MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-211I02
Chromosome	18 (Build37)
Map Location	12,594,826 - 12,714,814
singlet/doublet	doublet
Overlap gene	Lama3
Upstream gene	LOC665310, LOC100040148, Rbbp8, LOC621998, Cables1, 6030446N20Rik, Riok3, 3110002H16Rik, Npc1, Ankrd29
Downstream gene	2810439F02Rik, Cabyr, LOC665356, Osbpl1a, LOC435556, Impact, Hrh4, EG383354, LOC665379
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC665310 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665310
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040148 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 47 ESTs

name	Rbbp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225182 MGI:2442995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC621998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Cables1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63955 MGI:1927065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030446N20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338363 MGI:2442435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Riok3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66878 MGI:1914128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110002H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76482 MGI:1916528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18145 MGI:1097712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225187 MGI:2687055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 1 Protein

name	Lama3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16774 MGI:99909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 15 ESTs, 5 Proteins

name	2810439F02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72747 MGI:1919997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cabyr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71132 MGI:1918382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	LOC665356 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Osbpl1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64291 MGI:1927551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435556 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 704 ESTs, 7 Proteins pseudo : _no_value

name	Impact (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16210 MGI:1098233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hrh4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225192 MGI:2429635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG383354 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:383354 MGI:3645528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC665379 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100040148 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269644 GeneID:100040148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 47 ESTs product : similar to gag protein transcript_id : XM_001474216.1

name	Rbbp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487004 GeneID:225182 MGI:2442995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoblastoma binding protein 8 transcript_id : NM_001081223.1

name	LOC621998 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269648 GeneID:621998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC621998 transcript_id : XM_001474307.1

name	Cables1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11528507 GeneID:63955 MGI:1927065
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdk5 and Abl enzyme substrate 1 transcript_id : NM_022021.1

name	6030446N20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348079 GeneID:338363 MGI:2442435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030446N20 gene transcript_id : NM_178801.3

name	Riok3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388970 GeneID:66878 MGI:1914128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIO kinase 3 (yeast) transcript_id : NM_024182.4

name	3110002H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89242135 GeneID:76482 MGI:1916528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110002H16 gene transcript_id : NM_029623.2

name	Npc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89242145 GeneID:18145 MGI:1097712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Niemann Pick type C1 transcript_id : NM_008720.2

name	Ankrd29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269652 GeneID:225187 MGI:2687055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 1 Protein product : ankyrin repeat domain 29 transcript_id : XM_129028.6

name	Lama3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404299 GeneID:16774 MGI:99909
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 15 ESTs, 5 Proteins product : laminin, alpha 3, transcript variant 1 transcript_id : XM_140451.7

name	2810439F02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353858 GeneID:72747 MGI:1919997
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810439F02 gene transcript_id : NM_028341.2

name	Cabyr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560782 GeneID:71132 MGI:1918382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2) transcript_id : NM_027687.2

name	Cabyr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109255219 GeneID:71132 MGI:1918382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2) transcript_id : NM_001042418.1

name	Cabyr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109255223 GeneID:71132 MGI:1918382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2) transcript_id : NM_001042420.1

name	Cabyr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109255217 GeneID:71132 MGI:1918382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2) transcript_id : NM_181731.3

name	Cabyr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109255221 GeneID:71132 MGI:1918382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2) transcript_id : NM_001042419.1

name	Osbpl1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52345395 GeneID:64291 MGI:1927551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 1A transcript_id : NM_207530.2

name	Impact (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130830 GeneID:16210 MGI:1098233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : imprinted and ancient transcript_id : NM_008378.2

name	Hrh4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346506 GeneID:225192 MGI:2429635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histamine H4 receptor transcript_id : NM_153087.1

name	LOC100040148 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269645 GeneID:100040148
definition	codon_start : 1 product : similar to gag protein protein_id : XP_001474266.1

name	Rbbp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487005 GeneID:225182 MGI:2442995
definition	GO_process : GO:0001835 - blastocyst hatching [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP] codon_start : 1 product : retinoblastoma binding protein 8 protein_id : NP_001074692.1

name	LOC621998 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269649 GeneID:621998
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474357.1

name	Cables1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528508 CCDS:CCDS29061.1 GeneID:63955 MGI:1927065
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016538 - cyclin-dependent protein kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence TAS]; GO:0007399 - nervous system development [Evidence IMP]; GO:0051726 - regulation of cell cycle [Evidence IEA]; GO:0051302 - regulation of cell division [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS] codon_start : 1 exception : mismatches in translation note : interactor-1 with cdk3 product : Cdk5 and Abl enzyme substrate 1 protein_id : NP_071304.1

name	6030446N20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520297 GeneID:338363 MGI:2442435
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC338363 protein_id : NP_848916.1

name	Riok3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625737 CCDS:CCDS29062.1 GeneID:66878 MGI:1914128
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : sudD, suppressor of bimD6 homolog product : RIO kinase 3 protein_id : NP_077144.2

name	3110002H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077063 CCDS:CCDS29063.1 GeneID:76482 MGI:1916528
definition	codon_start : 1 product : colon cancer-associated protein Mic1 homolog protein_id : NP_083899.1

name	Npc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89242146 CCDS:CCDS29064.1 GeneID:18145 MGI:1097712
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0008158 - hedgehog receptor activity [Evidence IEA]; GO:0005478 - intracellular transporter activity [Evidence IMP] [Evidence ISS]; GO:0015248 - sterol transporter activity [Evidence ISS] GO_process : GO:0008206 - bile acid metabolism [Evidence ISS] [Evidence IMP]; GO:0042632 - cholesterol homeostasis [Evidence ISS] [Evidence IMP]; GO:0030301 - cholesterol transport [Evidence IEA]; GO:0006897 - endocytosis [Evidence IMP]; GO:0007041 - lysosomal transport [Evidence ISS] [Evidence IMP] codon_start : 1 note : sphingomyelinosis product : Niemann Pick type C1 protein_id : NP_032746.2

name	Ankrd29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269653 GeneID:225187 MGI:2687055
definition	codon_start : 1 product : similar to ankyrin repeat domain 29 protein_id : XP_129028.5

name	Lama3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82995771 GeneID:16774 MGI:99909
definition	codon_start : 1 product : laminin, alpha 3 isoform 1 protein_id : XP_140451.6

name	2810439F02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312214 CCDS:CCDS29065.1 GeneID:72747 MGI:1919997
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72747 protein_id : NP_082617.1

name	Cabyr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109255218 GeneID:71132 MGI:1918382
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 2; calcium-binding tyrosine-phosphorylation regulated protein, isoform 2 product : calcium-binding tyrosine-phosphorylation regulated protein isoform c protein_id : NP_859420.2

name	Cabyr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109255222 GeneID:71132 MGI:1918382
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform e is encoded by transcript variant 4; calcium-binding tyrosine-phosphorylation regulated protein, isoform 2 product : calcium-binding tyrosine-phosphorylation regulated protein isoform e protein_id : NP_001035884.1

name	Cabyr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109255220 GeneID:71132 MGI:1918382
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 3; calcium-binding tyrosine-phosphorylation regulated protein, isoform 2 product : calcium-binding tyrosine-phosphorylation regulated protein isoform a protein_id : NP_001035883.1

name	Cabyr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109255224 GeneID:71132 MGI:1918382
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 5; calcium-binding tyrosine-phosphorylation regulated protein, isoform 2 product : calcium-binding tyrosine-phosphorylation regulated protein isoform a protein_id : NP_001035885.1

name	Cabyr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312836 GeneID:71132 MGI:1918382
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0008603 - cAMP-dependent protein kinase regulator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; calcium-binding tyrosine-phosphorylation regulated protein, isoform 2 product : calcium-binding tyrosine-phosphorylation regulated protein isoform a protein_id : NP_081963.1

name	Osbpl1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52345396 CCDS:CCDS29067.1 GeneID:64291 MGI:1927551
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : oxysterol binding protein-like 1 protein_id : NP_997413.2

name	Impact (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680447 CCDS:CCDS29068.1 GeneID:16210 MGI:1098233
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001933 - negative regulation of protein amino acid phosphorylation [Evidence IDA]; GO:0006446 - regulation of translational initiation [Evidence IDA] codon_start : 1 product : imprinted and ancient protein_id : NP_032404.1

name	Hrh4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346507 CCDS:CCDS29069.1 GeneID:225192 MGI:2429635
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004969 - histamine receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006954 - inflammatory response [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : histamine H4 receptor protein_id : NP_694727.1

name	LOC665310 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665310
definition	number : 1 pseudo : _no_value

name	EG383354 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:383354
definition	number : 1 pseudo : _no_value

name	LOC665379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665379
definition	number : 1 pseudo : _no_value

name	LOC665356 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149269654 GeneID:665356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to CDK105 pseudo : _no_value transcript_id : XR_031786.1

name	LOC435556 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149269655 GeneID:435556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 704 ESTs, 7 Proteins product : similar to ribosomal protein S8 pseudo : _no_value transcript_id : XR_031851.1

clone name	MSMg01-460N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106F11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-045G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-202G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146J14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-211I02.b	B6Ng01-211I02.g
ACC	GA029557	GA029558
length	1,114	1,136
definition	B6Ng01-211I02.b	B6Ng01-211I02.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(12,713,696 - 12,714,814)	(12,594,826 - 12,595,920)
sequence	gaattcattctctcctgcataagttttatagattcatcatctttaggatt ttcccctatgtggggttacaatgacgacaccttttctgtgatttccatga ctgttttatgttctggtcattatttctaggaagcccaattttccatgcca acctgttctcatccaaaccctggcaagatgattgacccttacagtaaatg agttacttaaacctatcctcatttcacttctattcagtcttctttatcaa gtctaatttttgaagttttccatacaatgtgggttctcagtgaacttctc atctacagcaatttgtccagtgcagttatagccagtgatggctacagaag tgatgacttttgctgctattgaatgggatagactgtgtttcttaacagtt tatgagcttgaaagcaatgtcccttagacatttccatagtccctctatag cactgggttgctctaacttgttgctaatctaatccgtacatctgcttttg atcatcctgtggactgtgaactagctgtacttacctgtggcagaagaaaa aaggactaggaattaaaagtgctaggtcaaggctgggggcatagcttagt caataaagtgctaggtcagggctgggggcatagcttagtcaataaagtgc taggtcagggctgggggcatggcttagtcaataaagtgctatgtcagggc tgggggcatggcttagccagtaaagtgctaggtcagggctgggggcatgg cttagtcaataaagtgctaggtcagggctgggggcatggcttagtcaata aagtgctaggtcagggctgggggcatggcttagtcaataaagtgctaggt cagggctgggggcatggcttagtcaataaagtgctaggtcaggctgggac atggctcagtcaataagtacttgtcacacaaggaacaaaaggtctgaacc ttcatcccacaaagggtttcagaacccagaacccacatagaaaaagctgg gtacattggtgttattgcttataatcccagttgagagttaaacaggatga tccgcagagttgttggtagctagctagctactggtgagcccaaggctggt gagagaaactttgt	gaattcaacttgtgttgtaattctgccagtccaggttgaaagccaggctc tcagcagtctgcctgggctgtaggagattggcctttctctgggaaagaca caagaactatggggccatttatgctggcgagctgggcatcaaagtctaga actcttctgtgctgcctccacagggagaaacagccagccaatgccattat actattagctgacaaaaaccgaaccaaaccaaaccaaaacccatctatct cagttaccaaatcctcagactattgacttcatacatgtttgattaggggt acccagaagcaatgtgcttgcttctttgctgtcacttcaagatgcgttat cacggatctcttctttcaagggtggatggaggcagtaaaggtaggctaga aagccacttccacgagctcccaaagcaactcaaacagtcgtcagagtccg ctcctgcagaaagcaggctagatctgcactgataattaattaaaccaaat tgatagtgcagctgataaatttaaaaggaaccaaaaatctgtatttgact ccaaagaaacagatgcagaagggatgcacacacacacgtgcacaaacaca catgcacacacacacacacacacacagagagagaggatttagttcacata cttatgcttttgactattcagctctgactctaattttcctaaagcccaca tttttatgtgacgggagggtgttatgataggctcaggctagtccagaagt tactatatagtccagggctgagctgaaactttcaggaattctcctgcctc ggcctcccaggatgctgtatactctgtctagcagtctattgatcagactg ggtaaatctcatatataaaacatggtttgtagctatgttgaatactgggt ggttttgatcaaaacaatgtaggccactaaaacctagccaagcctgacct caacaaaaaacaacagaccacagatgtccaagaaacatttcttctaaaaa atcttacccaggttagaaactttattcttcttacaaaacagaactttgtt ggggtcccaccaagggctcagggaatggaaactttgtggggaagaacata cagtaattccatgtccttaatcatgtggcctcccaa
quality values	Open. Hide. 62 31 22 27 62 31 31 47 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 59 62 62 59 54 36 36 27 23 11 28 23 25 28 28 32 34 43 59 51 62 54 59 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 34 56 59 40 59 59 56 56 54 49 54 62 62 62 62 59 59 62 62 62 62 59 62 59 54 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 54 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 59 59 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 46 54 56 59 50 59 62 62 54 54 54 49 54 62 62 62 62 62 51 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 44 54 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 58 58 58 58 46 58 58 58 58 42 58 58 58 58 58 54 54 58 52 58 58 58 54 58 58 54 58 58 54 58 58 54 58 58 54 58 58 58 49 58 58 58 58 52 54 54 54 39 58 58 58 54 54 58 58 54 58 54 42 58 58 54 45 58 58 58 54 49 58 50 48 53 53 58 58 54 58 50 58 58 58 49 52 52 50 54 51 58 58 53 50 27 58 52 52 58 49 50 41 41 46 50 51 53 58 50 31 58 39 49 50 24 38 38 48 51 51 58 54 58 58 37 40 50 58 58 52 58 54 58 25 51 53 46 54 46 50 58 51 32 50 51 41 53 42 42 58 53 53 49 26 58 49 50 50 50 58 58 58 58 41 38 37 50 58 40 33 54 50 16 58 37 26 43 39 32 58 58 38 39 45 39 53 37 34 49 39 41 40 6 38 44 47 53 31 54 54 54 44 32 42 42 27 38 40 33 33 41 13 39 41 33 33 53 40 54 54 41 42 52 37 47 33 35 35 24 40 52 37 54 31 21 38 35 54 54 54 37 37 33 37 32 54 39 35 6 16 12 34 45 35 21 32 45 52 51 33 27 41 32 34 36 28 37 35 34 40 10 46 40 32 21 22 49 49 49 40 31 33 39 32 40 30 38 35 30 6 23 33 33 33 39 32 51 14 28 33 29 23 37 13 19 24 24 39 34 29 46 23 25 31 31 51 51 51 36 12 23 34 31 33 10 11 23 32 16 30 30 30 31 24 28 46 41 29 32 18 24 37 27 24 25 17 31 9 10 17 9 19 44 46 8 30 22 24 26 35 33 26 31 31 31 11 31 31 21 25 31 19 13 15 25 19 20 30 29 33 31 31 16 19 23 32 22 25 14 25 8 7 10 12 28 28 11 18 30 9 21 20 17 21 25 16 18 31 44 27 18 31 19 41 22 16 15 13 36 21 25 48 33 13 38 17 27 24 12 28 12 17 32 25 15 5 20 25 13 43 15 11 29 13 10 11 4 4 40 48 48 27 16 32 34 16 48 24 4 14 17 31 11 9 20 20 25 10 6 5 11 6 17 20 32 26 21 19 16 24 12 7 5 30 16 3 4 13 8 3 3 6 5 11 8 7 22 34 18 15 21 11 10 18 16 11 13 7 7 6 23 5 12 10 17 5 19 20 18 10 16 7 22 7 4 8 18 16 16 7 16 21 9 4 11 8 13 8 25 16 9 5 8 15 4 12 28 24 5 6 9 11 17 16 25 11 12 12 19 6 10 7 7 18 12 5 14 26 7 15 10	Open. Hide. 62 38 30 47 62 37 32 56 62 62 25 34 18 27 25 22 23 28 34 34 28 34 32 40 59 59 59 49 62 62 62 59 59 62 62 62 62 62 59 54 42 62 62 62 59 62 62 62 62 62 62 62 59 62 49 43 30 37 50 48 34 43 50 35 42 54 56 59 62 62 62 62 62 62 54 54 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 49 38 56 59 62 62 62 62 62 62 62 62 62 62 56 59 46 54 56 62 59 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 56 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 56 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 59 59 56 38 56 59 62 59 62 62 62 62 54 48 56 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 49 59 62 62 59 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 50 32 36 50 56 43 56 47 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 51 62 46 37 56 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 35 62 62 62 62 62 62 62 56 62 47 47 62 62 62 62 62 62 62 49 43 52 62 46 62 62 54 39 62 62 62 62 62 62 62 46 54 47 54 54 52 62 62 62 62 62 62 54 54 58 58 58 58 47 58 58 36 26 54 45 54 58 58 52 54 54 54 58 58 58 58 41 42 58 54 38 58 58 54 30 58 52 58 54 58 58 54 54 52 45 37 58 54 54 54 46 52 54 35 58 58 54 54 58 54 58 54 58 58 58 40 58 52 58 35 54 49 58 54 58 45 58 52 58 50 58 50 58 51 49 24 47 45 38 41 49 58 49 37 34 58 41 38 58 51 41 41 52 58 51 52 46 50 45 48 48 50 50 50 51 58 50 58 58 58 41 49 50 27 40 34 51 53 53 47 30 41 53 53 53 32 58 32 53 49 32 19 54 39 58 58 50 52 47 39 26 39 40 33 51 32 32 40 40 19 29 58 58 58 49 39 50 39 35 28 25 21 6 58 29 52 21 58 54 28 49 28 33 33 24 43 36 39 41 16 54 49 53 41 41 21 37 27 49 37 15 52 40 40 28 19 38 42 15 54 49 29 29 35 49 35 32 39 35 31 37 28 32 21 13 40 16 28 37 35 26 7 49 40 29 41 37 27 33 37 34 27 28 13 7 45 29 24 28 47 41 37 53 49 25 33 27 28 26 31 30 14 47 42 31 32 47 33 26 12 40 33 18 53 32 18 31 31 31 36 27 32 32 42 32 27 10 41 40 31 29 13 23 23 32 24 31 32 43 31 36 31 34 34 32 23 31 13 12 19 51 31 30 28 46 11 30 39 35 33 27 23 30 14 12 27 31 46 46 22 23 32 16 12 24 46 46 16 40 16 31 17 12 9 8 18 31 27 32 14 19 9 8 9 16 29 18 48 24 14 14 21 11 44 48 13 18 16 14 34 17 18 31 9 19 7 10 12 10 27 24 8 9 20 26 13 15 27 32 41 46 17 15 36 30 29 12 31 35 18 18 17 13 13 11 11 9 6 9 27 32 10 6 13 26 26 32 22 27 25 31 24 7 17 14 9 32 8 6 8 22 13 5 5 5 19 6 22 24 22 33 9 13 29 19 10 9 20 48 22 9 11 6 22 5 5 33 33 34 37 7 10 12 14 6 5 22 39 11 9 4 4 6 7 11 17 30 48 31 28 31 48 11 18 4 4 6 7 6 8 10 9 16 13 8 21 27 21 4 3 6 11 14 6 15 27 6 21 4 8 21 30 21 4 3 6 28 5 8 6 9 16 18 6 22 13 11 9 18 7 6 28 13 9 10 20 18 16 9 23 23 3 3 29 6 3 2 4 27 8 5 11 4 6 9 6 6 4 6 7 9 5 6 3 5 6 16 8 7 18 9 5 4 5 9 16 4 2 1 1 3 8 6 12 11 6 6 9 5 4 5 7 14 18 6 22

Alignment Information

BAC End 1

BAC End 2

seq1: chr18_12713696_12714814
seq2: B6Ng01-211I02.b_50_1163 (reverse)

seq1  ACAAAG--TCTCTCACCAGCCTGGGGCTCACCAAGTAGGCTAAGCTAGCT  48
      ||||||  |||||||||||||| ||||||||| |||| ||| ||||||||
seq2  ACAAAGTTTCTCTCACCAGCCTTGGGCTCACC-AGTA-GCT-AGCTAGCT  47

seq1  AACCAACAAACTCTGCCGATCATCCTGTTTTAACCTCCCCAACCTTGGGA  98
       |||||| |||||||| ||||||||||||| |  ||   ||||  |||||
seq2  -ACCAAC-AACTCTGCGGATCATCCTGTTTAACTCT---CAAC--TGGGA  90

seq1  TTATAAGCA--TACACCATTGTACCCAGCTTTTTCTATGTGGGTTCTGGG  146
      |||||||||   |||||| |||||||||||||||||||||||||||||||
seq2  TTATAAGCAATAACACCAATGTACCCAGCTTTTTCTATGTGGGTTCTGGG  140

seq1  TTCTG-AACCCTTTGTGGGATGAAGGTTCAGACCTTT--GTCCTTGTGTG  193
      ||||| |||||||||||||||||||||||||||||||   ||||||||||
seq2  TTCTGAAACCCTTTGTGGGATGAAGGTTCAGACCTTTTGTTCCTTGTGTG  190

seq1  ACAAGTACTTTATTGACTGAGCCATGTCCCAGCCCTGACCTAGCACTTTA  243
      |||||||| ||||||||||||||||||||||| |||||||||||||||||
seq2  ACAAGTAC-TTATTGACTGAGCCATGTCCCAG-CCTGACCTAGCACTTTA  238

seq1  TTGACTAAGCCATGCCCCCAGCCCTGACCTAGCACTTTATTGACTAAGCC  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGACTAAGCCATGCCCCCAGCCCTGACCTAGCACTTTATTGACTAAGCC  288

seq1  ATGCCCCCAGCCCTGACCTAGCACTTTATTGACTAAGCCATGCCCCCAGC  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCCCCCAGCCCTGACCTAGCACTTTATTGACTAAGCCATGCCCCCAGC  338

seq1  CCTGACCTAGCACTTTATTGACTAAGCCATGCCCCCAGCCCTGACCTAGC  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGACCTAGCACTTTATTGACTAAGCCATGCCCCCAGCCCTGACCTAGC  388

seq1  ACTTTACTGGCTAAGCCATGCCCCCAGCCCTGACATAGCACTTTATTGAC  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTACTGGCTAAGCCATGCCCCCAGCCCTGACATAGCACTTTATTGAC  438

seq1  TAAGCCATGCCCCCAGCCCTGACCTAGCACTTTATTGACTAAGCTATGCC  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGCCATGCCCCCAGCCCTGACCTAGCACTTTATTGACTAAGCTATGCC  488

seq1  CCCAGCCCTGACCTAGCACTTTATTGACTAAGCTATGCCCCCAGCCTTGA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCCCTGACCTAGCACTTTATTGACTAAGCTATGCCCCCAGCCTTGA  538

seq1  CCTAGCACTTTTAATTCCTAGTCCTTTTTTCTTCTGCCACAGGTAAGTAC  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGCACTTTTAATTCCTAGTCCTTTTTTCTTCTGCCACAGGTAAGTAC  588

seq1  AGCTAGTTCACAGTCCACAGGATGATCAAAAGCAGATGTACGGATTAGAT  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTAGTTCACAGTCCACAGGATGATCAAAAGCAGATGTACGGATTAGAT  638

seq1  TAGCAACAAGTTAGAGCAACCCAGTGCTATAGAGGGACTATGGAAATGTC  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCAACAAGTTAGAGCAACCCAGTGCTATAGAGGGACTATGGAAATGTC  688

seq1  TAAGGGACATTGCTTTCAAGCTCATAAACTGTTAAGAAACACAGTCTATC  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGGACATTGCTTTCAAGCTCATAAACTGTTAAGAAACACAGTCTATC  738

seq1  CCATTCAATAGCAGCAAAAGTCATCACTTCTGTAGCCATCACTGGCTATA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTCAATAGCAGCAAAAGTCATCACTTCTGTAGCCATCACTGGCTATA  788

seq1  ACTGCACTGGACAAATTGCTGTAGATGAGAAGTTCACTGAGAACCCACAT  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCACTGGACAAATTGCTGTAGATGAGAAGTTCACTGAGAACCCACAT  838

seq1  TGTATGGAAAACTTCAAAAATTAGACTTGATAAAGAAGACTGAATAGAAG  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATGGAAAACTTCAAAAATTAGACTTGATAAAGAAGACTGAATAGAAG  888

seq1  TGAAATGAGGATAGGTTTAAGTAACTCATTTACTGTAAGGGTCAATCATC  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAATGAGGATAGGTTTAAGTAACTCATTTACTGTAAGGGTCAATCATC  938

seq1  TTGCCAGGGTTTGGATGAGAACAGGTTGGCATGGAAAATTGGGCTTCCTA  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCAGGGTTTGGATGAGAACAGGTTGGCATGGAAAATTGGGCTTCCTA  988

seq1  GAAATAATGACCAGAACATAAAACAGTCATGGAAATCACAGAAAAGGTGT  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATAATGACCAGAACATAAAACAGTCATGGAAATCACAGAAAAGGTGT  1038

seq1  CGTCATTGTAACCCCACATAGGGGAAAATCCTAAAGATGATGAATCTATA  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTCATTGTAACCCCACATAGGGGAAAATCCTAAAGATGATGAATCTATA  1088

seq1  AAACTTATGCAGGAGAGAATGAATTC  1119
      ||||||||||||||||||||||||||
seq2  AAACTTATGCAGGAGAGAATGAATTC  1114

seq1: chr18_12594826_12595920
seq2: B6Ng01-211I02.g_72_1207

seq1  GAATTCAACTTGTGTTGTAATTCTGCCAGTCCAGGTTGAAAGCCAGGCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAACTTGTGTTGTAATTCTGCCAGTCCAGGTTGAAAGCCAGGCTC  50

seq1  TCAGCAGTCTGCCTGGGCTGTAGGAGATTGGCCTTTCTCTGGGAAAGACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCAGTCTGCCTGGGCTGTAGGAGATTGGCCTTTCTCTGGGAAAGACA  100

seq1  CAAGAACTATGGGGCCATTTATGCTGGCGAGCTGGGCATCAAAGTCTAGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAACTATGGGGCCATTTATGCTGGCGAGCTGGGCATCAAAGTCTAGA  150

seq1  ACTCTTCTGTGCTGCCTCCACAGGGAGAAACAGCCAGCCAATGCCATTAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTTCTGTGCTGCCTCCACAGGGAGAAACAGCCAGCCAATGCCATTAT  200

seq1  ACTATTAGCTGACAAAAACCGAACCAAACCAAACCAAAACCCATCTATCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTATTAGCTGACAAAAACCGAACCAAACCAAACCAAAACCCATCTATCT  250

seq1  CAGTTACCAAATCCTCAGACTATTGACTTCATACATGTTTGATTAGGGGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTACCAAATCCTCAGACTATTGACTTCATACATGTTTGATTAGGGGT  300

seq1  ACCCAGAAGCAATGTGCTTGCTTCTTTGCTGTCACTTCAAGATGCGTTAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCAGAAGCAATGTGCTTGCTTCTTTGCTGTCACTTCAAGATGCGTTAT  350

seq1  CACGGATCTCTTCTTTCAAGGGTGGATGGAGGCAGTAAAGGTAGGCTAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGGATCTCTTCTTTCAAGGGTGGATGGAGGCAGTAAAGGTAGGCTAGA  400

seq1  AAGCCACTTCCACGAGCTCCCAAAGCAACTCAAACAGTCGTCAGAGTCCG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCACTTCCACGAGCTCCCAAAGCAACTCAAACAGTCGTCAGAGTCCG  450

seq1  CTCCTGCAGAAAGCAGGCTAGATCTGCACTGATAATTAATTAAACCAAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGCAGAAAGCAGGCTAGATCTGCACTGATAATTAATTAAACCAAAT  500

seq1  TGATAGTGCAGCTGATAAATTTAAAAGGAACCAAAAATCTGTATTTGACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATAGTGCAGCTGATAAATTTAAAAGGAACCAAAAATCTGTATTTGACT  550

seq1  CCAAAGAAACAGATGCAGAAGGGATGCACACACACACGTGCACAAACACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAAGAAACAGATGCAGAAGGGATGCACACACACACGTGCACAAACACA  600

seq1  CATGCACACACACACACACACACACAGAGAGAGAGGATTTAGTTCACATA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCACACACACACACACACACACAGAGAGAGAGGATTTAGTTCACATA  650

seq1  CTTATGCTTTTGACTATTCAGCTCTGACTCTAATTTTCCTAAAGCCCACA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTATGCTTTTGACTATTCAGCTCTGACTCTAATTTTCCTAAAGCCCACA  700

seq1  TTTTTATGTGAC-GGAGGGTGTTATGATAGGCTCAGGCTAGTCCAGAAGT  749
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  TTTTTATGTGACGGGAGGGTGTTATGATAGGCTCAGGCTAGTCCAGAAGT  750

seq1  TACTATATAGTCCA-GGCTGAGCTGAAACTTTCAGGAATTCTCCTGCCTC  798
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  TACTATATAGTCCAGGGCTGAGCTGAAACTTTCAGGAATTCTCCTGCCTC  800

seq1  GGCCTCCCAGGATGCTGTATACTCTGTCTAGCAAGTCTATTGATCAGACT  848
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  GGCCTCCCAGGATGCTGTATACTCTGTCTAGC-AGTCTATTGATCAGACT  849

seq1  GG--TAATCTCATATATAAAACAT-GTTTGTAGCTATGTTG-ATACT-GG  893
      ||   ||||||||||||||||||| |||||||||||||||| ||||| ||
seq2  GGGTAAATCTCATATATAAAACATGGTTTGTAGCTATGTTGAATACTGGG  899

seq1  TG--TTTGATCAAA--CATGTA-GCCACTAAAACCTAGCCAAG-CTGA-C  936
      ||  ||||||||||   ||||| |||||||||||||||||||| |||| |
seq2  TGGTTTTGATCAAAACAATGTAGGCCACTAAAACCTAGCCAAGCCTGACC  949

seq1  TCA--CAAAAACAACAGA-CACAGA-GGCCAAG-AACATTTC-TCT-AAA  979
      |||   |||||||||||| |||||| | ||||| |||||||| ||| |||
seq2  TCAACAAAAAACAACAGACCACAGATGTCCAAGAAACATTTCTTCTAAAA  999

seq1  AATC-TACCCAAGGTAGAAACTTAATCTCTAC-----AAACAGA--CTTG  1021
      |||| |||||| | ||||||||| || ||| |     |||||||   |||
seq2  AATCTTACCCAGGTTAGAAACTTTAT-TCTTCTTACAAAACAGAACTTTG  1048

seq1  GTGGGG--CCA-CAAGG--CCAGG--ATGGAACTTTGGTGGAG----ACA  1060
       |||||  ||| |||||   ||||  ||||||  || |||| |    |||
seq2  TTGGGGTCCCACCAAGGGCTCAGGGAATGGAAACTTTGTGGGGAAGAACA  1098

seq1  TACAGTA--TCCATGTCCTTGTTCATGTGG-CTCCCAA  1095
      |||||||  |||||||||||  |||||||| |||||||
seq2  TACAGTAATTCCATGTCCTTAATCATGTGGCCTCCCAA  1136

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information