MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-324J06
Chromosome	18 (Build37)
Map Location	33,803,494 - 33,962,779
singlet/doublet	doublet
Overlap gene	LOC100041258, Epb4.1l4a
Upstream gene	LOC100041170, Tslp, Wdr36, Camk4, Stard4, EG433170, D0H4S114, ENSMUSG00000073610, LOC666281
Downstream gene	EG666296, Ppia-ps18_318.1, Ppia-ps18_319.1, LOC666313, Apc, Srp19, Reep5, Pkd2l2, 2610024E20Rik, Wnt8a, Nme5, 4933408B17Rik, Brd8, Kif20a, Cdc23, Gfra3, Cdc25c, LOC100041859, 2810012G03Rik, LOC100041879, LOC100041887, Jmjd1b
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041170 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041170
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	Tslp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53603 MGI:1855696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225348 MGI:1917819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12326 MGI:88258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stard4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170459 MGI:2156764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG433170 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433170 MGI:3646950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	D0H4S114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27528 MGI:99444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000073610 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:433171 MGI:3641986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC666281 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100041258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Epb4.1l4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13824 MGI:103007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666296 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666296 MGI:3645021
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Ppia-ps18_318.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606517
definition	note : peptidylprolyl isomerase A pseudogene 18_318.1 pseudo : _no_value

name	Ppia-ps18_319.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:383339
definition	note : peptidyl-prolyl cis-trans isomerase A pseudogene chr18_319.1 pseudo : _no_value

name	LOC666313 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Apc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11789 MGI:88039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srp19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66384 MGI:1913634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Reep5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13476 MGI:1270152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkd2l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53871 MGI:1858231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610024E20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:225358 MGI:2447834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnt8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20890 MGI:107924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nme5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75533 MGI:1922783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933408B17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271508 MGI:3045347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78656 MGI:1925906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif20a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19348 MGI:1201682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52563 MGI:1098815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gfra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14587 MGI:1201403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc25c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12532 MGI:88350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 873 ESTs, 5 Proteins

name	2810012G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66306 MGI:1913556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041879 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100041887 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs

name	Jmjd1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277250 MGI:1923356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041170 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269695 GeneID:100041170
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to loricrin transcript_id : XM_001475913.1

name	Tslp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946697 GeneID:53603 MGI:1855696
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymic stromal lymphopoietin transcript_id : NM_021367.1

name	Wdr36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374488 GeneID:225348 MGI:1917819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 36 transcript_id : NM_144863.3

name	Camk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377596 GeneID:12326 MGI:88258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase IV transcript_id : NM_009793.2

name	Stard4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803493 GeneID:170459 MGI:2156764
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : StAR-related lipid transfer (START) domain containing 4 transcript_id : NM_133774.3

name	EG433170 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94404359 GeneID:433170 MGI:3646950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG433170 transcript_id : XM_982610.1

name	D0H4S114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33186876 GeneID:27528 MGI:99444
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, human D4S114 transcript_id : NM_053078.3

name	ENSMUSG00000073610 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149269697 GeneID:433171 MGI:3641986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, ENSMUSG00000073610 transcript_id : XM_001476022.1

name	Epb4.1l4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87042271 GeneID:13824 MGI:103007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : erythrocyte protein band 4.1-like 4a transcript_id : NM_013512.2

name	LOC666313 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94404363 GeneID:666313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC666313 transcript_id : XM_982985.1

name	Apc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110225369 GeneID:11789 MGI:88039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenomatosis polyposis coli transcript_id : NM_007462.2

name	Srp19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365535 GeneID:66384 MGI:1913634
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal recognition particle 19 transcript_id : NM_025527.2

name	Reep5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542567 GeneID:13476 MGI:1270152
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor accessory protein 5 transcript_id : NM_007874.2

name	Pkd2l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350821 GeneID:53871 MGI:1858231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease 2-like 2 transcript_id : NM_016927.2

name	2610024E20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122578 GeneID:225358 MGI:2447834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610024E20 gene transcript_id : NM_146084.1

name	Wnt8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678168 GeneID:20890 MGI:107924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wingless-related MMTV integration site 8A transcript_id : NM_009290.1

name	Nme5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359743 GeneID:75533 MGI:1922783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 5 transcript_id : NM_080637.3

name	4933408B17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382686 GeneID:271508 MGI:3045347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933408B17 gene transcript_id : NM_177773.3

name	Brd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:69354973 GeneID:78656 MGI:1925906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bromodomain containing 8 transcript_id : NM_030147.2

name	Kif20a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385767 GeneID:19348 MGI:1201682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 20A transcript_id : NM_009004.3

name	Cdc23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369947 GeneID:52563 MGI:1098815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC23 (cell division cycle 23, yeast, homolog) transcript_id : NM_178347.3

name	Gfra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981761 GeneID:14587 MGI:1201403
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glial cell line derived neurotrophic factor family receptor alpha 3 transcript_id : NM_010280.2

name	Cdc25c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122114544 GeneID:12532 MGI:88350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 25 homolog C (S. pombe) transcript_id : NM_009860.2

name	LOC100041859 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269723 GeneID:100041859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 873 ESTs, 5 Proteins product : similar to ribosomal protein transcript_id : XM_001477476.1

name	2810012G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129841 GeneID:66306 MGI:1913556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810012G03 gene transcript_id : NM_175104.4

name	LOC100041879 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269727 GeneID:100041879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100041879 transcript_id : XM_001477557.1

name	LOC100041887 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149269729 GeneID:100041887
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs product : hypothetical protein LOC100041887 transcript_id : XM_001477572.1

name	Jmjd1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486934 GeneID:277250 MGI:1923356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji domain containing 1B transcript_id : NM_001081256.1

name	LOC100041170 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269696 GeneID:100041170
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475963.1

name	Tslp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946698 CCDS:CCDS29121.1 GeneID:53603 MGI:1855696
definition	GO_function : GO:0005125 - cytokine activity [Evidence IDA] codon_start : 1 product : thymic stromal lymphopoietin protein_id : NP_067342.1

name	Wdr36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542010 GeneID:225348 MGI:1917819
definition	GO_component : GO:0005732 - small nucleolar ribonucleoprotein complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0030515 - snoRNA binding [Evidence ISS] GO_process : GO:0006364 - rRNA processing [Evidence ISS] codon_start : 1 product : WD repeat domain 36 protein_id : NP_659112.2

name	Camk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753252 CCDS:CCDS29122.1 GeneID:12326 MGI:88258
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0004683 - calmodulin regulated protein kinase activity [Evidence TAS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007270 - nerve-nerve synaptic transmission [Evidence IMP]; GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Ca2+/calmodulin-dependent protein kinase type IV/Gr product : calcium/calmodulin-dependent protein kinase IV protein_id : NP_033923.1

name	Stard4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526998 CCDS:CCDS29123.1 GeneID:170459 MGI:2156764
definition	GO_component : GO:0005739 - mitochondrion [Evidence TAS] GO_function : GO:0015485 - cholesterol binding [Evidence IEA] [Evidence ISS]; GO:0017127 - cholesterol transporter activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : StAR-related lipid transfer protein 4 product : StAR-related lipid transfer (START) domain containing 4 protein_id : NP_598535.1

name	EG433170 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94404360 GeneID:433170 MGI:3646950
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987704.1

name	D0H4S114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716357 GeneID:27528 MGI:99444
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence IDA] codon_start : 1 product : neuronal protein 3.1 protein_id : NP_444308.1

name	ENSMUSG00000073610 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149269698 GeneID:433171 MGI:3641986
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476072.1

name	Epb4.1l4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87042272 CCDS:CCDS29124.1 GeneID:13824 MGI:103007
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : erythrocyte protein band 4.1-like 4 product : erythrocyte protein band 4.1-like 4a protein_id : NP_038540.2

name	LOC666313 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94404364 GeneID:666313
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988079.1

name	Apc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110225370 CCDS:CCDS29125.1 GeneID:11789 MGI:88039
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016328 - lateral plasma membrane [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0008013 - beta-catenin binding [Evidence IDA] [Evidence IPI]; GO:0005488 - binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0009798 - axis specification [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IDA] [Evidence IMP] codon_start : 1 note : multiple intestinal neoplasia product : adenomatosis polyposis coli protein_id : NP_031488.2

name	Srp19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384948 GeneID:66384 MGI:1913634
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005786 - signal recognition particle (sensu Eukaryota) [Evidence IEA] GO_function : GO:0008312 - 7S RNA binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : signal recognition particle 19 protein_id : NP_079803.1

name	Reep5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542568 GeneID:13476 MGI:1270152
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : receptor expression enhancing protein 5; deleted in polyposis 1 product : receptor accessory protein 5 protein_id : NP_031900.2

name	Pkd2l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393965 CCDS:CCDS29127.1 GeneID:53871 MGI:1858231
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Polycystin - L2 product : polycystic kidney disease 2-like 2 protein_id : NP_058623.1

name	2610024E20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122579 CCDS:CCDS29128.1 GeneID:225358 MGI:2447834
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : expressed sequence AW060714 protein_id : NP_666196.1

name	Wnt8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678169 CCDS:CCDS29129.1 GeneID:20890 MGI:107924
definition	GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007223 - frizzled-2 signaling pathway [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : stimulated by retinoic acid gene 11; wingless-related MMTV integration site 8D product : wingless-related MMTV integration site 8A protein_id : NP_033316.1

name	Nme5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625839 CCDS:CCDS29130.1 GeneID:75533 MGI:1922783
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0000302 - response to reactive oxygen species [Evidence NAS]; GO:0007286 - spermatid development [Evidence IDA]; GO:0048515 - spermatid differentiation [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 product : expressed in non-metastatic cells 5 protein_id : NP_542368.2

name	4933408B17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244282 GeneID:271508 MGI:3045347
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC271508 protein_id : NP_808441.1

name	Brd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536234 GeneID:78656 MGI:1925906
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : bromodomain containing 8 protein_id : NP_084423.1

name	Kif20a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679597 CCDS:CCDS29131.1 GeneID:19348 MGI:1201682
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0051301 - cell division [Evidence IEA]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Rab6, kinesin-like; Rabkinesin-6 product : kinesin family member 20A protein_id : NP_033030.1

name	Cdc23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30387632 CCDS:CCDS29132.1 GeneID:52563 MGI:1098815
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : CDC23 (cell division cycle 23, yeast, homolog) protein_id : NP_848124.1

name	Gfra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981762 CCDS:CCDS29133.1 GeneID:14587 MGI:1201403
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008046 - axon guidance receptor activity [Evidence IMP]; GO:0015026 - coreceptor activity [Evidence TAS]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence TAS] codon_start : 1 exception : mismatches in translation product : glial cell line derived neurotrophic factor family receptor alpha 3 protein_id : NP_034410.2

name	Cdc25c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122114545 GeneID:12532 MGI:88350
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000087 - M phase of mitotic cell cycle [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : cell division cycle control protein 25C; cell cycle phosphatase CDC25C product : cell division cycle 25 homolog C protein_id : NP_033990.2

name	LOC100041859 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269724 GeneID:100041859
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_001477526.1

name	LOC100041879 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269728 GeneID:100041879
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477607.1

name	2810012G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424703 CCDS:CCDS29134.1 GeneID:66306 MGI:1913556
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : family 53, member C protein protein_id : NP_780313.1

name	LOC100041887 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149269730 GeneID:100041887
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477622.1

name	Jmjd1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486935 GeneID:277250 MGI:1923356
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : jumonji domain containing 1B protein_id : NP_001074725.1

name	LOC666281 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666281
definition	number : 1 pseudo : _no_value

name	LOC666281 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666281
definition	number : 2 pseudo : _no_value

name	LOC666281 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666281
definition	number : 3 pseudo : _no_value

name	LOC666281 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666281
definition	number : 4 pseudo : _no_value

name	LOC100041258 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041258
definition	number : 3 pseudo : _no_value

name	LOC100041258 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041258
definition	number : 2 pseudo : _no_value

name	LOC100041258 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041258
definition	number : 1 pseudo : _no_value

name	EG666296 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666296
definition	number : 1 pseudo : _no_value

clone name	MSMg01-134L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184K24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-217B08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-503G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215B22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-142C10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-260K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-324J06.b	B6Ng01-324J06.g
ACC	GA112855	GA112856
length	1,102	1,072
definition	B6Ng01-324J06.b	B6Ng01-324J06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(33,803,494 - 33,804,602)	(33,961,707 - 33,962,779)
sequence	gaattctaaaggacaataacaaaataataaaacaaaagtgaacccatcag agttggacaggacaaaccaatagaaggaaaagagcccaagagaaggcaca agaatcagagaccccattgttcatactctcaagaatcccataaaaacact gaactaaaagccgtaagatagtcacagaggacctggtacagagccacaca ggccctgtgcatgctgcctcatcactgtgagttcataagcttcattattt gaaaacatttgaaaagttgttatgcagaaagaggaataggttaacgagaa ggtgactcacaaagagaatcaaggaaaacagaagtcaatgccatgggaaa agattcttcactcaggatgcatgagaagccacccatgtactctagtgtct tccagattcaataggactcacacacacacacacacacacacacacacaca cacacacacactacatgtacaaactcacaaagactatggttgcatgcaca ggggctgcacagtttcaagccagttgaggtcccattgctgaaaggggaag tagacactagttcccatccctaaccaagaaactatctccagtactccagt agacatctgtttgcaatggaaaatgttttttcctgtggagtctcactgga tagatcaagcccacttgagagcaggctccagccccagcagtagatgtcaa cacaaaacgaacttaatgatatatttgtagactttttctttcatatttct ttgttttgtcagaggttttttttttgtcttactagtcttttgtttattta ttatgatttcactctgtggatcagatggtctttcacttgtgatttttttc tcctcttctgcctctcaagtgctgggattacaggtgcccaacaccatgcc cacctttcatgttaaaagtttgacatgaggttttatgcatttgtgatcca attaattaggttaagacacaaatgtaggcctttaagctttagcataaata tagtatttataaatggtgattccctgtgcagcatgtctgtgtttttaggt gattttcctctctaatattttcctaatttttattaatttctttatttaca tt	gaattctcttctgcttaaaactagcgggcagttggtgaaatggctcggca ggttaggggtacctactgccttgcctaggaactgagtccttgggaccagc gtggtgaagggagagagctgagtgctgcagactgtcctgagtgcacagtg atatgcacacatgtgcacacataaataaatgccacgaaacagtagatagt aagccgaggaaccaaagcccctacgtcacttgctatttaacaccagctgg ctaggctggcttcaaacctgtggtgagacccctgcctctgcctctcaagt gctgagaatatgggtctgtcaccaagcccggcttccaggctctttcataa atgaacctctggtgatgactcatttccatttttgtacattcatgtgagtc tcgcttgccagtagtgaagtaacctgctaccttttcactgataattgtga tggctcctcatcagcagctgggtggcaagtgagacctcacaaaagtattg caggtcactcaaggtttgtgaatggcatgcattgtaggggtgaattttgt ctcctttgcttacagaagaagtcctgacatccaagcaaaagaagaactgt ggaagcacatccagtgagtactgggacccccggatgggtaccatttcaga atatatatgtgagtgttgtacatgtgcacgcccggtgcttctggatcccc tgcaactagaattatggatgacggtgaggcaccatgtgggtgttgaacct cggccttgtgcaagagcagcaaatgctcttaatcgctgagccgtacagcc agcaggatatgggcagttttgaattggatacaagataaaccaatgctact gcaaggagccttggtttggcgccctggcaggtgccgtgctctggtgatgc ctccggcaggtgccacgctcctccctgtatcctctggtgctgacatcagg gttgggcctcatacaccagctgctgtctataggcagaccaatgcctcctg tccaagtcttctagttgcctgtaaatgccacctccagctagccagtggtt tacaaaggaatgcaagagaagc
quality values	Open. Hide. 58 31 32 30 58 58 62 52 62 62 62 62 41 34 43 62 62 62 62 47 42 62 62 62 62 62 62 62 62 62 62 43 43 29 28 32 28 34 44 46 43 49 62 62 59 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 49 43 54 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 42 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 46 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 52 52 54 58 54 54 58 54 54 58 58 54 58 52 54 54 58 58 52 58 58 52 58 58 54 58 54 54 54 52 54 58 48 41 41 58 52 58 58 58 48 54 54 58 58 58 58 54 54 58 58 58 54 58 58 38 46 52 58 58 43 46 52 52 58 54 58 58 58 58 58 58 48 46 49 50 58 53 54 52 54 58 47 58 49 58 58 58 58 51 41 58 58 58 50 58 48 58 42 51 58 52 58 53 51 49 58 54 58 32 54 49 46 39 49 49 58 46 51 51 48 50 53 53 58 58 51 53 58 37 50 48 28 58 48 50 49 58 50 50 54 58 58 58 40 28 51 53 33 42 52 41 51 50 58 41 47 32 53 53 53 51 35 51 44 51 31 50 53 58 41 53 58 50 58 40 51 52 38 50 53 41 28 49 24 46 39 53 42 53 31 51 54 54 38 50 49 52 54 49 39 40 45 52 41 54 51 45 42 54 34 37 19 54 50 47 39 14 30 39 31 51 10 44 24 54 54 54 54 54 54 54 54 35 41 31 53 37 40 40 32 37 41 31 31 40 31 54 54 31 47 42 54 39 35 31 49 35 41 38 37 36 34 31 41 31 49 47 32 30 32 52 45 32 47 23 51 40 21 33 36 45 18 53 28 20 40 20 47 30 46 41 31 31 31 27 29 31 30 30 31 26 47 47 51 51 51 30 31 31 42 46 31 32 31 35 31 35 41 26 46 30 33 15 20 31 32 30 19 29 31 36 28 37 23 28 18 29 17 28 29 33 48 29 37 28 46 18 16 32 25 30 31 32 25 33 34 22 47 31 26 32 32 41 48 42 33 30 36 42 19 25 27 46 48 35 22 31 41 27 24 31 24 25 31 31 26 29 28 27 44 41 24 24 25 32 34 28 36 48 29 31 26 31 31 33 31 32 12 6 11 17 8 33 9 15 10 12 8 19 22 21 32 18 44 17 16 16 19 43 22 22 26 13 18 18 26 13 21 12 40 31 9 25 22 30 22 48 14 28 17 22 32 19 20 39 21 34 24 24 7 6 19 21 24 48 32 34 11 19 21 18 15 20 12 4 13 19 7 16 13 47 27 10 21 16 27 27 27 14 13 16 9 23 10 28 13 21 5 18 14 40 40 40 18 9 7 6 19 12 19 11 28 40 8 27 30 18 23 6 4 3 7 11 3 3 3 26 21 16 11 4 2 4 7 8 7 17 9 3 2 2 10 10 8 21 9 11 12 5 22 6 24 7 28 13 10 12 5 14 11	Open. Hide. 46 47 51 47 62 62 62 62 49 37 34 22 28 23 27 44 34 36 28 32 31 28 20 34 51 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 49 43 54 43 43 59 59 59 54 54 62 59 59 62 62 62 62 62 59 62 62 59 62 62 62 59 62 59 62 59 59 59 59 62 62 62 62 59 62 62 59 59 62 59 62 62 62 59 59 62 62 62 59 62 56 62 62 59 59 59 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 46 46 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 54 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 42 46 41 58 58 58 58 44 42 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 54 49 52 58 58 50 58 54 52 54 54 54 54 54 49 49 50 58 58 42 46 58 49 58 54 58 58 58 40 58 58 50 58 47 49 58 58 58 49 49 58 58 37 54 35 48 47 58 58 54 50 54 47 58 54 50 50 50 51 58 58 58 58 41 32 43 41 58 51 38 58 46 50 58 58 42 50 40 41 49 50 51 58 58 47 41 25 58 53 42 46 52 41 58 44 41 51 51 54 58 50 54 58 39 58 58 50 50 50 50 51 51 53 51 50 41 52 32 58 51 50 37 58 32 51 47 54 40 41 50 58 50 37 39 27 54 50 54 41 52 47 25 36 40 37 37 41 33 47 27 53 38 41 54 51 37 37 39 47 39 29 54 27 32 33 16 35 26 42 37 49 18 52 54 33 28 32 49 52 45 54 40 33 49 34 21 42 41 40 40 51 25 44 42 54 40 40 37 35 22 44 30 54 20 45 42 31 33 25 54 46 32 52 31 53 52 35 25 33 30 34 32 34 40 53 30 46 10 31 31 26 31 32 31 37 34 29 34 29 32 32 31 15 53 31 34 29 32 28 49 46 30 31 30 33 46 46 36 24 30 25 33 30 15 6 32 27 30 31 20 20 19 31 17 31 51 22 22 30 25 32 30 31 33 35 32 43 35 42 25 32 23 7 40 31 11 30 31 31 17 31 20 20 48 32 30 30 29 26 26 46 21 15 18 25 16 22 22 31 21 32 27 35 28 13 32 31 43 26 30 15 33 13 31 32 18 32 31 41 34 31 15 11 24 21 26 15 29 21 31 36 38 18 20 11 37 31 25 23 27 14 29 9 25 31 15 17 31 25 25 21 25 33 31 38 31 32 24 31 23 37 27 31 38 32 19 15 43 24 24 26 29 33 18 20 34 33 26 18 31 24 11 10 20 26 18 18 14 23 23 21 27 32 15 12 8 12 31 27 25 30 15 15 13 17 6 22 12 8 9 17 29 22 16 18 26 24 33 29 19 20 15 9 17 7 19 10 15 7 31 21 6 9 7 19 15 21 28 28 26 14 40 11 13 18 16 5 4 18 23 11 5 17 14 4 9 28 14 16 3 4 8 6 6 5 12 7 47 26 7 9 7 26 13 11 8 8 8 9 9 13 21 8 4 7 3 5 25 10 20

Alignment Information

BAC End 1

BAC End 2

seq1: chr18_33803494_33804602
seq2: B6Ng01-324J06.b_43_1144

seq1  GAATTCTAAAGGACAATAACAAAATAATAAAACAAAAGTGAACCCATCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAAAGGACAATAACAAAATAATAAAACAAAAGTGAACCCATCAG  50

seq1  AGTTGGACAGGACAAACCAATAGAAGGAAAAGAGCCCAAGAGAAGGCACA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGGACAGGACAAACCAATAGAAGGAAAAGAGCCCAAGAGAAGGCACA  100

seq1  AGAATCAGAGACCCCATTGTTCATACTCTCAAGAATCCCATAAAAACACT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATCAGAGACCCCATTGTTCATACTCTCAAGAATCCCATAAAAACACT  150

seq1  GAACTAAAAGCCGTAAGATAGTCACAGAGGACCTGGTACAGAGCCACACA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTAAAAGCCGTAAGATAGTCACAGAGGACCTGGTACAGAGCCACACA  200

seq1  GGCCCTGTGCATGCTGCCTCATCACTGTGAGTTCATAAGCTTCATTATTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCTGTGCATGCTGCCTCATCACTGTGAGTTCATAAGCTTCATTATTT  250

seq1  GAAAACATTTGAAAAGTTGTTATGCAGAAAGAGGAATAGGTTAACGAGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAACATTTGAAAAGTTGTTATGCAGAAAGAGGAATAGGTTAACGAGAA  300

seq1  GGTGACTCACAAAGAGAATCAAGGAAAACAGAAGTCAATGCCATGGGAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGACTCACAAAGAGAATCAAGGAAAACAGAAGTCAATGCCATGGGAAA  350

seq1  AGATTCTTCACTCAGGATGCATGAGAAGCCACCCATGTACTCTAGTGTCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATTCTTCACTCAGGATGCATGAGAAGCCACCCATGTACTCTAGTGTCT  400

seq1  TCCAGATTCAATAGGACTCACACACACACACACACACACACACACACACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGATTCAATAGGACTCACACACACACACACACACACACACACACACA  450

seq1  CACACACACACTACATGTACAAACTCACAAAGACTATGGTTGCATGCACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACACACACTACATGTACAAACTCACAAAGACTATGGTTGCATGCACA  500

seq1  GGGGCTGCACAGTTTCAAGCCAGTTGAGGTCCCATTGCTGAAAGGGGAAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGCTGCACAGTTTCAAGCCAGTTGAGGTCCCATTGCTGAAAGGGGAAG  550

seq1  TAGACACTAGTTCCCATCCCTAACCAAGAAACTATCTCCAGTACTCCAGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGACACTAGTTCCCATCCCTAACCAAGAAACTATCTCCAGTACTCCAGT  600

seq1  AGACATCTGTTTGCAATGGAAAATGTTTTTTCCTGTGGAGTCTCACTGGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACATCTGTTTGCAATGGAAAATGTTTTTTCCTGTGGAGTCTCACTGGA  650

seq1  TAGATCAAGCCCACTTGAGAGCAGGCTCCAGCCCCAGCAGTAGATGTCAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATCAAGCCCACTTGAGAGCAGGCTCCAGCCCCAGCAGTAGATGTCAA  700

seq1  CACAAAACGAACTTAATGATATATTTGTAGACTTTTTCTTTCATATTTCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAAACGAACTTAATGATATATTTGTAGACTTTTTCTTTCATATTTCT  750

seq1  TTGTTTTGTCAGAGGTTTTTTTTTTGTCTTACTAGTCTTTTGTTTATTTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTTGTCAGAGGTTTTTTTTTTGTCTTACTAGTCTTTTGTTTATTTA  800

seq1  TTATGATTTCACTCTGTGGATCAGATGGTCTTTCACTTGTGATTTTTTTC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGATTTCACTCTGTGGATCAGATGGTCTTTCACTTGTGATTTTTTTC  850

seq1  TCCTCTTCTGCCTCTCAAGTGCTGGGATTACAGGTGCCCAACACCATGCC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTTCTGCCTCTCAAGTGCTGGGATTACAGGTGCCCAACACCATGCC  900

seq1  CACCTTTCATGTTAAAAGTTTGACATGAGGTTTTATGCATTTGTGATCCA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  CACCTTTCATGTTAAAAGTTTGACATGAGGTTTTATGCATTTGTGATCC-  949

seq1  AATTAATTAGGTTAAGAACACAAATGTAGGCCTTTAAGCTTTAAGCATAA  1000
      |||||||||||||||| ||||||||||||||||||||||||| |||||||
seq2  AATTAATTAGGTTAAG-ACACAAATGTAGGCCTTTAAGCTTT-AGCATAA  997

seq1  ATATTAGTATTTATAAATGGTGATTCCCTGTGCAGCATGTCTGTGTTTTT  1050
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATA-TAGTATTTATAAATGGTGATTCCCTGTGCAGCATGTCTGTGTTTTT  1046

seq1  AGTTGATTTTCCCTCTCTAATATTTTTCCTTATTTTTTATTATTTTCTTT  1100
      || ||||||| |||||||||||||||  | || ||||||||| |||||||
seq2  AGGTGATTTT-CCTCTCTAATATTTT--CCTAATTTTTATTAATTTCTTT  1093

seq1  ATTTACATT  1109
      |||||||||
seq2  ATTTACATT  1102

seq1: chr18_33961707_33962779
seq2: B6Ng01-324J06.g_68_1139 (reverse)

seq1  GCTTCTCTTTGCATTCCTTTGTAAACCACTGGCCTAGCT-GAGGT-GCAT  48
      ||||||| |||||||||||||||||||||||| |||||| ||||| ||||
seq2  GCTTCTC-TTGCATTCCTTTGTAAACCACTGG-CTAGCTGGAGGTGGCAT  48

seq1  TTACAGGCAAACTAAGAGACCTTGGACAGGAGGCATTGGTCTGCCTATAG  98
      |||||||| |||||  ||| ||||||||||||||||||||||||||||||
seq2  TTACAGGC-AACTAGAAGA-CTTGGACAGGAGGCATTGGTCTGCCTATAG  96

seq1  ACAGCAGCTGGTGTATGAGGCCCAACCCTGATGTCAGCACCAGAGGATAC  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGCAGCTGGTGTATGAGGCCCAACCCTGATGTCAGCACCAGAGGATAC  146

seq1  A-GGAGGAGCGTGGCACCTGCCGGAGGCATCACCAGAGCACGGCACCTGC  197
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAGGAGCGTGGCACCTGCCGGAGGCATCACCAGAGCACGGCACCTGC  196

seq1  CAGGGCGCCAAACCAAGGCTCCTTGCAGTAGCATTGGTTTATCTTGTATC  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGCGCCAAACCAAGGCTCCTTGCAGTAGCATTGGTTTATCTTGTATC  246

seq1  CAATTCAAAACTGCCCATATCCTGCTGGCTGTACGGCTCAGCGATTAAGA  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATTCAAAACTGCCCATATCCTGCTGGCTGTACGGCTCAGCGATTAAGA  296

seq1  GCATTTGCTGCTCTTGCACAAGGCCGAGGTTCAACACCCACATGGTGCCT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATTTGCTGCTCTTGCACAAGGCCGAGGTTCAACACCCACATGGTGCCT  346

seq1  CACCGTCATCCATAATTCTAGTTGCAGGGGATCCAGAAGCACCGGGCGTG  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCGTCATCCATAATTCTAGTTGCAGGGGATCCAGAAGCACCGGGCGTG  396

seq1  CACATGTACAACACTCACATATATATTCTGAAATGGTACCCATCCGGGGG  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATGTACAACACTCACATATATATTCTGAAATGGTACCCATCCGGGGG  446

seq1  TCCCAGTACTCACTGGATGTGCTTCCACAGTTCTTCTTTTGCTTGGATGT  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGTACTCACTGGATGTGCTTCCACAGTTCTTCTTTTGCTTGGATGT  496

seq1  CAGGACTTCTTCTGTAAGCAAAGGAGACAAAATTCACCCCTACAATGCAT  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGACTTCTTCTGTAAGCAAAGGAGACAAAATTCACCCCTACAATGCAT  546

seq1  GCCATTCACAAACCTTGAGTGACCTGCAATACTTTTGTGAGGTCTCACTT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCATTCACAAACCTTGAGTGACCTGCAATACTTTTGTGAGGTCTCACTT  596

seq1  GCCACCCAGCTGCTGATGAGGAGCCATCACAATTATCAGTGAAAAGGTAG  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCACCCAGCTGCTGATGAGGAGCCATCACAATTATCAGTGAAAAGGTAG  646

seq1  CAGGTTACTTCACTACTGGCAAGCGAGACTCACATGAATGTACAAAAATG  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTTACTTCACTACTGGCAAGCGAGACTCACATGAATGTACAAAAATG  696

seq1  GAAATGAGTCATCACCAGAGGTTCATTTATGAAAGAGCCTGGAAGCCGGG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATGAGTCATCACCAGAGGTTCATTTATGAAAGAGCCTGGAAGCCGGG  746

seq1  CTTGGTGACAGACCCATATTCTCAGCACTTGAGAGGCAGAGGCAGGGGTC  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGTGACAGACCCATATTCTCAGCACTTGAGAGGCAGAGGCAGGGGTC  796

seq1  TCACCACAGGTTTGAAGCCAGCCTAGCCAGCTGGTGTTAAATAGCAAGTG  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCACAGGTTTGAAGCCAGCCTAGCCAGCTGGTGTTAAATAGCAAGTG  846

seq1  ACGTAGGGGCTTTGGTTCCTCGGCTTACTATCTACTGTTTCGTGGCATTT  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTAGGGGCTTTGGTTCCTCGGCTTACTATCTACTGTTTCGTGGCATTT  896

seq1  ATTTATGTGTGCACATGTGTGCATATCACTGTGCACTCAGGACAGTCTGC  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATGTGTGCACATGTGTGCATATCACTGTGCACTCAGGACAGTCTGC  946

seq1  AGCACTCAGCTCTCTCCCTTCACCACGCTGGTCCCAAGGACTCAGTTCCT  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACTCAGCTCTCTCCCTTCACCACGCTGGTCCCAAGGACTCAGTTCCT  996

seq1  AGGCAAGGCAGTAGGTACCCCTAACCTGCCGAGCCATTTCACCAACTGCC  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAAGGCAGTAGGTACCCCTAACCTGCCGAGCCATTTCACCAACTGCC  1046

seq1  CGCTAGTTTTAAGCAGAAGAGAATTC  1073
      ||||||||||||||||||||||||||
seq2  CGCTAGTTTTAAGCAGAAGAGAATTC  1072

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information