagatgcctccctgggacccagtggtcacaacatagcccatcctcacttt ggaggcagccccacaaaaccacacatactaccaagatgactggttgagag gacgtaatgctcacttcccatgctgctgaccccaccctggtaagtcagca gtaggctcagccccagtcagtcagtctctccttgcaggcagggctcccat ctgctgtctgagcacagtgcaggcctgcttcagcatcactagtcacaaag accatctccagggccacccccagcggctgtacctgccacgcctgcaggga aaggccccgactactgcagcaagtagagccactgtgatgggatctgtggc caggttgtctacaaccacctctgtccccagtcaaagccagccaccaactt gtaaagagtgcccccaggctgaggcatagctagccctttggggtggtctc catcactctctagcagtcatggacatcagcaagcagccttctctgatacc aggccaagttcagagcccacttgtagctgggcccgtttctctctgacagc gatggcttcccacctcctgtgctctaccagggtatgccaggttatataag gtgaagcaccatgaagtttcttccaagaggttggctcggtgacagtccag gtcaccatgggtctggtctctaccctacaccctgcaggcacctcagatct cctgggggagcagccaaggactgccccttgcaagggaggtggggcctaca cagtgttaagccagctctcctctaggagggtttattcaggtctctctgga gccatgactctcacatgtgggaagtcaaagttactcaaggaagctcaagt tctcctcgggtttcagctgccacacctgctatgagcagacgtctctaact ttaaccacctcagggtcactcttcttctggtggcacctccctggggtttt acctgatccaaccctgctctacgctggcccttccccccctccccccaacc tga	gaattcccggacagccagggctacacaaagaaaccctgtcttgaaaagtc aaataattaaagtaatttcacagaagtgacagctggacaggtctccgggg accttcctgagctccctgaggcacctgtctcacaagacgattccagctgg ggggcagcaggggatggggggggttcaccaaaagatgaaagaatgagcct tcttgttgtcccttacatattccagttaatgttctttagaatttatagaa gatggctgattaacattgaactgacttgtgtcctaaattgattgagaagg gagtccggaagaacccggatttgagtagggtgtgacaacttcaacttgac ttatgagtacttaactttgttttgacaaggatccttaaggctttaaaatc tagagcttttttaacttgggcagtcaatatacagttattcttctctttgc aataaatccatgaaaagtccacctatacagtcttagggaggatggaggaa gataagtaatgagattaagacttgactgtggtacttgaactctttaatga ctgtaggactggagaaatgactctgctgttactagttctccttatacaga ggaactgcctttagctcccagcacccatgctgggtggctcacaactactt ggaatttcgcagcaggggaactcctctcacctctgaggcattttagccat gcacataatctcatactctgatacacacacacacacacacacacacacac acgtttaatataactgtatatattatatgtgttagaataagaatcatatt aaatatatcaaagtctggttgagcaaaatatctgtataactccaaaaaga ctct
quality values	Open. Hide. 61 61 33 24 38 28 24 24 24 14 11 23 43 37 14 14 14 31 34 41 15 15 15 19 12 12 9 5 11 24 36 49 21 27 24 12 28 15 28 22 36 29 23 23 19 15 15 22 22 36 45 27 22 27 20 10 29 15 19 38 19 23 23 22 14 39 24 31 38 28 18 24 13 18 22 29 30 23 23 25 23 13 30 27 39 31 19 15 27 36 19 18 12 20 28 39 36 49 36 38 39 44 28 38 38 34 24 20 23 19 23 23 44 39 39 43 38 24 23 25 19 11 27 38 31 36 29 27 34 28 24 15 12 16 15 11 30 30 36 32 34 34 28 34 28 29 29 36 36 30 36 31 52 28 32 19 13 13 19 24 34 39 19 33 19 23 26 27 28 28 19 34 33 27 24 52 39 34 30 30 28 33 24 29 18 36 30 29 30 25 38 45 36 27 41 45 49 24 49 27 44 41 35 25 39 28 19 27 36 13 25 19 19 17 39 37 22 23 24 23 31 41 30 29 37 27 23 19 34 19 19 19 28 38 19 23 23 21 37 13 13 23 27 19 23 19 24 29 18 49 31 36 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 59 59 59 59 61 61 59 61 61 61 59 59 61 61 61 61 55 55 61 61 61 61 55 52 55 36 29 28 29 25 34 36 55 52 55 55 61 55 61 55 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 61 55 55 55 55 55 55 61 61 61 61 61 61 61 61 55 55 61 61 61 55 55 55 55 55 61 55 61 61 61 61 61 61 61 55 61 61 55 55 55 55 55 55 50 61 61 61 53 61 39 61 50 53 61 61 43 50 61 53 43 35 43 43 50 50 61 61 61 61 61 53 61 47 47 53 61 50 50 52 61 61 53 53 61 61 61 53 40 61 61 61 61 50 61 53 61 61 61 61 61 53 53 61 61 43 50 61 53 61 61 61 47 34 43 47 47 53 50 47 52 61 61 61 45 50 47 47 50 52 61 47 47 39 61 46 61 61 39 61 39 61 34 31 40 42 39 39 61 53 53 45 45 45 52 57 53 57 47 43 16 16 10 6 11 16 34 57 53 47 47 47 42 53 32 17 47 47 42 47 45 47 53 28 53 53 47 42 47 43 28 47 53 47 47 43 53 50 53 50 53 45 43 50 34 32 42 38 47 57 43 28 50 45 47 47 26 43 57 53 52 45 50 40 45 45 44 22 46 38 52 47 37 19 39 39 32 43 38 52 53 57 57 42 37 57 23 21 15 13 11 13 12 37 52 53 24 38 27 53 53 57 24 57 50 47 47 27 33 17 26 31 38 50 52 45 31 42 57 32 42 42 38 50 36 50 57 57 57 45 42 52 53 57 39 39 50 36 40 32 20 37 38 29 28 38 34 31 37 39 36 52 36 14 5 38 30 33 30 38 53 30 52 15 47 24 37 53 38 42 40 37 57 57 57 45 43 17 37 47 31 25 18 18 19 11 23 36 18 34 29 17 39 39 32 27 37 37 27 33 36 18 57 27 27 9 28 29 48 57 57 40 24 41 27 33 30 21 37 28 32 27 40 30 36 30 37 24 37 33 24 22 31 40 24 37 27 30 30 29 29 47 30 17 32 13 51 9 4 39 34 25 27 29 25 18 30 27 17 27 32 28 32 21 20 18 28 35 14 29 16 16 32 31 34 15 29 12 13 8 7 15 8 15 29 25 39 46 10 26 29 18 28 28 25 46 30 19 24 38 25 29 5 29 8 29 25 20 29 34 29 28 35 33 19 33 11 10 5 9 32 29 24 14 19 16 9 5 5 5 5 6 12 10 19 29 29 16 7 17 10 15 14 23 28 30 10 23 10 17 24 29 15 20 9 6 29 13 28 10 7 17 24 31 27 28 22 29 46 34 20 26 26 8 10 16 16 17 12 7 17 38 18 25 12 7 5 20 20 6 27 17 28 8 7 6 16 8 7 32 17 23 15 9 13 18 20 34 10 20 26 51 44 28 28 34 34 18 10 6 10 9 7 12 12 12 13 25 19 15 38 12 11 38 13 16 5 5 7 8 7 6 21 22 30 13 9 7 5 19 13 24 24 29 25 14 33 7 21 24 30 28 15 7 4 9 8 13 8 6 4	Open. Hide. 55 55 59 59 43 39 13 10 11 10 11 16 11 11 11 12 27 18 18 37 23 27 27 39 34 28 19 23 27 12 27 23 19 24 22 39 43 43 28 31 37 24 33 28 34 28 38 23 39 39 30 21 23 26 18 18 26 22 22 22 24 17 28 19 13 30 27 41 36 36 39 25 18 41 27 29 28 31 36 32 27 18 28 31 27 27 21 23 13 13 38 36 39 39 32 36 36 49 33 36 40 30 32 27 39 34 33 39 36 49 22 27 27 27 27 33 28 31 39 19 36 32 29 39 39 27 39 24 23 24 28 24 23 23 26 13 27 21 13 37 25 25 28 27 12 13 24 27 36 36 31 35 35 39 34 34 24 30 13 12 36 19 18 20 12 18 22 18 18 22 26 23 24 12 22 18 28 13 13 19 27 26 18 18 23 12 26 24 18 39 11 19 19 12 18 19 13 13 13 12 13 22 11 12 12 12 12 12 10 27 10 26 18 22 11 13 12 13 12 23 27 31 10 17 25 19 10 12 25 17 27 11 12 12 11 11 9 8 8 12 13 12 13 12 12 13 10 13 13 13 11 20 10 10 22 11 12 13 18 12 13 13 13 11 19 12 12 12 10 12 13 12 11 20 27 13 11 18 13 23 13 12 18 12 12 15 27 15 15 12 14 23 13 18 18 28 25 24 24 10 30 20 18 19 15 10 11 23 18 27 18 29 12 19 23 13 13 31 13 32 19 18 18 27 12 15 15 10 12 12 18 27 22 44 36 39 27 19 34 23 27 18 10 29 10 18 23 13 12 30 17 12 16 28 14 12 13 15 11 9 25 19 13 35 12 27 18 27 12 13 30 24 10 7 13 19 24 24 12 26 26 29 18 27 9 10 23 12 13 32 12 13 8 9 7 9 13 12 12 13 12 12 12 22 12 13 13 12 12 13 13 18 19 13 33 24 15 26 10 18 18 12 13 13 29 19 13 12 11 11 11 18 10 8 9 12 18 18 12 27 15 15 19 15 13 11 12 13 19 23 15 23 20 22 21 19 23 27 27 12 36 31 30 23 23 28 35 11 16 8 18 28 31 24 22 29 15 31 11 21 12 35 27 33 19 13 27 20 18 18 18 22 30 35 35 36 41 27 27 18 20 12 23 15 19 20 18 31 24 20 29 33 27 28 15 20 12 13 13 29 19 18 19 23 27 11 31 31 28 23 24 14 18 21 23 33 32 27 21 24 36 30 7 8 17 9 12 11 28 28 16 25 37 17 19 10 28 32 22 28 22 12 15 10 19 37 27 19 26 24 33 37 19 9 11 12 23 24 15 9 10 22 31 22 14 11 14 26 19 31 29 29 29 29 22 25 19 15 15 21 27 34 55 35 14 38 38 35 39 39 32 37 14 11 21 21 32 25 23 13 19 21 19 21 19 15 14 19 23 18 25 43 31 31 36 43 50 45 19 35 31 23 13 14 28 12 14 28 21 13 15 19 27 19 20 14 31 24 7 10 7 14 21 16 11 19 17 12 24 22 26 10 9 6 6 13 9 27 17 15 22 13 24 26 30 24 10 27 31 29 29 12 16 30 13 21 14 26 22 19 22 22 22 32 16 10 14 12 11 18 14 15 8 19 21 16 30 17 10 20 26 30 13 24 27 47 24 42 30 23 5 27 12 38 30 20 5 18 10 20 10 21 12 30 7 22 9 10 8 20 27 27 23 18 21 10 18 23 23 8 10 7 6 16 25 45 21 27 14 23 36 29 27 30 14 17 32 24 20 17 7 18 10 8 10 12 13 8 17 14 11 10 10 18 20 9 23 12 20 10 8 14 22 10 15 18 14 17 5 12 17 10 20 14 17 18 20 12 24 19 20 17 21 12 8 10 12 14 8 5 15 16 17 28 17 27 30 28 27 20 33 40 20 10 8 23 21 13 14 14 9 7 9 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr10_80099415_80100521
seq2: B6Ng01-093D09.b_44_1146 (reverse)

seq1  TCAGGTTGGGGGGGGGGGGGGGGAGAGGCCAGCGGTAGAGCAGGGTTGGA  50
      |||||||  |||||| ||||||||  ||||||| ||||||||||||||||
seq2  TCAGGTT--GGGGGGAGGGGGGGAAGGGCCAGC-GTAGAGCAGGGTTGGA  47

seq1  TCAGTGAAAACCCCAGGGGAGGTGGCCACAGAAGAAGAGTGACCCTGAGG  100
      ||||  ||||||||| |||||||| |  ||||||||||||||||||||||
seq2  TCAGGTAAAACCCCA-GGGAGGTGCCACCAGAAGAAGAGTGACCCTGAGG  96

seq1  TGGTTAAAGTTAGAGACGTCTGCTCATAAGCAGGTGTTGGCAGCTG-CAG  149
      ||||||||||||||||||||||||||| |||||||| |||||||||  | 
seq2  TGGTTAAAGTTAGAGACGTCTGCTCAT-AGCAGGTG-TGGCAGCTGAAAC  144

seq1  CCGAGGAG-ACTTGAGCTTCCTTGGGTAACTTTGACTTCCCACATGTGAG  198
      |||||||| ||||||||||||||| |||||||||||||||||||||||||
seq2  CCGAGGAGAACTTGAGCTTCCTTGAGTAACTTTGACTTCCCACATGTGAG  194

seq1  AGTCATGGCTCCAGAGAGACCTGAATAAACCCTCCTAGAGGAGAGCTGGC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCATGGCTCCAGAGAGACCTGAATAAACCCTCCTAGAGGAGAGCTGGC  244

seq1  TTAACACTGTGTAGGCCCCACCTCCCTTGCAAGGGGCAGTCCTTGGCTGC  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACACTGTGTAGGCCCCACCTCCCTTGCAAGGGGCAGTCCTTGGCTGC  294

seq1  TCCCCCAGGAGATCTGAGGTGCCTGCAGGGTGTAGGGTAGAGACCAGACC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCCAGGAGATCTGAGGTGCCTGCAGGGTGTAGGGTAGAGACCAGACC  344

seq1  CATGGTGACCTGGACTGTCACCGAGCCAACCTCTTGGAAGAAACTTCATG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGTGACCTGGACTGTCACCGAGCCAACCTCTTGGAAGAAACTTCATG  394

seq1  GTGCTTCACCTTATATAACCTGGCATACCCTGGTAGAGCACAGGAGGTGG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTTCACCTTATATAACCTGGCATACCCTGGTAGAGCACAGGAGGTGG  444

seq1  GAAGCCATCGCTGTCAGAGAGAAACGGGCCCAGCTACAAGTGGGCTCTGA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCCATCGCTGTCAGAGAGAAACGGGCCCAGCTACAAGTGGGCTCTGA  494

seq1  ACTTGGCCTGGTATCAGAGAAGGCTGCTTGCTGATGTCCATGACTGCTAG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGGCCTGGTATCAGAGAAGGCTGCTTGCTGATGTCCATGACTGCTAG  544

seq1  AGAGTGATGGAGACCACCCCAAAGGGCTAGCTATGCCTCAGCCTGGGGGC  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTGATGGAGACCACCCCAAAGGGCTAGCTATGCCTCAGCCTGGGGGC  594

seq1  ACTCTTTACAAGTTGGTGGCTGGCTTTGACTGGGGACAGAGGTGGTTGTA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTTTACAAGTTGGTGGCTGGCTTTGACTGGGGACAGAGGTGGTTGTA  644

seq1  GACAACCTGGCCACAGATCCCATCACAGTGGCTCTACTTGCTGCAGTAGT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAACCTGGCCACAGATCCCATCACAGTGGCTCTACTTGCTGCAGTAGT  694

seq1  CGGGGCCTTTCCCTGCAGGCGTGGCAGGTACAGCCGCTGGGGGTGGCCCT  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGGCCTTTCCCTGCAGGCGTGGCAGGTACAGCCGCTGGGGGTGGCCCT  744

seq1  GGAGATGGTCTTTGTGACTAGTGATGCTGAAGCAGGCCTGCACTGTGCTC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGATGGTCTTTGTGACTAGTGATGCTGAAGCAGGCCTGCACTGTGCTC  794

seq1  AGACAGCAGATGGGAGCCCTGCCTGCAAGGAGAGACTGACTGACTGGGGC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAGCAGATGGGAGCCCTGCCTGCAAGGAGAGACTGACTGACTGGGGC  844

seq1  TGAGCCTACTGCTGACTTACCAGGGTGGGGTCAGCAGCATGGGAAGTGAG  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCCTACTGCTGACTTACCAGGGTGGGGTCAGCAGCATGGGAAGTGAG  894

seq1  CATTACGTCCTCTCAACCAGTCATCTTGGTAGTATGTGTGGTTTTGTGGG  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTACGTCCTCTCAACCAGTCATCTTGGTAGTATGTGTGGTTTTGTGGG  944

seq1  GCTGCCTCCAAAGTGAGGATGGGCTATGTTGTGACCACTGGGTCCCAGGG  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCCTCCAAAGTGAGGATGGGCTATGTTGTGACCACTGGGTCCCAGGG  994

seq1  AGGCATCTCCCCATGACTGCATGCAAGTGGAGAGGGTGTAGTGCCTGGGA  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCATCTCCCCATGACTGCATGCAAGTGGAGAGGGTGTAGTGCCTGGGA  1044

seq1  TGCCTAGGCAGTTGGCGTTTGTGGCCAAAAGCACTTTAACAGCTGACATG  1098
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  TGCCTAGGCAGTTGGCGTTTGTGGCCAAAAGCACTCTAACAGCTGACATG  1094

seq1  AGGGAATTC  1107
      |||||||||
seq2  AGGGAATTC  1103

seq1: chr18_41472848_41473512
seq2: B6Ng01-093D09.g_265_922 (reverse)

seq1  AGTGTCTTTTCTGGAGTTAATACAGATATATTTGCTCAAACCAGACTTTT  50
      || ||||||| ||||||| |||||||||| ||||||| ||||||||||| 
seq2  AGAGTCTTTT-TGGAGTT-ATACAGATAT-TTTGCTC-AACCAGACTTTG  46

seq1  ATCTATTTTATATGATTTTTATTCTTAATACATATAATATATACAGTATA  100
      || ||||| |||||||| |||||| ||| |||||||||||||||||| ||
seq2  ATATATTTAATATGATTCTTATTC-TAACACATATAATATATACAGT-TA  94

seq1  TATTAAACGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTATCAGAGTATGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTAAACGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTATCAGAGTATGA  144

seq1  GATTATGTGCATGGCTAAAATGCCTCAGAGGTGAGAAGAGTT-CCCTGCA  199
      |||||||||||||||||||||||||||||||||||| ||||| |||||| 
seq2  GATTATGTGCATGGCTAAAATGCCTCAGAGGTGAGAGGAGTTCCCCTGCT  194

seq1  GCTGAAATTCCAAGTAGTTGTGAGCCACCCAGCATGGGTGCTGGGAGCTA  249
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  GC-GAAATTCCAAGTAGTTGTGAGCCACCCAGCATGGGTGCTGGGAGCTA  243

seq1  AAGGCAGTTCCTCTGTATAAGGAGTACTAGTAACAGCAGAGTCATTTCTC  299
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  AAGGCAGTTCCTCTGTATAAGGAGAACTAGTAACAGCAGAGTCATTTCTC  293

seq1  CAGTCCTACAGTCTTTTAAAGAGTTCAAGTACCACAGTCATGTCTTAATC  349
      |||||||||||||  ||||||||||||||||||||||||| |||||||||
seq2  CAGTCCTACAGTC-ATTAAAGAGTTCAAGTACCACAGTCAAGTCTTAATC  342

seq1  TCATTACTTAACTTCCTCCATCCTCCCTAAGACTGTATAGGTTGACTTTT  399
      |||||||||| ||||||||||||||||||||||||||||||| |||||||
seq2  TCATTACTTATCTTCCTCCATCCTCCCTAAGACTGTATAGGTGGACTTTT  392

seq1  CATGGATTTATTGCAAAGAGAAGAATAACTGTATATTGACTGCCCAAGTT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGATTTATTGCAAAGAGAAGAATAACTGTATATTGACTGCCCAAGTT  442

seq1  AAAAAAGCTCTAGATTTTCAAGCCTTACGGATCCTTGTCAAAACAAAGTT  499
      |||||||||||||||||| |||||||| ||||||||||||||||||||||
seq2  AAAAAAGCTCTAGATTTTAAAGCCTTAAGGATCCTTGTCAAAACAAAGTT  492

seq1  AAATACTTATAAGTTAAATTGAAGTTGTCACATACTACTCAAAACCGGGC  549
      || |||| |||||| || ||||||||||||||  ||||||||| ||||| 
seq2  AAGTACTCATAAGTCAAGTTGAAGTTGTCACACCCTACTCAAATCCGGGT  542

seq1  TCTTCCAGACTCACTTCTCAATCAATTTAGGACCTAAGTCAGTTCAATGT  599
      |||||| ||||| ||||||||||||||||||||  |||||||||||||||
seq2  TCTTCCGGACTCCCTTCTCAATCAATTTAGGACACAAGTCAGTTCAATGT  592

seq1  TAATCAGCCATCTTCTATAAATTCTAAAGAACATTAACTCGAATATGTAA  649
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  TAATCAGCCATCTTCTATAAATTCTAAAGAACATTAACTGGAATATGTAA  642

seq1  GTGACAACAAGAAGGC  665
      | ||||||||||||||
seq2  GGGACAACAAGAAGGC  658

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information