MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-188A05
Chromosome	18 (Build37)
Map Location	34,617,955 - 34,747,319
singlet/doublet	doublet
Overlap gene	2610024E20Rik, Wnt8a, Nme5, 4933408B17Rik
Upstream gene	D0H4S114, ENSMUSG00000073610, LOC666281, LOC100041258, Epb4.1l4a, EG666296, Ppia-ps18_318.1, Ppia-ps18_319.1, LOC666313, Apc, Srp19, Reep5, Pkd2l2
Downstream gene	Brd8, Kif20a, Cdc23, Gfra3, Cdc25c, LOC100041859, 2810012G03Rik, LOC100041879, LOC100041887, Jmjd1b, Reep2, Egr1, Etf1, Hspa9, LOC100041377, EG626954, LOC100041951, Ctnna1, Lrrtm2, Sil1, LOC100041423, LOC666460, LOC666462, EG383341, EG436583, Matr3
Link	Open Mouse BAC browser

Click to get alignment info.

name	D0H4S114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27528 MGI:99444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000073610 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433171 MGI:3641986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC666281 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100041258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Epb4.1l4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13824 MGI:103007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666296 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666296 MGI:3645021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Ppia-ps18_318.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606517
definition	note : peptidylprolyl isomerase A pseudogene 18_318.1 pseudo : _no_value

name	Ppia-ps18_319.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383339
definition	note : peptidyl-prolyl cis-trans isomerase A pseudogene chr18_319.1 pseudo : _no_value

name	LOC666313 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Apc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11789 MGI:88039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srp19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66384 MGI:1913634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Reep5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13476 MGI:1270152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkd2l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53871 MGI:1858231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610024E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225358 MGI:2447834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20890 MGI:107924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nme5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75533 MGI:1922783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933408B17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271508 MGI:3045347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78656 MGI:1925906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif20a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19348 MGI:1201682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52563 MGI:1098815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14587 MGI:1201403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc25c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12532 MGI:88350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 873 ESTs, 5 Proteins

name	2810012G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66306 MGI:1913556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041879 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100041887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs

name	Jmjd1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277250 MGI:1923356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Reep2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225362 MGI:2385070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Egr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13653 MGI:95295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225363 MGI:2385071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspa9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15526 MGI:96245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041377 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG626954 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626954 MGI:3648052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 780 ESTs, 8 Proteins

name	LOC100041951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ctnna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12385 MGI:88274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrtm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107065 MGI:2389174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sil1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81500 MGI:1932040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041423 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC666460 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins pseudo : _no_value

name	LOC666462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	EG383341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383341 MGI:3648788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 16 Proteins

name	EG436583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436583 MGI:3646921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17184 MGI:1298379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D0H4S114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33186876 GeneID:27528 MGI:99444
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, human D4S114 transcript_id : NM_053078.3

name	ENSMUSG00000073610 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269697 GeneID:433171 MGI:3641986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, ENSMUSG00000073610 transcript_id : XM_001476022.1

name	Epb4.1l4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87042271 GeneID:13824 MGI:103007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.1-like 4a transcript_id : NM_013512.2

name	LOC666313 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94404363 GeneID:666313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC666313 transcript_id : XM_982985.1

name	Apc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225369 GeneID:11789 MGI:88039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenomatosis polyposis coli transcript_id : NM_007462.2

name	Srp19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365535 GeneID:66384 MGI:1913634
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal recognition particle 19 transcript_id : NM_025527.2

name	Reep5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542567 GeneID:13476 MGI:1270152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 5 transcript_id : NM_007874.2

name	Pkd2l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350821 GeneID:53871 MGI:1858231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease 2-like 2 transcript_id : NM_016927.2

name	2610024E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122578 GeneID:225358 MGI:2447834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610024E20 gene transcript_id : NM_146084.1

name	Wnt8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678168 GeneID:20890 MGI:107924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 8A transcript_id : NM_009290.1

name	Nme5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359743 GeneID:75533 MGI:1922783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 5 transcript_id : NM_080637.3

name	4933408B17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382686 GeneID:271508 MGI:3045347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933408B17 gene transcript_id : NM_177773.3

name	Brd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:69354973 GeneID:78656 MGI:1925906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 8 transcript_id : NM_030147.2

name	Kif20a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385767 GeneID:19348 MGI:1201682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 20A transcript_id : NM_009004.3

name	Cdc23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369947 GeneID:52563 MGI:1098815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC23 (cell division cycle 23, yeast, homolog) transcript_id : NM_178347.3

name	Gfra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981761 GeneID:14587 MGI:1201403
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glial cell line derived neurotrophic factor family receptor alpha 3 transcript_id : NM_010280.2

name	Cdc25c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122114544 GeneID:12532 MGI:88350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 25 homolog C (S. pombe) transcript_id : NM_009860.2

name	LOC100041859 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269723 GeneID:100041859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 873 ESTs, 5 Proteins product : similar to ribosomal protein transcript_id : XM_001477476.1

name	2810012G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129841 GeneID:66306 MGI:1913556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810012G03 gene transcript_id : NM_175104.4

name	LOC100041879 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269727 GeneID:100041879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041879 transcript_id : XM_001477557.1

name	LOC100041887 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269729 GeneID:100041887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs product : hypothetical protein LOC100041887 transcript_id : XM_001477572.1

name	Jmjd1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486934 GeneID:277250 MGI:1923356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 1B transcript_id : NM_001081256.1

name	Reep2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450088 GeneID:225362 MGI:2385070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 2 transcript_id : NM_144865.1

name	Egr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76559936 GeneID:13653 MGI:95295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : early growth response 1 transcript_id : NM_007913.5

name	Etf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286825 GeneID:225363 MGI:2385071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation termination factor 1 transcript_id : NM_144866.3

name	Hspa9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754255 GeneID:15526 MGI:96245
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock protein 9 transcript_id : NM_010481.1

name	LOC100041377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269711 GeneID:100041377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100041377 transcript_id : XM_001476281.1

name	EG626954 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269735 GeneID:626954 MGI:3648052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 780 ESTs, 8 Proteins product : predicted gene, EG626954 transcript_id : XM_891577.3

name	LOC100041951 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269737 GeneID:100041951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041951 transcript_id : XM_001477645.1

name	Ctnna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753293 GeneID:12385 MGI:88274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin (cadherin associated protein), alpha 1 transcript_id : NM_009818.1

name	Lrrtm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802003 GeneID:107065 MGI:2389174
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat transmembrane neuronal 2 transcript_id : NM_178005.2

name	Sil1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13540506 GeneID:81500 MGI:1932040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : endoplasmic reticulum chaperone SIL1 homolog (S. cerevisiae) transcript_id : NM_030749.1

name	LOC100041423 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269714 GeneID:100041423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041423 transcript_id : XM_001476356.1

name	LOC666462 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94404369 GeneID:666462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical LOC666462 transcript_id : XM_984027.1

name	EG383341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269743 GeneID:383341 MGI:3648788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 16 Proteins product : predicted gene, EG383341 transcript_id : XM_356994.4

name	Matr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349909 GeneID:17184 MGI:1298379
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrin 3 transcript_id : NM_010771.4

name	D0H4S114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716357 GeneID:27528 MGI:99444
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence IDA] codon_start : 1 product : neuronal protein 3.1 protein_id : NP_444308.1

name	ENSMUSG00000073610 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269698 GeneID:433171 MGI:3641986
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476072.1

name	Epb4.1l4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87042272 CCDS:CCDS29124.1 GeneID:13824 MGI:103007
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : erythrocyte protein band 4.1-like 4 product : erythrocyte protein band 4.1-like 4a protein_id : NP_038540.2

name	LOC666313 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94404364 GeneID:666313
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988079.1

name	Apc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225370 CCDS:CCDS29125.1 GeneID:11789 MGI:88039
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016328 - lateral plasma membrane [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0008013 - beta-catenin binding [Evidence IDA] [Evidence IPI]; GO:0005488 - binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0009798 - axis specification [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IDA] [Evidence IMP] codon_start : 1 note : multiple intestinal neoplasia product : adenomatosis polyposis coli protein_id : NP_031488.2

name	Srp19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384948 GeneID:66384 MGI:1913634
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005786 - signal recognition particle (sensu Eukaryota) [Evidence IEA] GO_function : GO:0008312 - 7S RNA binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : signal recognition particle 19 protein_id : NP_079803.1

name	Reep5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542568 GeneID:13476 MGI:1270152
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : receptor expression enhancing protein 5; deleted in polyposis 1 product : receptor accessory protein 5 protein_id : NP_031900.2

name	Pkd2l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393965 CCDS:CCDS29127.1 GeneID:53871 MGI:1858231
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Polycystin - L2 product : polycystic kidney disease 2-like 2 protein_id : NP_058623.1

name	2610024E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122579 CCDS:CCDS29128.1 GeneID:225358 MGI:2447834
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : expressed sequence AW060714 protein_id : NP_666196.1

name	Wnt8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678169 CCDS:CCDS29129.1 GeneID:20890 MGI:107924
definition	GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : stimulated by retinoic acid gene 11; wingless-related MMTV integration site 8D product : wingless-related MMTV integration site 8A protein_id : NP_033316.1

name	Nme5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625839 CCDS:CCDS29130.1 GeneID:75533 MGI:1922783
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0000302 - response to reactive oxygen species [Evidence NAS]; GO:0007286 - spermatid development [Evidence IDA]; GO:0048515 - spermatid differentiation [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 product : expressed in non-metastatic cells 5 protein_id : NP_542368.2

name	4933408B17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244282 GeneID:271508 MGI:3045347
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC271508 protein_id : NP_808441.1

name	Brd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536234 GeneID:78656 MGI:1925906
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : bromodomain containing 8 protein_id : NP_084423.1

name	Kif20a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679597 CCDS:CCDS29131.1 GeneID:19348 MGI:1201682
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Rab6, kinesin-like; Rabkinesin-6 product : kinesin family member 20A protein_id : NP_033030.1

name	Cdc23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30387632 CCDS:CCDS29132.1 GeneID:52563 MGI:1098815
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : CDC23 (cell division cycle 23, yeast, homolog) protein_id : NP_848124.1

name	Gfra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981762 CCDS:CCDS29133.1 GeneID:14587 MGI:1201403
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008046 - axon guidance receptor activity [Evidence IMP]; GO:0015026 - coreceptor activity [Evidence TAS]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence TAS] codon_start : 1 exception : mismatches in translation product : glial cell line derived neurotrophic factor family receptor alpha 3 protein_id : NP_034410.2

name	Cdc25c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122114545 GeneID:12532 MGI:88350
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000087 - M phase of mitotic cell cycle [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : cell division cycle control protein 25C; cell cycle phosphatase CDC25C product : cell division cycle 25 homolog C protein_id : NP_033990.2

name	LOC100041859 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269724 GeneID:100041859
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_001477526.1

name	LOC100041879 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269728 GeneID:100041879
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477607.1

name	2810012G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424703 CCDS:CCDS29134.1 GeneID:66306 MGI:1913556
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : family 53, member C protein protein_id : NP_780313.1

name	LOC100041887 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269730 GeneID:100041887
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477622.1

name	Jmjd1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486935 GeneID:277250 MGI:1923356
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : jumonji domain containing 1B protein_id : NP_001074725.1

name	Reep2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54261730 CCDS:CCDS29135.1 GeneID:225362 MGI:2385070
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : receptor expression enhancing protein 2 protein_id : NP_659114.2

name	Egr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681285 CCDS:CCDS29136.1 GeneID:13653 MGI:95295
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IMP] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IMP]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0030217 - T cell differentiation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Krox-24 nuclear protein product : early growth response 1 protein_id : NP_031939.1

name	Etf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286826 CCDS:CCDS29137.1 GeneID:225363 MGI:2385071
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003747 - translation release factor activity [Evidence ISS]; GO:0016149 - translation release factor activity, codon specific [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006415 - translational termination [Evidence ISS] [Evidence IEA] codon_start : 1 product : eukaryotic translation termination factor 1 protein_id : NP_659115.3

name	Hspa9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754256 CCDS:CCDS29138.1 GeneID:15526 MGI:96245
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006611 - protein export from nucleus [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0009408 - response to heat [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 exception : mismatches in translation note : heat shock protein cognate 74; heat shock protein, 74 kDa, A; heat shock protein, A; C3H-specific antigen product : heat shock protein 9A protein_id : NP_034611.1

name	LOC100041377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269712 GeneID:100041377
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476331.1

name	EG626954 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269736 GeneID:626954 MGI:3648052
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896670.2

name	LOC100041951 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269738 GeneID:100041951
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477695.1

name	Ctnna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753294 CCDS:CCDS29139.1 GeneID:12385 MGI:88274
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IEA]; GO:0005912 - adherens junction [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005915 - zonula adherens [Evidence IDA] GO_function : GO:0051015 - actin filament binding [Evidence IDA]; GO:0045296 - cadherin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : alpha E catenin; alpha(E)-catenin; cadherin associated protein product : catenin alpha 1 protein_id : NP_033948.1

name	Lrrtm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29725617 GeneID:107065 MGI:2389174
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : leucine-rich repeat transmembrane neuronal 2 protein protein_id : NP_821072.1

name	Sil1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13540507 CCDS:CCDS29140.1 GeneID:81500 MGI:1932040
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : ER chaperone and modulator of BiP product : endoplasmic reticulum chaperone SIL1 homolog protein_id : NP_109674.1

name	LOC100041423 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269715 GeneID:100041423
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476406.1

name	LOC666462 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94404370 GeneID:666462
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989121.1

name	EG383341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82996161 GeneID:383341 MGI:3648788
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 protein_id : XP_356994.2

name	Matr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25141233 CCDS:CCDS29142.1 GeneID:17184 MGI:1298379
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : matrin 3 protein_id : NP_034901.2

name	LOC666281 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666281
definition	number : 1 pseudo : _no_value

name	LOC666281 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666281
definition	number : 2 pseudo : _no_value

name	LOC666281 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666281
definition	number : 3 pseudo : _no_value

name	LOC666281 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666281
definition	number : 4 pseudo : _no_value

name	LOC100041258 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041258
definition	number : 3 pseudo : _no_value

name	LOC100041258 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041258
definition	number : 2 pseudo : _no_value

name	LOC100041258 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041258
definition	number : 1 pseudo : _no_value

name	EG666296 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666296
definition	number : 1 pseudo : _no_value

name	LOC666460 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149269716 GeneID:666460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins product : similar to Ac2-008 pseudo : _no_value transcript_id : XR_032703.1

name	EG436583 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:142382261 GeneID:436583 MGI:3646921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG436583 transcript_id : NR_002905.2

clone name	MSMg01-358O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121F22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-302M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-276C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542K17
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-093N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347D08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-188A05.b	B6Ng01-188A05.g
ACC	GA012431	GA012432
length	1,111	1,110
definition	B6Ng01-188A05.b	B6Ng01-188A05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(34,617,955 - 34,619,066)	(34,746,213 - 34,747,319)
sequence	gaattctaatattccaaataaggaggtaactttagcctgtctacaatatg ttaaataataagaaataatgttaactgttaacattaaagtaatgttagtt atttcctgttattaggttcctatgaataacacacacacacacacacacac acacacacacacacacacacacacacacacacacattttagtcccacaac agtatttaagtgaaaatgaaacagctctggtgctccctgagcacacggat cgtattacagtgattctgtgcactctccactgaatccatgttaatagctt acatctcttctcaaatacaccatctataaatatatgccaaatacaacatt atttttaagcatcactggagtatgggggggagaaagaacttctagatata tcttagaactaaaaatttaaatctcattgaaatagctattgcaaaagcaa aaacaaatagaacaatgtattaacagtattaaaaatttttaagttgtatt tttctttagagaataatcaagatagccagccatttcagcaatttagttta atgctatgtagtagtcacttaagtattatctttttgttttgttttttcaa gacagggtttctgtgtttagccctggctgtcctggaactcactctgtaga ccaggctggcctcgaactcagaaatcccaagtgctgggattaaaggcatg cgccaccactccctagctatgcattatcttttaatagtttttagaaaata atttaccttgcctttgaggcctagaccattttggttgactaaaacttggg taacaagtatgtaatcccacaataaactcaacaatacagtgatttcaaag caacccttgtacctgtgtcccagcagatatactaataatgaacattttag gagaaattttaatgttttaagaaaagaattacaaacccttttttctgagt tttcacatagaagtttcatgtgggaacagcaggagaagggctgaaacaag acaaaccagtgagccacagaggaagcaaagctgagctgtgcgagcatact taccctcccccagctcttctgcagatgcattggtttggaaatcatgaggg ggaaagtgata	gaattctttgatacatgaggaattaataacatctactatgtgtcaggtgg ttatatgtacttacggaagaacactggacaaaaacttttttttcttttga ggctgcatctcatgtagcccagattggcctttaactcattctgtagcctt gaacctctggtcttcctgcttctactcccaaagtgctggattataggtgt gtaccaccatgcccacttgagaaaccactttctagatgagctctgtagag tcacaggtgggaactgagcaggagaagcccaggcacaggtgagccaggca gacacacctgcaatcccagcatttgggaagctggagattcaggataaagg ttgaatgaacagtttaaagacatcctggactaaactctggactttgttgt tgttttgttttgttttgtttgtttgtgtttgttttgttgtttttgtttga ctttcaagactgggtgtgtagctctggctatcctggagctcaggatgttg accaggctggcagctggctgggattaaaggcgtgcaccaccactgcctgg ctgtaagcagagatttttagaatagttcttactatgtagctgaccctttt gccaaatacatgggattgcggcagggaggaaagagaagaaagaaaagggg cacaagcaatttgagagttgtagtgaacacttacccagcatggtggcata agcctataattcaaatattgtagaatatggaggaaggaaattttagtagt tcagggtcatcttcagttacatagttagttcaaggccagctgtcttacac gagaccctgactcaaaagaagaaaaaaagagagaaatataaaacaagcca acgaaagtaaccacttcattgggtaatagtgacatagtttattgtggctg gagagacatggttcagcagttaagagcccttgcagctcttgtagaggacc tgggttcagttcccagcacccataagaggcagctcactacatcttcactt atcaaggatcaggggcaccctattgtgctctactggtaccaggtcatctt gatgccacattattccacacagggccacatacagaggcacataaaaagaa aaaaattgct
quality values	Open. Hide. 62 47 28 34 62 62 62 56 62 62 46 47 62 62 37 18 62 62 62 62 49 62 62 62 62 59 62 62 62 59 62 62 59 59 56 62 59 43 49 56 56 54 62 62 56 62 62 62 59 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 49 54 54 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 38 49 62 62 62 54 43 49 62 62 62 62 62 62 54 54 56 48 35 43 62 62 62 59 59 54 54 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 54 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 56 62 62 62 54 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 46 45 58 58 58 58 58 58 58 58 58 54 40 58 58 58 51 48 58 58 58 58 47 48 33 58 54 58 47 42 54 58 58 58 58 54 54 58 58 54 58 54 58 58 58 54 58 58 58 58 58 54 48 58 58 53 54 54 54 58 52 46 52 52 54 54 52 54 58 54 58 54 48 52 25 54 41 41 40 51 58 47 49 58 54 50 54 49 53 32 58 50 35 53 52 40 15 58 35 47 50 50 58 37 25 45 46 52 50 48 51 53 58 52 37 20 49 32 51 35 30 28 27 41 50 54 43 50 58 44 29 35 39 37 58 52 42 39 54 50 51 50 51 58 50 43 51 52 34 58 54 52 47 51 52 58 58 28 32 50 38 53 52 58 58 58 58 24 27 9 12 18 21 33 26 50 32 32 24 21 30 40 33 41 50 53 50 35 30 58 46 41 39 31 37 11 46 40 49 27 35 21 39 21 30 52 54 49 38 31 12 39 40 32 30 37 49 49 50 37 37 41 30 53 50 54 19 13 21 31 35 30 40 33 26 32 33 21 20 54 41 34 45 35 24 34 8 11 12 9 9 14 19 16 28 22 28 40 31 46 32 31 37 22 15 28 47 25 40 33 22 27 27 47 35 32 25 10 12 28 33 20 40 40 53 26 16 9 32 29 43 31 31 31 32 51 33 31 22 42 42 31 51 30 29 32 29 31 25 21 32 14 13 31 30 29 18 30 30 20 31 46 46 22 27 25 30 31 8 33 46 28 24 46 40 14 13 27 28 30 9 48 46 9 6 36 13 29 46 41 33 14 30 27 17 25 21 20 19 8 18 23 41 28 19 41 39 39 36 31 21 31 30 31 17 41 43 37 20 13 20 13 16 22 28 7 9 44 18 31 41 30 16 18 31 31 24 30 38 33 17 23 31 18 21 32 18 26 18 11 14 25 33 9 43 25 21 28 20 33 38 17 21 15 30 23 20 13 25 34 24 33 22 24 13 12 29 16 11 30 18 6 8 13 18 32 18 13 14 16 10 7 14 36 30 11 20 31 22 26 5 19 31 32 19 31 26 11 27 5 16 7 10 15 15 9 21 18 22 28 11 4 12 15 28 27 21 13 5 8 12 22 6 9 5 7 10 6 5 6 24 18 10 19 27 24 24 8 3 7 34 32 8 6 18 21 10 4 5 20 6 5 4 6 34 22 17 17 10 25 12 4 6 9 7 6 3	Open. Hide. 62 59 51 59 62 62 62 62 62 62 59 51 49 56 28 33 43 33 33 49 42 54 35 62 62 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 54 42 54 62 62 62 62 62 59 62 62 62 59 62 56 62 59 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 54 62 62 54 54 54 62 62 54 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 56 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 45 38 54 58 58 58 58 58 52 58 58 58 58 52 54 54 54 54 58 54 58 58 58 58 58 58 58 58 58 58 58 54 52 58 52 58 58 54 58 54 54 53 58 58 58 58 58 52 58 58 52 58 54 54 58 58 58 52 52 48 58 52 54 58 51 58 54 58 58 58 46 30 58 58 58 58 58 58 58 41 41 37 58 48 50 47 48 52 58 58 58 58 42 25 58 54 49 51 58 53 53 42 51 49 46 35 58 58 58 41 39 58 34 58 58 32 58 58 58 40 58 58 58 51 35 58 58 49 50 53 52 50 53 41 54 51 42 46 58 58 49 52 52 58 50 50 46 53 40 52 38 53 53 43 58 35 40 50 49 51 50 44 41 50 39 53 50 50 39 58 58 42 58 51 36 32 50 49 46 41 50 43 44 52 52 37 35 31 54 37 34 54 39 42 38 40 52 54 31 53 28 51 35 34 35 39 51 54 49 32 50 40 53 24 50 40 54 52 32 54 54 45 42 37 45 52 33 53 45 39 33 28 54 51 31 45 40 42 41 53 45 40 31 42 38 31 32 45 27 37 34 40 53 42 42 45 37 47 29 21 32 33 32 8 40 32 32 31 33 33 32 39 53 31 31 31 27 34 26 53 28 32 16 46 25 22 42 34 25 34 31 37 53 53 31 31 33 33 26 41 46 46 47 46 46 33 23 51 22 42 26 42 51 19 26 30 37 31 51 51 41 32 17 41 42 30 27 21 35 30 26 41 48 31 31 30 35 26 19 33 24 42 29 11 31 29 30 30 42 47 46 29 33 28 24 42 29 31 31 31 35 35 38 31 26 33 46 23 23 18 34 39 18 41 31 32 31 31 31 25 24 39 19 28 18 24 32 26 27 31 13 23 31 23 31 30 30 41 36 21 33 18 41 19 31 36 23 34 32 36 33 23 26 25 31 28 17 22 31 19 31 22 42 37 31 31 15 21 20 32 48 35 11 20 26 21 21 30 27 33 44 31 27 28 32 19 17 34 28 19 24 15 29 12 31 6 25 20 15 14 19 17 14 22 22 17 4 7 5 30 32 28 30 12 9 16 8 7 7 7 15 14 8 19 25 19 21 15 28 6 28 48 17 14 12 16 34 28 26 14 14 28 28 8 28 10 15 27 16 11 16 20 18 21 6 11 20 9 13 10 6 24 11 7 23 3 5 24 28 27 20 27 8 7 7 5 3 5 6 5 3 3 11 10 7 4 5 10 7 13 29 16 20 6 6 5 5 12 7 11 4 2 5 10 18 7 4 9 11 17 9 23 30 26 10 8 7 25 28 24 17 16 5 1 4 8 10 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr18_34617955_34619066
seq2: B6Ng01-188A05.b_46_1156

seq1  GAATTCTAATATTCCAAATAAGGAGGTAACTTTAGCCTGTCTACAATATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAATATTCCAAATAAGGAGGTAACTTTAGCCTGTCTACAATATG  50

seq1  TTAAATAATAAGAAATAATGTTAACTGTTAACATTAAAGTAATGTTAGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATAATAAGAAATAATGTTAACTGTTAACATTAAAGTAATGTTAGTT  100

seq1  ATTTCCTGTTATTAGGTTCCTATGAATAACACACACACACACACACACAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCCTGTTATTAGGTTCCTATGAATAACACACACACACACACACACAC  150

seq1  ACACACACACACACACACACACACACACACACACATTTTAGTCCCACAAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACACACACACACACACACACACACACACACACATTTTAGTCCCACAAC  200

seq1  AGTATTTAAGTGAAAATGAAACAGCTCTGGTGCTCCCTGAGCACACGGAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATTTAAGTGAAAATGAAACAGCTCTGGTGCTCCCTGAGCACACGGAT  250

seq1  CGTATTACAGTGATTCTGTGCACTCTCCACTGAATCCATGTTAATAGCTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTATTACAGTGATTCTGTGCACTCTCCACTGAATCCATGTTAATAGCTT  300

seq1  ACATCTCTTCTCAAATACACCATCTATAAATATATGCCAAATACAACATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTCTTCTCAAATACACCATCTATAAATATATGCCAAATACAACATT  350

seq1  ATTTTTAAGCATCACTGGAGTATGGGGGGGAGAAAGAACTTCTAGATATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTAAGCATCACTGGAGTATGGGGGGGAGAAAGAACTTCTAGATATA  400

seq1  TCTTAGAACTAAAAATTTAAATCTCATTGAAATAGCTATTGCAAAAGCAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAGAACTAAAAATTTAAATCTCATTGAAATAGCTATTGCAAAAGCAA  450

seq1  AAACAAATAGAACAATGTATTAACAGTATTAAAAATTTTTAAGTTGTATT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAATAGAACAATGTATTAACAGTATTAAAAATTTTTAAGTTGTATT  500

seq1  TTTCTTTAGAGAATAATCAAGATAGCCAGCCATTTCAGCAATTTAGTTTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTTTAGAGAATAATCAAGATAGCCAGCCATTTCAGCAATTTAGTTTA  550

seq1  ATGCTATGTAGTAGTCACTTAAGTATTATCTTTTTGTTTTGTTTTTTCAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTATGTAGTAGTCACTTAAGTATTATCTTTTTGTTTTGTTTTTTCAA  600

seq1  GACAGGGTTTCTGTGTTTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGGTTTCTGTGTTTAGCCCTGGCTGTCCTGGAACTCACTCTGTAGA  650

seq1  CCAGGCTGGCCTCGAACTCAGAAATCCCAAGTGCTGGGATTAAAGGCATG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGCTGGCCTCGAACTCAGAAATCCCAAGTGCTGGGATTAAAGGCATG  700

seq1  CGCCACCACTCCCTAGCTATGCATTATCTTTTAATAGTTTTTAGAAAATA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCACCACTCCCTAGCTATGCATTATCTTTTAATAGTTTTTAGAAAATA  750

seq1  ATTTACCTTGCCTTTGAGGCCTAGACCATTTTGGTTGACTAAAACTTGGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTACCTTGCCTTTGAGGCCTAGACCATTTTGGTTGACTAAAACTTGGG  800

seq1  TAACAAGTATGTAATCCCACAATAAACTCAACAATACAGTGATTTCAAAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACAAGTATGTAATCCCACAATAAACTCAACAATACAGTGATTTCAAAG  850

seq1  CAACCCTTGTACCTGTGTCCCAGCAGATATACTAATAATGAACATTTTAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCCTTGTACCTGTGTCCCAGCAGATATACTAATAATGAACATTTTAG  900

seq1  GAGAAATTTTAATGTTTTAAGAAAAGAATTACAAAACCCTTTTTCTGAGT  950
      ||||||||||||||||||||||||||||||||||| || |||||||||||
seq2  GAGAAATTTTAATGTTTTAAGAAAAGAATTACAAACCCTTTTTTCTGAGT  950

seq1  TTTCAACATAGAAGTTTCATGTGGGAACAGCAGGAGAAGGGCTGAAACAA  1000
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTC-ACATAGAAGTTTCATGTGGGAACAGCAGGAGAAGGGCTGAAACAA  999

seq1  GACAAACCAGTGAGCCACAGAGGAAAGCAAAGCTGAGCTGTGCGAGCCAT  1050
      ||||||||||||||||||||||| |||||||||||||||||||||| |||
seq2  GACAAACCAGTGAGCCACAGAGG-AAGCAAAGCTGAGCTGTGCGAG-CAT  1047

seq1  ACTTACCCT-CCCCAGCTC-TCTGCAGATGCATT-GTTTTGAAATCAATG  1097
      ||||||||| ||||||||| |||||||||||||| |||| |||||| |||
seq2  ACTTACCCTCCCCCAGCTCTTCTGCAGATGCATTGGTTTGGAAATC-ATG  1096

seq1  AGGGGGAAAGTGATA  1112
      |||||||||||||||
seq2  AGGGGGAAAGTGATA  1111

seq1: chr18_34746213_34747319
seq2: B6Ng01-188A05.g_63_1172 (reverse)

seq1  AGCATTTTTTTTC-TTTTATGTGCCTCTGTATGTG--CCTGTGTGAATTT  47
      |||| |||||||| |||||||||||||||||||||  |||||||| | | 
seq2  AGCAATTTTTTTCTTTTTATGTGCCTCTGTATGTGGCCCTGTGTGGAATA  50

seq1  ATGT-GCATCAAGAATGAACTGGTACCAGTAGAGCACAATAGGGTGCCCT  96
      |||| |||||||| |||| |||||||||||||||||||||||||||||| 
seq2  ATGTGGCATCAAG-ATGACCTGGTACCAGTAGAGCACAATAGGGTGCCCC  99

seq1  TGATCCTTGAT-AGTGAAGATGGTAGTGAGCTGCCTCTTATGGGTGCTGG  145
      ||||||||||| ||||||||| ||||||||||||||||||||||||||||
seq2  TGATCCTTGATAAGTGAAGAT-GTAGTGAGCTGCCTCTTATGGGTGCTGG  148

seq1  GAACTGAACCCAGGTCCTCTACAAGAGCTGCAAGGGCTCTTAACTGCTGA  195
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTGAACCCAGGTCCTCTACAAGAGCTGCAAGGGCTCTTAACTGCTGA  198

seq1  ACCATGTCTCTCCAGCCACAATAAACTATGTCACTATTACCCAATGAAGT  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATGTCTCTCCAGCCACAATAAACTATGTCACTATTACCCAATGAAGT  248

seq1  GGTTACTTTCGTTGGCTTGTTTTATATTTCTCTCTTTTTTTCTTCTTTTG  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTACTTTCGTTGGCTTGTTTTATATTTCTCTCTTTTTTTCTTCTTTTG  298

seq1  AGTCAGGGTCTCGTGTAAGACAGCTGGCCTTGAACTAACTATGTAACTGA  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCAGGGTCTCGTGTAAGACAGCTGGCCTTGAACTAACTATGTAACTGA  348

seq1  AGATGACCCTGAACTACTAAAATTTCCTTCCTCCATATTCTACAATATTT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGACCCTGAACTACTAAAATTTCCTTCCTCCATATTCTACAATATTT  398

seq1  GAATTATAGGCTTATGCCACCATGCTGGGTAAGTGTTCACTACAACTCTC  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTATAGGCTTATGCCACCATGCTGGGTAAGTGTTCACTACAACTCTC  448

seq1  AAATTGCTTGTGCCCCTTTTCTTTCTTCTCTTTCCTCCCTGCCGCAATCC  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTGCTTGTGCCCCTTTTCTTTCTTCTCTTTCCTCCCTGCCGCAATCC  498

seq1  CATGTATTTGGCAAAAGGGTCAGCTACATAGTAAGAACTATTCTAAAAAT  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTATTTGGCAAAAGGGTCAGCTACATAGTAAGAACTATTCTAAAAAT  548

seq1  CTCTGCTTACAGCCAGGCAGTGGTGGTGCACGCCTTTAATCCCAGCCAGC  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGCTTACAGCCAGGCAGTGGTGGTGCACGCCTTTAATCCCAGCCAGC  598

seq1  TGCCAGCCTGGTCAACATCCTGAGCTCCAGGATAGCCAGAGCTACACACC  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAGCCTGGTCAACATCCTGAGCTCCAGGATAGCCAGAGCTACACACC  648

seq1  CAGTCTTGAAAGTCAAACAAAAACAACAAAACAAACACAAACAAACAAAA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCTTGAAAGTCAAACAAAAACAACAAAACAAACACAAACAAACAAAA  698

seq1  CAAAACAAAACAACAACAAAGTCCAGAGTTTAGTCCAGGATGTCTTTAAA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAACAAAACAACAACAAAGTCCAGAGTTTAGTCCAGGATGTCTTTAAA  748

seq1  CTGTTCATTCAACCTTTATCCTGAATCTCCAGCTTCCCAAATGCTGGGAT  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTCATTCAACCTTTATCCTGAATCTCCAGCTTCCCAAATGCTGGGAT  798

seq1  TGCAGGTGTGTCTGCCTGGCTCACCTGTGCCTGGGCTTCTCCTGCTCAGT  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGGTGTGTCTGCCTGGCTCACCTGTGCCTGGGCTTCTCCTGCTCAGT  848

seq1  TCCCACCTGTGACTCTACAGAGCTCATCTAGAAAGTGGTTTCTCAAGTGG  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCACCTGTGACTCTACAGAGCTCATCTAGAAAGTGGTTTCTCAAGTGG  898

seq1  GCATGGTGGTACACACCTATAATCCAGCACTTTGGGAGTAGAAGCAGGAA  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGGTGGTACACACCTATAATCCAGCACTTTGGGAGTAGAAGCAGGAA  948

seq1  GACCAGAGGTTCAAGGCTACAGAATGAGTTAAAGGCCAATCTGGGCTACA  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCAGAGGTTCAAGGCTACAGAATGAGTTAAAGGCCAATCTGGGCTACA  998

seq1  TGAGATGCAGCCTCAAAAGAAAAAAAAGTTTTTGTCCAGTGTTCTTCCGT  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGATGCAGCCTCAAAAGAAAAAAAAGTTTTTGTCCAGTGTTCTTCCGT  1048

seq1  AAGTACATATAACCACCTGACACATAGTAGATGTTATTAATTCCTCATGT  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTACATATAACCACCTGACACATAGTAGATGTTATTAATTCCTCATGT  1098

seq1  ATCAAAGAATTC  1107
      ||||||||||||
seq2  ATCAAAGAATTC  1110

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information